ID: 1042218205

View in Genome Browser
Species Human (GRCh38)
Location 8:66448496-66448518
Sequence CCAGTTTACTAGCACACCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 162
Summary {0: 1, 1: 2, 2: 12, 3: 39, 4: 108}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042218205_1042218208 26 Left 1042218205 8:66448496-66448518 CCAGTGGTGTGCTAGTAAACTGG 0: 1
1: 2
2: 12
3: 39
4: 108
Right 1042218208 8:66448545-66448567 TAAGCCCTGACTTGTAGTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042218205 Original CRISPR CCAGTTTACTAGCACACCAC TGG (reversed) Intronic
902601846 1:17545262-17545284 CCTGTTTACCAGCACACCACTGG + Intronic
905243739 1:36597892-36597914 CCGATTTACCAGCACACTACTGG + Intergenic
911444507 1:97973645-97973667 CCAGCTTACCAGAACACCACTGG - Intergenic
912963229 1:114214413-114214435 ACAGTTTACCAGCACCCCACTGG - Intergenic
913296202 1:117323047-117323069 CCAGTTAACCAGCACACCGCTGG + Intergenic
913441448 1:118902405-118902427 CCAGTTTTCTAGCACAGTGCTGG + Intronic
914689876 1:150016358-150016380 AATATTTACTAGCACACCACTGG - Intergenic
915078847 1:153337453-153337475 CTAGTTTACCAGCACTCCATTGG - Intronic
918108596 1:181435191-181435213 AATGTTTACCAGCACACCACTGG + Intronic
922241225 1:223756565-223756587 CCAGTTTCCCAGCACACCCCTGG + Intronic
1065131952 10:22631067-22631089 ACGGTATACTAACACACCACAGG + Intronic
1067043695 10:42971916-42971938 CCAGTGCACTAGGACACCACTGG + Intergenic
1074935522 10:118175984-118176006 TCAGTTTACCAGCACACCATTGG - Intergenic
1075532147 10:123238723-123238745 GCAGTTTACCAGCACACCAGTGG + Intergenic
1075899922 10:126033269-126033291 CCAGTTTGCCAGCATACCATTGG + Intronic
1078007802 11:7545718-7545740 CCAGTTTGCTAGCACAGAAAAGG + Intronic
1079032293 11:16994651-16994673 CCAGTGTCCTAGAACACGACAGG + Intronic
1079765320 11:24385217-24385239 CCAGTCTACTAGAAGATCACTGG + Intergenic
1079765375 11:24385895-24385917 CCAGTCTACTAGAAGATCACTGG - Intergenic
1079942326 11:26696918-26696940 GCAGTTTACTAACTCACCATAGG + Intronic
1081189069 11:40081036-40081058 CCATATCACTAGGACACCACTGG + Intergenic
1081909840 11:46693912-46693934 GCCATTTACCAGCACACCACTGG + Intronic
1085516463 11:77114774-77114796 GCAGTTTACCAGCACAGCACAGG - Intronic
1085580062 11:77642433-77642455 CCAGGTTACTAGAACAACTCAGG + Intergenic
1086949323 11:92875547-92875569 CTGGTTTACCAGCACACCCCTGG - Intronic
1087020804 11:93601144-93601166 GCAGTTTAGCAGCACACCACAGG + Intergenic
1087311720 11:96551504-96551526 AATGTTTACCAGCACACCACTGG + Intergenic
1088052707 11:105537402-105537424 CCAGATTAATAGCACATCACAGG - Intergenic
1093201462 12:16191883-16191905 CCTGTTGACGAGCACCCCACAGG - Intronic
1095493702 12:42762549-42762571 TCATTTTACCAGCACACCACTGG + Intergenic
1095743751 12:45634808-45634830 GCAGTTTCCTAGCACCCCATGGG + Intergenic
1095928587 12:47604169-47604191 CTGGTTTACCAGCACACCACTGG - Intergenic
1097938103 12:65276060-65276082 AATGTTTACCAGCACACCACTGG + Intergenic
1099666056 12:85630892-85630914 CCAATTTGCTAGCACACCACTGG - Intergenic
1101467921 12:104966898-104966920 CCAGTTTAGCGGTACACCACTGG - Intergenic
1102962796 12:117104208-117104230 CTTGTTTACCAGCTCACCACTGG - Intergenic
1107566029 13:41605454-41605476 ACCATTTACTAGCACACTACTGG - Intronic
1107571671 13:41666653-41666675 CTAGTTTACTAGCACGCCACCGG + Intronic
1112144334 13:96680574-96680596 ACAGTGTACTAGCACACCTGAGG + Intronic
1112588554 13:100742547-100742569 AACATTTACTAGCACACCACTGG + Intergenic
1116348489 14:43828002-43828024 CTAGTTTACTATCCCACCAACGG + Intergenic
1116923022 14:50601413-50601435 ACATTTTGCCAGCACACCACTGG - Intronic
1116923555 14:50608496-50608518 CCAGTTTATCAGCACATCACTGG + Intronic
1117305935 14:54473119-54473141 CCAGATTACCAGCTCATCACAGG - Intergenic
1118912193 14:70070805-70070827 CTGGTTTATTAGCTCACCACTGG - Intronic
1120672278 14:87376358-87376380 CCATTTTAGTAGCACTCAACTGG - Intergenic
1126539721 15:49808474-49808496 CTGGTTTACCAGCACACCACTGG + Intergenic
1128131731 15:65232523-65232545 GCCAGTTACTAGCACACCACTGG + Intergenic
1130038225 15:80380817-80380839 AAAATTTACCAGCACACCACTGG + Intronic
1130811979 15:87389355-87389377 CCAGGTAACCAGCACACCAATGG - Intergenic
1131992775 15:98106720-98106742 CCAGTTTGCCAGCAAACCACAGG - Intergenic
1132098154 15:99003753-99003775 CCAGTTTGCCAGCAAACCACAGG + Intronic
1133112686 16:3558005-3558027 CCAGTTTACCAGTACACCACTGG - Intronic
1133941497 16:10312876-10312898 AACATTTACTAGCACACCACAGG + Intergenic
1136272363 16:29155955-29155977 CCAGGTCACTCGCACACGACCGG - Intergenic
1136632499 16:31497103-31497125 CCAGTTTCCTAGAACAGGACAGG - Intronic
1137809735 16:51341515-51341537 GGAGTTTACAAGCACGCCACAGG - Intergenic
1139028694 16:62852408-62852430 CCAGTTTATTAGCACACCACTGG - Intergenic
1142075924 16:88117766-88117788 CCAGGTCACTTGCACACGACCGG - Intronic
1145011241 17:19369480-19369502 CTACTTTACCAGCACATCACTGG + Intronic
1145788006 17:27606567-27606589 CACATTTACCAGCACACCACTGG - Intronic
1148448174 17:47754027-47754049 CTGGTTTACTACCACACCACTGG + Intergenic
1151781719 17:76251099-76251121 CCAGTTTACCAGCATACCCCTGG + Intergenic
1152505057 17:80743930-80743952 CCTGGTTACTAGCACAGCCCTGG + Intronic
1152505068 17:80744002-80744024 CCTGGTTACTAGCACAGCCCTGG + Intronic
1152505071 17:80744020-80744042 CCTGGTTACTAGCACAGCCCTGG + Intronic
1152505074 17:80744038-80744060 CCTGGTTACTAGCACAGCCCTGG + Intronic
1152505082 17:80744092-80744114 CCTGGTTACTAGCACAGCCCTGG + Intronic
1152505085 17:80744110-80744132 CCTGGTTACTAGCACAGCCCTGG + Intronic
1152505090 17:80744146-80744168 CCTGGTTACTAGCACAGCCCTGG + Intronic
1152505113 17:80744308-80744330 CCTGGTTACTAGCACAGCCCTGG + Intronic
1152505134 17:80744452-80744474 CCTGGTTACTAGCACAGCCCTGG + Intronic
1152505137 17:80744470-80744492 CCTGGTTACTAGCACAGCCCTGG + Intronic
1152505155 17:80744596-80744618 CCTGGTTACTAGCACAGCCCTGG + Intronic
1158909374 18:62044782-62044804 CAAAGCTACTAGCACACCACGGG + Exonic
1159605906 18:70474628-70474650 CCAGTTTACCAGCACAACACTGG - Intergenic
1162206354 19:9059054-9059076 CCATTTTACAAGCACTCCAGGGG + Intergenic
925881144 2:8353536-8353558 CCAGTTTACTATCATACCACTGG - Intergenic
926494546 2:13568712-13568734 CCATTTTACATGCACACCAATGG - Intergenic
929299685 2:40288732-40288754 CTAGTTTACCAGCACACCAGTGG + Intronic
930224845 2:48781519-48781541 CTGGTTTACCAGCACAGCACTGG - Intergenic
936652902 2:114450034-114450056 CCATTTTGGTAGCACAGCACTGG - Intronic
938552251 2:132393249-132393271 TCAGTTTACCAGCACACCGCTGG + Intergenic
939023822 2:136988524-136988546 CCAGTTTACTCACACACCAGTGG - Intronic
942943974 2:181653301-181653323 CTAGTTTACAATCATACCACCGG - Intronic
943381980 2:187161628-187161650 CCAGTTTACTTGCACACCTTTGG - Intergenic
944358339 2:198820630-198820652 CCAGTTTACCAGCACACCCCTGG - Intergenic
946986489 2:225279700-225279722 CCAGTCTACTGCCACACCACTGG - Intergenic
947144592 2:227053108-227053130 CTAGTTTACTAGCCCATCACTGG + Intronic
948489086 2:238300152-238300174 CACATTAACTAGCACACCACTGG - Intergenic
1174567766 20:51479145-51479167 AACGTTTACTAGCACATCACTGG + Intronic
1179570571 21:42276216-42276238 CCCGTTTGCTAACACAGCACTGG - Intronic
1180033457 21:45228778-45228800 AGCATTTACTAGCACACCACTGG + Intergenic
1182345956 22:29664986-29665008 CCAGTTTACTATTAAACCACTGG + Exonic
1182741815 22:32573143-32573165 CCAGTTTGCCAGCACACCACTGG + Intronic
1183426661 22:37743407-37743429 CCAGTTTAATAACTCACCCCTGG + Intronic
950311902 3:11966187-11966209 TCAGTTTACCAGCAAATCACAGG - Intergenic
953840922 3:46389726-46389748 CCACTTTACTAGCTCACAAAGGG - Intergenic
955271786 3:57506768-57506790 CCATATTTCTAGCACACTACTGG + Intronic
959861294 3:111217994-111218016 CCAATTAACTTGCACACCATAGG - Intronic
961463965 3:127070340-127070362 CCAGGTGACAAGCACGCCACTGG + Intergenic
965836979 3:172863573-172863595 CCAGTTTTCCAGCACACCTTTGG - Intergenic
965850537 3:173017504-173017526 CCAGGTTACCAGCATACCATTGG - Intronic
975582215 4:75917381-75917403 CTGGTTTACTAGCAGACCACTGG + Intronic
977113182 4:92986541-92986563 CTACTTTGGTAGCACACCACTGG + Intronic
978819712 4:112951658-112951680 AATGTTTACTAGCACACCACTGG - Intronic
979358768 4:119736634-119736656 AACGTTTACCAGCACACCACTGG - Intergenic
981354230 4:143768695-143768717 TGAGTTTATCAGCACACCACCGG - Intergenic
981887742 4:149697566-149697588 CAAATTTACCAGCACACCATTGG + Intergenic
982596433 4:157391093-157391115 CCAATTTACCAGCACACCATTGG - Intergenic
984133683 4:175910006-175910028 TCAGCTTACTAGCACACCACTGG - Intronic
986679110 5:10217430-10217452 CCAATTAACTCACACACCACTGG + Intergenic
992486814 5:77205079-77205101 CCTGTTAACAAGCACCCCACAGG - Intergenic
993983682 5:94572024-94572046 GCACACTACTAGCACACCACAGG - Intronic
996601924 5:125274094-125274116 CCCATTTACCAGCATACCACCGG - Intergenic
998320968 5:141230787-141230809 CCAGTTTACTCTCACTCCAAGGG - Intergenic
999082532 5:148857660-148857682 CTGGCTGACTAGCACACCACTGG - Intergenic
1000315841 5:160089775-160089797 CCAGTTTACTCCCACTCCAAGGG + Intronic
1000752939 5:165119321-165119343 ACAGTTCACTAGCACACCTTTGG - Intergenic
1002590401 5:180287512-180287534 TCAGTTCCCTAGCACAGCACAGG + Intronic
1004130609 6:12915615-12915637 CCAGTTTACTATCACAGAGCAGG + Intronic
1006784834 6:36659355-36659377 CTGGTTTACCAGCACACTACTGG - Intergenic
1013738581 6:113256984-113257006 CTGGTTTACCAGCATACCACTGG + Intergenic
1015953839 6:138580464-138580486 CCAGTTTACTAACACACCACTGG - Intronic
1018279047 6:162164805-162164827 CAAGTTTACTAGGACACTAGAGG + Intronic
1018335820 6:162787860-162787882 CCAGGTTACTAGTCCAACACTGG - Intronic
1019080790 6:169428206-169428228 CCAGTCTTCTAGCTCTCCACTGG - Intergenic
1026900333 7:74033542-74033564 CCAGATTACTTGCACACTTCAGG + Intronic
1030083989 7:105801886-105801908 CCAGTGTATTGGCACACCACTGG + Intronic
1033451429 7:141465422-141465444 CCAGTTTGCCACCAAACCACAGG + Intronic
1033538561 7:142334727-142334749 CCAGTTTACAAGGACATCACTGG + Intergenic
1033540960 7:142355689-142355711 TCAGTGTACCAGCACATCACTGG + Intergenic
1033552184 7:142457635-142457657 CCAGTTTATCAGCACATCCCTGG + Intergenic
1033554453 7:142476572-142476594 CCAGTTTATCAGCACATCACTGG + Intergenic
1034133568 7:148743446-148743468 CCAATTTACCAGTATACCACTGG + Intronic
1040413160 8:47175606-47175628 CACATTTACCAGCACACCACTGG + Intergenic
1042218205 8:66448496-66448518 CCAGTTTACTAGCACACCACTGG - Intronic
1045415527 8:101962961-101962983 CCAATTTACTACTACATCACAGG - Intronic
1046658261 8:116920840-116920862 CAACTTTACTAACACAACACTGG - Intergenic
1047035182 8:120930421-120930443 TTTGTTTACCAGCACACCACTGG + Intergenic
1047605060 8:126466506-126466528 CCACCTTACTGGCACACCAGTGG - Intergenic
1049263116 8:141650439-141650461 CCAGTTCACCAGCACACAACTGG - Intergenic
1049311267 8:141935105-141935127 CCAGTTAAGTAGCACCCTACGGG + Intergenic
1051290625 9:15542063-15542085 CTAGTTTACTAGCATGCCACTGG + Intergenic
1053420876 9:37977076-37977098 CCAGGTTACTACCACCCAACTGG - Intronic
1057387684 9:94618918-94618940 CCAGTTTACCAGCACATCACTGG + Intronic
1059731451 9:117061012-117061034 TCAGTTTACCAGCATACCACTGG + Intronic
1060398385 9:123332534-123332556 GCAGTTTACCAGCACACCACTGG - Intergenic
1060735285 9:126062871-126062893 CCATGTTACTAGCATTCCACTGG - Intergenic
1061207416 9:129173061-129173083 CCAGGCTCCTAGGACACCACGGG - Intergenic
1187592492 X:20733612-20733634 CTGGTTTAAAAGCACACCACTGG + Intergenic
1187649497 X:21386481-21386503 CCATTTTACAAGCACTCCATTGG - Intronic
1188022068 X:25170036-25170058 CCAATTTACCAGCGCACCACTGG - Intergenic
1191636051 X:63378278-63378300 CAGGTTTACCAGCACACCACTGG - Intergenic
1195507707 X:105677687-105677709 GCTGTTTAGTAGTACACCACTGG + Intronic
1197054927 X:122106390-122106412 CTAGTTTACAAGCCCACCAATGG - Intergenic
1197163236 X:123346931-123346953 CCAGTTTTCCAGCATACCACTGG - Intronic
1197651613 X:129071618-129071640 CCAATTTACCAGCACACCACAGG + Intergenic
1198274952 X:135091191-135091213 ACATTTTACTATCTCACCACTGG - Intergenic
1198515430 X:137401769-137401791 CCAGTTTACCAGTACTCCACTGG - Intergenic
1198990089 X:142503379-142503401 CTGGTTTACTAGCATATCACTGG + Intergenic
1199544778 X:148996294-148996316 ACATTTTACCAGCACACCACTGG - Exonic