ID: 1042223300

View in Genome Browser
Species Human (GRCh38)
Location 8:66494448-66494470
Sequence TCATGGAGGTGGATGGGAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 830
Summary {0: 1, 1: 0, 2: 4, 3: 76, 4: 749}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042223300_1042223315 27 Left 1042223300 8:66494448-66494470 CCCCCTCCCATCCACCTCCATGA 0: 1
1: 0
2: 4
3: 76
4: 749
Right 1042223315 8:66494498-66494520 CAGCCTTGAATGAAGTAGGCTGG No data
1042223300_1042223310 -5 Left 1042223300 8:66494448-66494470 CCCCCTCCCATCCACCTCCATGA 0: 1
1: 0
2: 4
3: 76
4: 749
Right 1042223310 8:66494466-66494488 CATGACTCAGGCTTAGCCCCTGG No data
1042223300_1042223314 23 Left 1042223300 8:66494448-66494470 CCCCCTCCCATCCACCTCCATGA 0: 1
1: 0
2: 4
3: 76
4: 749
Right 1042223314 8:66494494-66494516 TTGTCAGCCTTGAATGAAGTAGG No data
1042223300_1042223316 28 Left 1042223300 8:66494448-66494470 CCCCCTCCCATCCACCTCCATGA 0: 1
1: 0
2: 4
3: 76
4: 749
Right 1042223316 8:66494499-66494521 AGCCTTGAATGAAGTAGGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042223300 Original CRISPR TCATGGAGGTGGATGGGAGG GGG (reversed) Intronic
900640001 1:3684091-3684113 GCCGGGAGGTGGATGGCAGGTGG + Intronic
900788189 1:4662919-4662941 GCCTGGAGGTGGAGGGGAGAGGG + Intronic
900933081 1:5748765-5748787 TCATGGAGGATGAAGTGAGGTGG - Intergenic
901194744 1:7434043-7434065 TCCAGGAGGTGGAAGGGATGTGG - Intronic
901686201 1:10944874-10944896 GGATGGAGGTGGAGGGGAGGAGG + Intergenic
901777043 1:11567224-11567246 TTAACAAGGTGGATGGGAGGTGG + Intergenic
902087059 1:13871413-13871435 TGATGGGGGAGGGTGGGAGGAGG - Intergenic
902740617 1:18435686-18435708 TGAGGGAGGTGGATGGGAGAGGG - Intergenic
903334182 1:22614004-22614026 TCATGCACGTGGCTGTGAGGGGG + Intergenic
903463404 1:23534922-23534944 ACATGGGGATGGAGGGGAGGAGG - Intergenic
903642166 1:24867596-24867618 CCATGGAGGTAGGTGGTAGGAGG + Intergenic
904295190 1:29515730-29515752 AAGTGGAGGAGGATGGGAGGAGG - Intergenic
904617447 1:31757657-31757679 CCATGGAGCTGGAGGGGAAGAGG - Intronic
905015625 1:34776711-34776733 TGATGGAGGAGGAAGAGAGGAGG + Intronic
905197086 1:36288302-36288324 TCAAGGAGAAGGATGGGAGGGGG - Intronic
905487223 1:38310594-38310616 TGATGGAGGTGTATCAGAGGAGG - Intergenic
905532591 1:38693881-38693903 GCACAGAGGTGGATGGGAGGTGG - Intergenic
905744571 1:40403592-40403614 TCAGGAAGATGGATGGGAAGTGG + Intronic
905903388 1:41597077-41597099 TCTTGGAGTTGGGAGGGAGGAGG - Intronic
905959669 1:42033089-42033111 TGGTGGAGGGAGATGGGAGGAGG + Intronic
905978849 1:42204284-42204306 TCAAGGAGGTGGGTGGGGAGGGG + Intronic
906102350 1:43271654-43271676 TCGTGGAGGAGGATGGCATGGGG + Intronic
906289398 1:44610106-44610128 TAATGAATGTGGACGGGAGGCGG + Intronic
906449645 1:45934062-45934084 TCAGGGTGGAGGGTGGGAGGAGG - Intronic
907076915 1:51587406-51587428 TCATGGAGGTGGGTGGAAATGGG - Intronic
907318118 1:53585562-53585584 GGATGGAGGTGGAAGTGAGGTGG + Intronic
907411259 1:54285333-54285355 TCATAGATGTGGTTGGGGGGAGG - Intronic
907427800 1:54391876-54391898 TGATTGAGGTGGGTGGGTGGAGG - Intronic
907739047 1:57145882-57145904 TCATGGAATTGGGTGGGAAGAGG - Intronic
907901855 1:58748303-58748325 CCCGGGAGGTGGAAGGGAGGCGG + Intergenic
908155651 1:61350043-61350065 GCATGGAGGTGAAAGGGTGGGGG - Intronic
910041970 1:82863471-82863493 TCAGGGAGGAGGATGGAAGGAGG - Intergenic
910165534 1:84323987-84324009 TCATGGAATTGGATGGATGGTGG - Intronic
911535189 1:99091052-99091074 TGAGGGTGGAGGATGGGAGGAGG - Intergenic
912299267 1:108497206-108497228 TGTTGGGGGTGGGTGGGAGGAGG + Intergenic
912822366 1:112878408-112878430 GCGTGGTGGTGGCTGGGAGGTGG - Intergenic
913597281 1:120390390-120390412 TGAGGCAGGCGGATGGGAGGCGG + Intergenic
914090047 1:144488916-144488938 TGAGGCAGGCGGATGGGAGGCGG - Intergenic
914308564 1:146445306-146445328 TGAGGCAGGCGGATGGGAGGCGG + Intergenic
914593544 1:149127827-149127849 TGAGGCAGGCGGATGGGAGGCGG - Intergenic
914901308 1:151712565-151712587 TCATGGAGGTGGTGGAGTGGGGG - Intronic
915305647 1:154975924-154975946 TGAGGGAGGAGGGTGGGAGGAGG + Intronic
915547517 1:156609758-156609780 TGAGGGAGGAGGGTGGGAGGAGG + Intergenic
915970651 1:160352859-160352881 AGATGGAGGTAGGTGGGAGGGGG - Intronic
916425335 1:164674854-164674876 TCTTGGTGGTGGGTGGGGGGGGG - Intronic
916657638 1:166891243-166891265 TTATAGAGGTGAATGTGAGGGGG - Intergenic
917253558 1:173089329-173089351 TGAGGGAGGAGGGTGGGAGGAGG - Intergenic
917407854 1:174727529-174727551 AGATGGAGATGGATGGGAAGAGG + Intronic
918174576 1:182031618-182031640 TCAAGGAGGTTGATGGAAAGGGG + Intergenic
919517746 1:198548127-198548149 GCATGGAGATGTATGGGAGCAGG + Intergenic
919583770 1:199410128-199410150 TCATGGAGTTGATTAGGAGGTGG - Intergenic
919639632 1:200035809-200035831 AGAAGGAGGTGGAGGGGAGGTGG + Intronic
919669673 1:200327448-200327470 TGAAGGAGGTGGAGAGGAGGAGG - Intergenic
919848116 1:201654402-201654424 TGATGGGGGTGGGTGGTAGGGGG - Intronic
920540011 1:206771092-206771114 TGGCGGAGGTGGCTGGGAGGAGG + Intronic
920763019 1:208804112-208804134 TGAGGGCGGTGGGTGGGAGGAGG - Intergenic
921344594 1:214169246-214169268 TCATGGATGTGGATGCTGGGTGG - Intergenic
922173746 1:223178710-223178732 GCATGGTGGGGGAGGGGAGGGGG + Intergenic
922579467 1:226686186-226686208 CCATGGGGGTGGATGGGCAGGGG + Intronic
922798954 1:228355379-228355401 TCCTTGAGGTGACTGGGAGGAGG + Intronic
923293003 1:232564898-232564920 TCAGGGTGGGGGATGAGAGGAGG + Intergenic
923364539 1:233246391-233246413 CCATGGTGGGGGATGGGAGCAGG + Intronic
924188679 1:241524332-241524354 TCAGGGGGAAGGATGGGAGGGGG - Intergenic
924588595 1:245381655-245381677 TTCTGGAGGTGGATGGATGGTGG - Intronic
924686708 1:246299833-246299855 TGAAGGTGGAGGATGGGAGGAGG + Intronic
924712476 1:246541343-246541365 GCAGGGAAGAGGATGGGAGGAGG + Intronic
924903577 1:248428200-248428222 TCAGGGAGGTAGCTGGTAGGAGG + Intergenic
924924292 1:248663778-248663800 TCAGGGAGGTAGCTGGTAGGAGG - Intergenic
1063057041 10:2517023-2517045 AGAAGGAGGGGGATGGGAGGAGG - Intergenic
1063114358 10:3063669-3063691 GCATGGAGGTGGGGTGGAGGTGG + Intergenic
1063526843 10:6795103-6795125 TGATGGGGGAGGGTGGGAGGAGG + Intergenic
1063693675 10:8312069-8312091 TCATGCAGGAGGAATGGAGGAGG + Intergenic
1064104150 10:12487162-12487184 TCAGGGTGGAGGATGGGAGGAGG - Intronic
1064340947 10:14484786-14484808 TCAAGTAGATGGATGGGATGGGG + Intergenic
1064748632 10:18502805-18502827 TGAGGGTGGAGGATGGGAGGAGG + Intronic
1065193187 10:23234524-23234546 AGAGGGAGGAGGATGGGAGGAGG + Intronic
1067250981 10:44587156-44587178 GGATGGGGGTGCATGGGAGGGGG - Intergenic
1068397680 10:56485485-56485507 TGAAGGTGGAGGATGGGAGGAGG - Intergenic
1068820439 10:61371470-61371492 TGATGGTGGAGGATGGGAGGAGG - Intergenic
1069085184 10:64130477-64130499 TCAGGGAGGCAGATGAGAGGTGG - Intergenic
1069438803 10:68409190-68409212 TGAAGGTGGAGGATGGGAGGAGG - Intergenic
1069633456 10:69911585-69911607 TCATGGAGGGGTATGGGGGAAGG - Intronic
1070591099 10:77801705-77801727 TCATGGTGGTGGACGGGTGGTGG + Intronic
1070674170 10:78400606-78400628 TCATGGAGGAGTAATGGAGGAGG - Intergenic
1070789716 10:79181848-79181870 TGGTGGTGGTGGCTGGGAGGCGG - Intronic
1071217906 10:83429187-83429209 TCAAGGGGGAGGATGAGAGGAGG + Intergenic
1071387102 10:85132426-85132448 TCATGGAGGTGGAATTGAGGTGG + Intergenic
1071482003 10:86071696-86071718 TGAGGGAGGTGGTGGGGAGGTGG + Intronic
1071992048 10:91109071-91109093 GCATGGAGGTGCATGGAATGGGG + Intergenic
1072275155 10:93815804-93815826 TCAGTGAGGTGGGTGGGGGGGGG - Intergenic
1072343059 10:94474486-94474508 TTTTGGAGGTGGAGGGGAGCTGG - Intronic
1073522868 10:104150880-104150902 TGAGGGTGGTGGGTGGGAGGAGG - Intronic
1074079781 10:110158339-110158361 TTAGGGAGGAGGAGGGGAGGGGG - Intergenic
1074191523 10:111142073-111142095 GCAGGCAGGGGGATGGGAGGTGG + Intergenic
1074778692 10:116785194-116785216 TGGTGGCGGTGGGTGGGAGGGGG - Intergenic
1074917527 10:117971820-117971842 CCATTGAGGTGGAGGGGAGTGGG + Intergenic
1075167850 10:120085327-120085349 CTATGGAGGTGGAGGGGAGGAGG + Intergenic
1075336823 10:121614793-121614815 TCAGGAAGGAGGCTGGGAGGAGG - Intergenic
1075620973 10:123928075-123928097 ACATGGTGGTGGAGGGGAGTGGG - Intronic
1075840550 10:125498718-125498740 TCAGGGTGGAGGGTGGGAGGAGG - Intergenic
1076055464 10:127368645-127368667 TCATCCAGGTGGATGGGATAAGG - Intronic
1076170431 10:128314889-128314911 TAATGGTGGGGGAGGGGAGGGGG - Intergenic
1076879827 10:133234724-133234746 GCATGGAGGTGTCGGGGAGGGGG + Intergenic
1077383440 11:2258065-2258087 TCAGGGAGATGGGTGGGTGGAGG - Intergenic
1078605614 11:12772424-12772446 GAATGGAGGAGGATGGGGGGAGG + Intronic
1078945219 11:16058853-16058875 TCATGGGGCTGGAAGGGAGGAGG + Intronic
1079083055 11:17427468-17427490 GTATGGAGGTGGGTTGGAGGTGG - Intronic
1079299206 11:19262501-19262523 TCTTGGTGGTGGATGAGAGAGGG - Intergenic
1079326644 11:19498534-19498556 TTATGGGGGTGGATGGGAAAAGG - Intronic
1079992517 11:27261452-27261474 TGAGGGTGGAGGATGGGAGGAGG + Intergenic
1080056939 11:27916280-27916302 TAATGGAGATGGAAAGGAGGGGG + Intergenic
1080649071 11:34208788-34208810 GCTTGGTGGTTGATGGGAGGTGG - Intronic
1080724492 11:34881929-34881951 TGATGGCGGAGGGTGGGAGGAGG + Intronic
1081198086 11:40185779-40185801 TCTTGCATGAGGATGGGAGGAGG + Intronic
1081640322 11:44748863-44748885 CCCTGGAAGTGGGTGGGAGGAGG - Intronic
1081652562 11:44834170-44834192 TCAGGGAGATGGAGGCGAGGTGG + Intronic
1082869112 11:57927667-57927689 TGATGGAGGAGGTTGGGAGGGGG - Intergenic
1083114752 11:60449767-60449789 TGAGGGTGGAGGATGGGAGGAGG + Intronic
1083131442 11:60627302-60627324 TTATGGAGGAGGATGGGAATAGG + Intergenic
1083281174 11:61628155-61628177 TCATGGAGGTGGCTAGGATGGGG + Intergenic
1083856337 11:65394811-65394833 TCCTGGAGAGGGCTGGGAGGTGG - Intronic
1083936748 11:65873361-65873383 TCCTGGGGGTGGAGGGCAGGAGG - Intronic
1084044221 11:66559738-66559760 CCATGGAGGTGCTTGGGTGGAGG - Intronic
1084116297 11:67044855-67044877 TCATGCAGATGGATAGGGGGTGG + Intronic
1084734498 11:71095638-71095660 GGATGGAGGGGGATGGGATGGGG - Intronic
1085394718 11:76201435-76201457 TCAAGGATTAGGATGGGAGGTGG + Intronic
1085678897 11:78552137-78552159 TGAGGGGGGAGGATGGGAGGAGG - Intronic
1086164639 11:83763320-83763342 TGATGGTGGAGGGTGGGAGGAGG - Intronic
1086954235 11:92919356-92919378 TGATGGAGGTGGATATGTGGAGG + Intergenic
1087176961 11:95104996-95105018 GCATGGAGGTGGGTGGGAGAGGG + Intronic
1087224704 11:95585323-95585345 TGAGGGAGGAGGATGGGAGGAGG + Intergenic
1087842825 11:102937518-102937540 TGAGGGAGGAGGGTGGGAGGAGG + Intergenic
1087912080 11:103765778-103765800 TGAGGGAGGAGGATGGCAGGAGG - Intergenic
1088714269 11:112535055-112535077 ACATGGGGGTGGAGGGGAGAGGG + Intergenic
1089271044 11:117301416-117301438 ACATGGAGGTGTGTGGGAGGGGG - Intronic
1089292980 11:117449697-117449719 TAGTGGAGGTGGATGGCAGAGGG - Intronic
1089345736 11:117790300-117790322 CCTTGGAGGGGAATGGGAGGAGG + Intronic
1089420434 11:118329106-118329128 TCAGGGTGGAGGGTGGGAGGAGG + Intergenic
1089583674 11:119496849-119496871 TCAGGGAGGGGCAGGGGAGGTGG + Intergenic
1089597579 11:119590852-119590874 TCCTGGAGGTGGAAGGGAGAGGG + Intergenic
1090248318 11:125233607-125233629 TCATGGAGGTGCCTCAGAGGCGG - Intronic
1090281899 11:125463563-125463585 TCATGGATCTGGAGAGGAGGTGG + Exonic
1090921959 11:131214704-131214726 GCATGGCTGGGGATGGGAGGAGG + Intergenic
1091110009 11:132957254-132957276 GCCTGGAGGTGGAAGGAAGGAGG - Intronic
1091354313 11:134923902-134923924 TGAGGGAGCTGGATGGGAGAGGG + Intergenic
1091409672 12:231060-231082 TGAGGGCGGGGGATGGGAGGAGG - Intronic
1091636782 12:2203229-2203251 GCATGGAGATGGATCGCAGGCGG - Intronic
1091899637 12:4134457-4134479 CCATGATGGTGGGTGGGAGGTGG + Intergenic
1091912019 12:4240389-4240411 TACTGGGGGTGGAAGGGAGGTGG + Intergenic
1092091619 12:5808518-5808540 TCATGGAGGGGGAGGAGAGGGGG + Intronic
1092405261 12:8217343-8217365 TCATGAAGGTGGGTGGGGGCTGG + Intergenic
1092441102 12:8505165-8505187 TGAGGGTGGAGGATGGGAGGAGG - Intergenic
1092954878 12:13540758-13540780 ACTTGGAGGTGGATGGGCTGGGG + Exonic
1093134308 12:15432145-15432167 TCAGGGTGGTGGGTGAGAGGAGG - Intronic
1093189103 12:16054821-16054843 TGGTGGAGGTGGAGGGTAGGAGG + Intergenic
1093417414 12:18935621-18935643 GCATGTAGGTGGGTGGGTGGGGG - Intergenic
1093541570 12:20293389-20293411 TGAGGGTGGAGGATGGGAGGAGG - Intergenic
1095099841 12:38169131-38169153 TGATGGGGGAGGGTGGGAGGAGG - Intergenic
1095515795 12:43003852-43003874 TACTTGAGGTGGGTGGGAGGAGG + Intergenic
1096953574 12:55502192-55502214 TGAGGGTGGAGGATGGGAGGAGG + Intergenic
1096977719 12:55708785-55708807 CCATGAAAGGGGATGGGAGGGGG + Intronic
1097143855 12:56926013-56926035 GCATGGAGTAGGATGGGAGACGG + Intronic
1097740055 12:63231341-63231363 TGATGGTGGAGGATGGGAGGAGG + Intergenic
1097856858 12:64472514-64472536 TCATGAAGGCAGATGGCAGGAGG + Intronic
1097954938 12:65474661-65474683 TCATTGTGGCGGCTGGGAGGAGG - Intronic
1098141189 12:67451585-67451607 GGGTGGAGGTGGGTGGGAGGAGG - Intergenic
1098524004 12:71465610-71465632 TTATGCAGCTGGATGGGAGATGG - Intronic
1099860057 12:88215022-88215044 TGAGGGTGGAGGATGGGAGGAGG + Intergenic
1099926694 12:89027348-89027370 TCATGAAGATGGGTGGGAGATGG - Intergenic
1100386483 12:94109060-94109082 TCATGGATGAGGATGGGGGTCGG - Intergenic
1101116188 12:101533795-101533817 TCATGGAGGTGGTTGGAGGGTGG + Intergenic
1101252869 12:102952405-102952427 TCTTGGAGGAGGTGGGGAGGAGG + Intronic
1101257213 12:102990183-102990205 TGAGGGTGGAGGATGGGAGGGGG + Intergenic
1101765701 12:107697141-107697163 CCATGAAGGAGGACGGGAGGAGG + Intronic
1101819524 12:108173230-108173252 TCTGGGATGAGGATGGGAGGGGG - Intronic
1102477123 12:113195931-113195953 TCAGGGAGGAGGGTGGGAGGAGG - Intronic
1102492480 12:113297537-113297559 CCTTGGAGGTGGTTGGGAGGAGG - Exonic
1102748987 12:115275680-115275702 TCAGGGAGAAGGGTGGGAGGAGG + Intergenic
1102785857 12:115604356-115604378 TCATGGAGCAGGTGGGGAGGAGG - Intergenic
1103372553 12:120430509-120430531 CCTTGGAGGAGGAGGGGAGGTGG - Intergenic
1103481909 12:121255870-121255892 TTCTGGAGGTGGTTGGGAGGTGG - Intronic
1103948673 12:124540532-124540554 AGATGGAGGGGGATGGGAGGAGG + Intronic
1103948762 12:124540770-124540792 AGCTGGAGGGGGATGGGAGGTGG + Intronic
1104691532 12:130829825-130829847 CCATGGAGGGGGTGGGGAGGAGG + Intronic
1104748740 12:131225151-131225173 GCAGGGAGGGGAATGGGAGGAGG - Intergenic
1104784383 12:131440413-131440435 GCAGGGAGGGGAATGGGAGGAGG + Intergenic
1104842719 12:131832337-131832359 TCCGGGAGGGGGATGGGAAGGGG + Intronic
1104899356 12:132179978-132180000 GCCTGGAGGTCGATGGAAGGAGG + Intergenic
1106447482 13:29849864-29849886 ACATGGAGAGGGGTGGGAGGGGG + Exonic
1107193948 13:37624317-37624339 GGATGGAGGTGGGTGGGAGTGGG + Intergenic
1107560240 13:41551616-41551638 ACAGGGAGGTGGTTGGCAGGTGG - Intergenic
1107779793 13:43886598-43886620 TAAGGGTGGTGGGTGGGAGGAGG + Intronic
1107786454 13:43962573-43962595 CCATGGAAGTGGATAAGAGGGGG + Intergenic
1108505238 13:51107106-51107128 CCATGTGGGTCGATGGGAGGAGG - Intergenic
1109267691 13:60219934-60219956 TGAAGGGGGTGGGTGGGAGGGGG + Intergenic
1109491532 13:63107087-63107109 TCAGTGATGTGGAGGGGAGGAGG - Intergenic
1109911459 13:68917387-68917409 TCATAGAGGTAGAGAGGAGGAGG - Intergenic
1110082409 13:71331952-71331974 TCATGGGGTTGGGTGGGGGGGGG + Intergenic
1111479795 13:88809897-88809919 TGTTGGAGGTGGGTGGGAGGTGG + Intergenic
1112182462 13:97097704-97097726 TGAGGGTGGAGGATGGGAGGAGG - Intergenic
1112193942 13:97206384-97206406 TTATGGGAGTGGAAGGGAGGGGG + Intergenic
1112434420 13:99381545-99381567 TCATGGTGGTGGATAGTAGGTGG + Intronic
1113097275 13:106679390-106679412 GCTTGGATGTGGATGGGAGGAGG + Intergenic
1114442430 14:22760591-22760613 TCAGGGAGGAGGAGGGGACGAGG - Intergenic
1114552166 14:23538975-23538997 CCACTGAGGGGGATGGGAGGAGG + Intronic
1114984693 14:28211276-28211298 TCATGGAGATAGATGGTAGAAGG - Intergenic
1115209088 14:30946625-30946647 CCATGGAGTGGGGTGGGAGGTGG + Intronic
1116009893 14:39339015-39339037 CCATGGAGGTTGCAGGGAGGAGG + Intronic
1116598758 14:46890130-46890152 TCATGGTGGTGGAAGTGAGCAGG - Intronic
1116746396 14:48824741-48824763 TGATGGAGGAGGATGGGAAGAGG + Intergenic
1116799575 14:49429125-49429147 GCATGGTGGGGGATGGGTGGGGG - Intergenic
1117105276 14:52391914-52391936 GGATGGTGGTGGATGGGAAGTGG - Intergenic
1117211900 14:53509415-53509437 TGAAGGAGGTGGGTGGGAGCAGG + Intergenic
1117739952 14:58806848-58806870 TGGTGGAGGTGGAAGAGAGGGGG + Intergenic
1118134752 14:63011088-63011110 TCATAAAGGTTAATGGGAGGTGG + Intronic
1119319003 14:73718470-73718492 TCCTGGAGGCCGAGGGGAGGAGG + Exonic
1119764750 14:77181449-77181471 TCAGGGAGGGCGAGGGGAGGTGG + Intronic
1121078714 14:91090438-91090460 TCATGCAGGAGGCTGGGAGAAGG - Intronic
1121389505 14:93562172-93562194 TCCTGCAGGTGGATGGCAGTTGG + Intronic
1121817850 14:96942194-96942216 TGAGGGAGGTGGAGAGGAGGGGG + Intergenic
1121883232 14:97518960-97518982 TTATGGAGTTGGAGGGGTGGGGG - Intergenic
1121944136 14:98103027-98103049 ACAAGGAGGTGGATGGGACAAGG + Intergenic
1121956461 14:98217932-98217954 TCAGTGAGGTGGATGGATGGAGG + Intergenic
1122573761 14:102727285-102727307 TCTTGGAGGTGGGGGGGTGGGGG - Exonic
1122828715 14:104384966-104384988 TCAGGGAGGGGGCTGTGAGGAGG - Intergenic
1123042504 14:105496126-105496148 ACTTGGGGGTGGGTGGGAGGGGG + Intronic
1123947599 15:25246314-25246336 TCCTGGAGCCTGATGGGAGGTGG + Intergenic
1124576375 15:30912566-30912588 TCATGGAGTTGAAGGGGAAGGGG - Intronic
1125238772 15:37549330-37549352 TGAGGGTGGTGGACGGGAGGAGG - Intergenic
1125394036 15:39227290-39227312 TCATGGAGGATGGTGGGTGGGGG + Intergenic
1125568277 15:40694549-40694571 TCATGGAGGTGGAGGAGCTGAGG - Intergenic
1125687591 15:41572665-41572687 TGATGGAGCTGGGTGGGAGTAGG + Intronic
1125715383 15:41817084-41817106 TCATGGAGGTGGGAGGCAGATGG - Intronic
1126054930 15:44721013-44721035 TCCCAGAGGTGGATGGGTGGGGG + Intergenic
1126223762 15:46245479-46245501 TGATGGGGGAGGGTGGGAGGAGG - Intergenic
1126394569 15:48200552-48200574 TAATGGAGATGGTGGGGAGGTGG + Intronic
1126516330 15:49542491-49542513 TCAGGGGGAAGGATGGGAGGGGG - Intronic
1126729928 15:51672337-51672359 TCATGGAGGGGGCGGGGTGGGGG - Intergenic
1127456084 15:59157397-59157419 TCATGGATAAGGAGGGGAGGGGG - Intronic
1127696488 15:61453080-61453102 TGATGGGGGAGAATGGGAGGAGG - Intergenic
1127918554 15:63475239-63475261 TGATGGACGTGGAGGGCAGGGGG - Intergenic
1128429302 15:67575355-67575377 CCATGGAGGTGGCGGGGCGGGGG + Intronic
1128457911 15:67843182-67843204 GCATGGAGGTGGAGGAGAGGAGG + Intergenic
1128729908 15:70014121-70014143 TCCTGGAGGAGGACGGGATGGGG - Intergenic
1129236259 15:74225525-74225547 AGATGGAGGTGGAGGGTAGGGGG - Intergenic
1129273053 15:74429420-74429442 GCATGGAGGTGGCAGGGTGGGGG - Intronic
1129281691 15:74490061-74490083 AGATGGGGGTGGCTGGGAGGAGG - Intergenic
1129595335 15:76959493-76959515 TCATGGAGGTAGAGGGGGGAGGG - Intergenic
1129784956 15:78303981-78304003 TCTTGGAGGGGGCTGGGAGCAGG + Intergenic
1129998376 15:80026217-80026239 TAAAGGAGATGGTTGGGAGGGGG + Intergenic
1131310226 15:91283973-91283995 TCATGTAAGTGGAAGGGAGCTGG - Intronic
1131537969 15:93253439-93253461 TTCAGGAGGTGGAGGGGAGGGGG - Intergenic
1132078044 15:98839379-98839401 TGATGGTGGTGGTAGGGAGGTGG - Intronic
1132157061 15:99503119-99503141 CCAAGCAGATGGATGGGAGGGGG - Intergenic
1132452425 15:101975718-101975740 TCCCCGAGGTGGCTGGGAGGTGG + Intergenic
1132454471 16:14904-14926 TCCCCGAGGTGGCTGGGAGGTGG - Intronic
1132586432 16:707569-707591 TCACAGAGGTGGAGGGCAGGTGG - Intronic
1132586490 16:707807-707829 TCACAGAGGTGGAGGGTAGGTGG - Intronic
1132776253 16:1596201-1596223 CCAGGGAGGAGGCTGGGAGGGGG - Intronic
1132843498 16:1989833-1989855 TGAGGGTGGGGGATGGGAGGTGG + Intronic
1133022930 16:2974728-2974750 TCTTGGAGGTGGGTGGGAGAGGG + Intronic
1133071127 16:3247327-3247349 TCCTGGAGGTGGATAAGAGGTGG + Intronic
1133489913 16:6257566-6257588 TCAGGGTGGAGGATGGGAAGTGG - Intronic
1133710914 16:8400370-8400392 TGAGGGGGGAGGATGGGAGGAGG + Intergenic
1134300987 16:12990653-12990675 AACTGGAGGTGGATGGGGGGTGG + Intronic
1134741336 16:16549791-16549813 ACAAGAAGGTGGTTGGGAGGAGG - Intergenic
1134826201 16:17286329-17286351 TCATGGAAGGGGATGGCAGATGG + Intronic
1134846137 16:17442388-17442410 TCATGGAGGTGGGGGGTAGGTGG - Intronic
1135142659 16:19934953-19934975 TCATGGGGGTTGTGGGGAGGTGG + Intergenic
1135284774 16:21183948-21183970 ACATGGAGGTGGAGGGTGGGAGG + Intergenic
1135630184 16:24030379-24030401 GCATGTGGGTGGGTGGGAGGAGG + Intronic
1136133784 16:28241735-28241757 TCATTGCGGTGGGTGGGGGGGGG - Intergenic
1138216187 16:55207273-55207295 CCATGAAGGAGGATGGGAGAGGG + Intergenic
1138339691 16:56280580-56280602 GCAGGGAGGGGGATGGCAGGGGG + Intronic
1138706965 16:58925040-58925062 TTATGTAGGTGTATGTGAGGAGG + Intergenic
1138930841 16:61653982-61654004 TGATGAAGGAGGAGGGGAGGAGG - Exonic
1139113739 16:63923879-63923901 TGATGGTGGAGGATGGGAGGTGG + Intergenic
1139260609 16:65589880-65589902 CCCTGGGGGTGGAAGGGAGGGGG + Intergenic
1140289265 16:73635728-73635750 TGATGGAGATGGATGGTAGATGG - Intergenic
1141187207 16:81796443-81796465 GCATAGGGGTGGATTGGAGGTGG + Intronic
1141624201 16:85252940-85252962 ACAGGGAGGTGGAAGGGAAGTGG + Intergenic
1142922791 17:3205757-3205779 AGATGGTGGAGGATGGGAGGAGG + Intergenic
1143116972 17:4586671-4586693 TCTTCGGGGTGGATGGAAGGTGG + Intronic
1143387880 17:6542851-6542873 TAGTGAAGGTGGATGGAAGGAGG - Intronic
1143697038 17:8629358-8629380 TCACTGCGGTGGATGGAAGGGGG - Intronic
1143978968 17:10851481-10851503 TCATGCAGGTTGTTGGCAGGAGG + Intergenic
1144028970 17:11302856-11302878 TCATCCAGGTGGAGAGGAGGGGG + Intronic
1144637281 17:16918315-16918337 TAAGGGAGATGGGTGGGAGGAGG + Intergenic
1144698382 17:17321135-17321157 TCATGGAGGAGGATAGCAAGCGG + Intronic
1144698401 17:17321254-17321276 TCATGGAGGAGGATAGCAAGTGG + Intronic
1145835751 17:27953046-27953068 CCAGGGATGTGGGTGGGAGGGGG - Intergenic
1145850861 17:28094641-28094663 TCTTTGAGGTGGGTGGGTGGTGG + Intronic
1146499332 17:33351222-33351244 TCAGAGAGGAGGAGGGGAGGAGG - Intronic
1146616251 17:34359420-34359442 TCATGGGGGTGGAGAAGAGGAGG + Intergenic
1147326529 17:39672360-39672382 TCCTGGAGGAGGGTGGGGGGTGG + Exonic
1147429294 17:40361877-40361899 TCATGGAGGTGGGGTGGGGGTGG - Intronic
1147511310 17:41071155-41071177 TTCTGGAGTTGGGTGGGAGGAGG + Intergenic
1147576072 17:41599726-41599748 TCCTGGGGGTGGGTGGGGGGTGG + Intergenic
1147867095 17:43560197-43560219 TCGGGGAGGTGGGTGGGAGGTGG + Intronic
1147931026 17:43981403-43981425 TCATTCTGGTGGATGGGTGGTGG + Intronic
1148393424 17:47289966-47289988 TTGTGGTGGTGGAGGGGAGGTGG + Intronic
1148785064 17:50142236-50142258 CCAGGGAGGTGGAGTGGAGGAGG - Intronic
1149009290 17:51838407-51838429 TCATGGAGGTGGGGGGTTGGAGG - Intronic
1149429262 17:56584061-56584083 GCCTGGAGGTGGCAGGGAGGAGG - Intergenic
1149624596 17:58071593-58071615 TGATGGAGGAGGGTGGGAGGAGG + Intergenic
1150300828 17:64045611-64045633 TCATGGATGAGGGAGGGAGGGGG - Intronic
1150843887 17:68635227-68635249 TCATGGCGGGGGCGGGGAGGGGG + Intergenic
1150866184 17:68852675-68852697 TCAGGGAGTGGGGTGGGAGGAGG + Intergenic
1151351703 17:73535769-73535791 CCATGGATGTGGCTGGCAGGGGG + Intronic
1151547708 17:74803375-74803397 TCAGGGATGTGGATGGGGAGAGG - Intronic
1152298934 17:79484443-79484465 CCAGGGAGGTGGCTGGGAGAGGG + Intronic
1153842027 18:9015959-9015981 TCTTGGAGGTGGGTGGGAAGGGG - Intergenic
1153881071 18:9422225-9422247 TCATTGGGGCGGGTGGGAGGTGG + Intergenic
1155304956 18:24469906-24469928 TGAGGGTGGTGGGTGGGAGGAGG - Intronic
1155726568 18:29092356-29092378 TCATGATGGTGGTTGGGAGCAGG - Intergenic
1156618741 18:38822357-38822379 TGAAGGTGGAGGATGGGAGGAGG + Intergenic
1157253220 18:46114776-46114798 TCAGTGAGCTGGAAGGGAGGAGG + Intronic
1157369521 18:47097874-47097896 TCAGGGTGGAGGGTGGGAGGAGG - Intronic
1157429871 18:47615878-47615900 TCATGGTGGTTGCGGGGAGGGGG - Intergenic
1158215573 18:55097379-55097401 TCATGGAGCTGGTTGGGGGTGGG - Intergenic
1158522470 18:58183147-58183169 ACATGGAGGTTGCTGGGAGGAGG + Intronic
1158548820 18:58417701-58417723 TCATGTAGGTGGATGGGAAAGGG - Intergenic
1159209582 18:65299640-65299662 TCAGGGAGGTGGAATGGAGGTGG - Intergenic
1159951767 18:74489236-74489258 CCTTGAAGGTGGAGGGGAGGAGG + Intergenic
1159972311 18:74669432-74669454 GAATGGAGGTGGAGGGGTGGGGG - Intronic
1160039809 18:75335256-75335278 TCAGGGAGGCGAGTGGGAGGAGG - Intergenic
1160048230 18:75407350-75407372 TCATGTTGGTGGATGGGGGTGGG + Intronic
1160134404 18:76260301-76260323 TCCTGGGGGTGGGGGGGAGGGGG + Intergenic
1160317589 18:77861881-77861903 GGATGGAGGTGGAAGAGAGGAGG - Intergenic
1160427487 18:78788122-78788144 GCCAGGAGGTGGATGGGAGTGGG - Intergenic
1160482640 18:79256709-79256731 GCATGTAAGTGGATGGGAGAGGG - Intronic
1160717596 19:583444-583466 TTGTGGCGGTGGGTGGGAGGGGG - Exonic
1161256803 19:3314253-3314275 TGATGGAGGTGGTGGGCAGGCGG + Intergenic
1161395705 19:4043845-4043867 TCCTGGAGGTGGGGGGGGGGGGG - Intergenic
1161613401 19:5256743-5256765 GCATGGAGGGGGAGGGGATGGGG - Intronic
1161731006 19:5960587-5960609 TCATGAAGGGGGAGGGAAGGAGG + Intronic
1161860214 19:6792302-6792324 TCATTGAGGAGGAAGGGTGGAGG + Intronic
1162287342 19:9749033-9749055 TCCTGCAGGTGGACGGGAGTTGG - Intergenic
1162362168 19:10226976-10226998 CGATGGGGGGGGATGGGAGGGGG - Intronic
1162371909 19:10284739-10284761 ACATGGAGGTGGGTGGGGGCAGG - Intronic
1162625060 19:11878828-11878850 TCATCAGGGAGGATGGGAGGAGG - Intronic
1162635218 19:11962854-11962876 TCATCAGGGAGGATGGGAGGAGG - Intronic
1163184032 19:15623862-15623884 TCAGGAAGGTTGAGGGGAGGGGG - Intronic
1163267031 19:16227729-16227751 TCCTGGAGGTGAAGGGGAGGAGG - Intronic
1163363390 19:16862212-16862234 TCATGGATGCGAATGAGAGGCGG - Intronic
1163435844 19:17294598-17294620 TGCTCGAGTTGGATGGGAGGGGG - Intronic
1163447167 19:17353491-17353513 TGATGGAGGGGAACGGGAGGAGG - Intronic
1163462525 19:17447794-17447816 GCTTGGAAGTGGGTGGGAGGCGG - Intronic
1163640300 19:18458176-18458198 ACATGCTGGGGGATGGGAGGCGG + Intronic
1163714542 19:18866205-18866227 TCAAGGAGAAGGATGGGAGGGGG + Intronic
1163722203 19:18903629-18903651 TCCGGGAGCTGGGTGGGAGGTGG - Intronic
1164708208 19:30335867-30335889 ACCAGCAGGTGGATGGGAGGTGG + Intronic
1164901578 19:31930588-31930610 GCAAGGAGGTGGAAGGTAGGTGG - Intergenic
1164940507 19:32249428-32249450 TCTTGGGGGTGGAGTGGAGGTGG - Intergenic
1165477855 19:36042063-36042085 TGATGGAGGAGGAGGGGAAGGGG + Intronic
1165752068 19:38266217-38266239 GACTGGAGGAGGATGGGAGGTGG + Intronic
1165787534 19:38470878-38470900 TCCTAGAGGTGGCTGGGACGGGG + Intronic
1165963994 19:39559208-39559230 TCAGGAAGGAGGATAGGAGGAGG - Intergenic
1166048349 19:40242755-40242777 TGCTGGGGGTGGCTGGGAGGTGG - Intronic
1166255267 19:41599812-41599834 CCCTGGGAGTGGATGGGAGGAGG + Intronic
1166266530 19:41688065-41688087 TCCTGGGAGTGGGTGGGAGGAGG - Intronic
1166301510 19:41914169-41914191 TCCAGGAGGCAGATGGGAGGTGG - Intronic
1166303644 19:41925863-41925885 TCACGGAGGAGGATGGGTGAGGG + Intronic
1166351250 19:42199459-42199481 TGATGGAGGAGGAAGGGGGGCGG - Exonic
1166616229 19:44249866-44249888 TCTAGGGGGTGGAGGGGAGGTGG - Intronic
1167650253 19:50724895-50724917 TCATGGGGAGGGCTGGGAGGAGG - Intronic
1167842553 19:52133867-52133889 TCAGGGTGGAGGGTGGGAGGAGG - Intronic
925017357 2:541395-541417 TGAAGGAGGAGGGTGGGAGGAGG + Intergenic
925191623 2:1889448-1889470 ACATGGAGGTGGATGAGAACGGG - Exonic
925357843 2:3254698-3254720 CCTTGGAGGCGGAAGGGAGGTGG + Intronic
925384983 2:3455531-3455553 TCATGGAGATGGAGAGCAGGAGG - Intronic
925399582 2:3562644-3562666 TGAGGGTGGAGGATGGGAGGAGG - Intergenic
925594328 2:5540032-5540054 TGAGGGAGGTGGAGGGGAGGCGG + Intergenic
925961720 2:9023398-9023420 TCAGGGAGAAGGGTGGGAGGGGG + Intergenic
926195730 2:10762703-10762725 CCATGGAGGTGGGAGGGATGGGG - Intronic
926205414 2:10831798-10831820 CCAGGAAGGTGGCTGGGAGGAGG - Intronic
926240478 2:11081154-11081176 GCATGGAGGGGGGAGGGAGGAGG - Intergenic
926472700 2:13280784-13280806 TCATGGTGGTGGAAGGCAGGGGG - Intergenic
926719194 2:15946305-15946327 TCATGGAGGTGAGGTGGAGGAGG - Exonic
926783016 2:16492763-16492785 TGAAGGAGGAGGGTGGGAGGAGG + Intergenic
927355798 2:22171672-22171694 TCAGGGAAAAGGATGGGAGGGGG + Intergenic
927372221 2:22369405-22369427 TCAGGGAGAAGGGTGGGAGGGGG + Intergenic
927441281 2:23119732-23119754 CAATGGAGGTGGAGGGGATGGGG - Intergenic
929668269 2:43850594-43850616 TGAGGGTGGAGGATGGGAGGAGG - Intronic
929955511 2:46455291-46455313 TCAAGGTGGTGGCAGGGAGGTGG - Intronic
931135823 2:59399470-59399492 ACATGGGGTTGGATGGGAGGGGG - Intergenic
931193113 2:60024579-60024601 TGATGGGGGTGGAGGTGAGGAGG + Intergenic
931891626 2:66679455-66679477 TCATGGTGGTGGTGAGGAGGAGG + Intergenic
932007733 2:67944355-67944377 TGAAGGTGGAGGATGGGAGGAGG + Intergenic
932103620 2:68923560-68923582 TCATGGATGTGGGTGGGAGTGGG - Intergenic
932103688 2:68923976-68923998 TCATGGAGGGGGATGGTCAGTGG + Intergenic
932776001 2:74528867-74528889 TCATGGAGATGAATGGGCGGGGG - Exonic
932777364 2:74536260-74536282 GCATGGAGGTGGGAGGGAGAGGG - Intronic
932798325 2:74716803-74716825 TCATGGAGGTGGGGGGCAAGTGG - Intergenic
933624881 2:84587098-84587120 TGAGGGTGGAGGATGGGAGGAGG - Intronic
933758494 2:85659293-85659315 GCATGGGGGTGGGTGTGAGGCGG + Intronic
933770598 2:85741714-85741736 CCATGGAGGTGGAAGGGACTAGG - Intergenic
933779129 2:85789191-85789213 TGCAGGAGGGGGATGGGAGGTGG - Intergenic
933996365 2:87672865-87672887 TGGTGGGGGAGGATGGGAGGAGG - Intergenic
934516835 2:94993677-94993699 TCAGGGAGCTGGGTGAGAGGAGG + Intergenic
934856943 2:97735405-97735427 TCATGGAGATGGCTGGGGGCGGG + Exonic
936120919 2:109743771-109743793 TAAATGAGGAGGATGGGAGGTGG - Intergenic
936223778 2:110627705-110627727 TAAATGAGGGGGATGGGAGGTGG + Intergenic
936521080 2:113212550-113212572 CCATGGAGGAGGAGGGGAAGTGG + Intergenic
936568638 2:113598192-113598214 TCCCCGAGGTGGCTGGGAGGTGG + Intergenic
936752763 2:115666039-115666061 TGAGGGTGGAGGATGGGAGGAGG - Intronic
936961840 2:118083693-118083715 ATATTGAGGTGGATGGTAGGGGG - Intergenic
937086182 2:119173547-119173569 CCAAGGAGCTGGATGAGAGGTGG - Intergenic
937129117 2:119494075-119494097 TCATGGAGCTGGCAGGGAGGTGG + Intronic
937201095 2:120204975-120204997 TCATGGGGATGGATGGGTGGCGG - Intergenic
937321663 2:120964563-120964585 CCATTGTGGTGGAGGGGAGGAGG + Intronic
937571692 2:123370887-123370909 TGAGAGTGGTGGATGGGAGGAGG + Intergenic
937680739 2:124641377-124641399 TCATGGAGGCAGATGTGATGAGG - Intronic
938097311 2:128472043-128472065 TCACTGCGGTGGGTGGGAGGAGG + Intergenic
938122671 2:128644854-128644876 ACAGGGAGGAGGAAGGGAGGAGG - Intergenic
938307099 2:130263801-130263823 ACATGTAGGAGGAAGGGAGGCGG + Intergenic
938393158 2:130921010-130921032 GCAGGGAGGAGGAAGGGAGGTGG - Intronic
938596224 2:132789942-132789964 TCATGGAGATGAAGGGCAGGTGG - Intronic
938600246 2:132830307-132830329 ATGTGGAGGGGGATGGGAGGGGG + Intronic
938797271 2:134728423-134728445 TGATGGAGGGGGAAGGAAGGAGG - Intergenic
939195460 2:138965649-138965671 TCAGGGTGGAGGAGGGGAGGAGG - Intergenic
939231275 2:139429283-139429305 TGATGGAGGTGGGTGGGGGAGGG - Intergenic
939246980 2:139637493-139637515 TCATGGAGGTGAATAGGAACTGG + Intergenic
939362649 2:141193585-141193607 TGAGGGTGGAGGATGGGAGGAGG + Intronic
939530635 2:143356403-143356425 TCATGGTGGGGGAAGGGGGGTGG - Intronic
939976530 2:148723022-148723044 TCAGGGTGGAGGATGGAAGGAGG + Intronic
940081855 2:149812074-149812096 TCATGGAGGAGGGTGAAAGGGGG - Intergenic
940198717 2:151126272-151126294 TGAGGGAGGAGGATGGGAAGGGG + Intergenic
940385288 2:153064375-153064397 ACAAGGAGGTGAGTGGGAGGTGG + Intergenic
941692807 2:168518912-168518934 CTAAGGAGGTGGGTGGGAGGAGG - Intronic
942002856 2:171666618-171666640 GAAGGGAGGTGCATGGGAGGTGG + Intergenic
942050813 2:172139098-172139120 TGATGGGGGAGGGTGGGAGGAGG + Intergenic
942307316 2:174621492-174621514 CGATGGGGGTGGAGGGGAGGGGG - Intronic
944161418 2:196664527-196664549 ACATGGAGGTGCTTGGAAGGTGG - Intronic
944249500 2:197567151-197567173 TTTTGGAGGTGGGTGGGTGGTGG + Intergenic
944404004 2:199361508-199361530 GAAGGGAGGTGGGTGGGAGGGGG - Intronic
944504899 2:200401245-200401267 TCATGGAGATGGATGGTGGGTGG - Intronic
944576367 2:201094879-201094901 TGAAGGTGGAGGATGGGAGGAGG + Intergenic
944996861 2:205303717-205303739 TCATGCATGGGGAAGGGAGGAGG + Intronic
946062075 2:216951194-216951216 TGATGGTGGAGGGTGGGAGGAGG - Intergenic
946181828 2:217953616-217953638 TCAGTGAGGTGGGTGGGAGTGGG - Intronic
946230585 2:218288779-218288801 TCTTGGGGGTGGAAGGGAGTTGG + Intronic
947152655 2:227130909-227130931 GTAGGGAAGTGGATGGGAGGTGG - Intronic
947327029 2:228990857-228990879 TGAGGGAGGAGGATAGGAGGAGG + Intronic
947531471 2:230911443-230911465 TCAGGAAAGTGGGTGGGAGGAGG - Intronic
947666841 2:231911257-231911279 CCATGGAGGTGACTGTGAGGAGG + Intergenic
948131999 2:235607749-235607771 TCCTGGAGGTGGAAGGGCAGCGG + Intronic
948615842 2:239198310-239198332 TCATGGAGGGTGACTGGAGGTGG + Intronic
948669846 2:239561295-239561317 GAAAGGAGGTGGGTGGGAGGGGG - Intergenic
1168831710 20:848624-848646 TCATGAAGGTGGATGGGCCCTGG + Intronic
1168904015 20:1389883-1389905 GCATTGAGGTGGGAGGGAGGTGG - Intronic
1168924915 20:1571586-1571608 TCACCTAGGTGCATGGGAGGTGG + Intronic
1168956608 20:1838675-1838697 TAAAGCAGGGGGATGGGAGGAGG - Intergenic
1168975413 20:1962189-1962211 TTATGCAGGTGGATGGCATGAGG + Intergenic
1169040774 20:2493617-2493639 TCATGGTGGGGGGTGGGGGGTGG - Intronic
1169425848 20:5496895-5496917 AGATGGGGGTGGATGGGGGGAGG - Intergenic
1169680619 20:8208393-8208415 TGATGGAAGGGGAAGGGAGGAGG + Intronic
1170143248 20:13146274-13146296 TGAGGGAGGAGGGTGGGAGGAGG + Intronic
1170323379 20:15127685-15127707 AAAGGGAGGTGGATGGGAGAGGG + Intronic
1170653232 20:18261879-18261901 TGATGGGGGAGGGTGGGAGGAGG + Intergenic
1170842971 20:19939009-19939031 ATTTGGAGATGGATGGGAGGAGG - Intronic
1170987326 20:21270384-21270406 TGATGGTGGAGGGTGGGAGGAGG - Intergenic
1171232583 20:23499587-23499609 CCATGGAGCTGGAGGGGAAGGGG + Intergenic
1172028882 20:31968049-31968071 TAATTGAAGTGGAGGGGAGGAGG + Exonic
1172034252 20:32000460-32000482 TAATGGATGTGGAGGGCAGGTGG - Exonic
1172123432 20:32611572-32611594 TGAGGGAGGCAGATGGGAGGAGG - Intergenic
1172183130 20:33015702-33015724 TTATGGGGTTGGAGGGGAGGGGG + Intronic
1172397598 20:34620050-34620072 AGATGGACTTGGATGGGAGGTGG - Intronic
1172863856 20:38079404-38079426 TGAGGGTGGAGGATGGGAGGAGG - Intronic
1172977821 20:38919846-38919868 TGATGGAGGTGGAAGGGGGTGGG - Exonic
1173222708 20:41142563-41142585 CCATGGTGGTAGATGGGAGAAGG + Intronic
1173558477 20:43984900-43984922 GCTGGGAGGTGGCTGGGAGGGGG - Intronic
1173777287 20:45720690-45720712 TCATGGGGGTGGTAGGGAGAGGG + Intergenic
1173800916 20:45893892-45893914 TCAGGGAGGTTGGTGGGAGGTGG + Intronic
1174322535 20:49753276-49753298 GGATGGAGGTGGGAGGGAGGCGG - Intergenic
1174465359 20:50712973-50712995 TAAGGGAGGGGGAAGGGAGGGGG + Intergenic
1174552177 20:51369984-51370006 TCTTGATGGTGGGTGGGAGGGGG - Intergenic
1174683386 20:52430191-52430213 TGAGGGTGGAGGATGGGAGGAGG + Intergenic
1174724870 20:52851121-52851143 TCATGGGGGTGGAGGGGTGTTGG - Intergenic
1174741067 20:53014807-53014829 TCAGGGAGGTGGAGGGGAGCAGG - Intronic
1174749436 20:53097148-53097170 ACAAGGAGGGGGATGGGATGAGG + Intronic
1175206085 20:57312391-57312413 TCAAGGCAGAGGATGGGAGGCGG + Intergenic
1175428068 20:58882703-58882725 TCATGGTGGTGGGGTGGAGGTGG + Intronic
1175489911 20:59372962-59372984 TCAAGTAGGAGGATGGGGGGAGG - Intergenic
1175974343 20:62702835-62702857 TCATGGGTGTGGATGAGATGGGG - Intergenic
1176039438 20:63056549-63056571 TCCTGGCGGTCGAGGGGAGGGGG - Intergenic
1176864769 21:14041001-14041023 TGATGGGGGAGGGTGGGAGGAGG - Intergenic
1176968030 21:15233600-15233622 TCATGGGGGTGGAGGGGAGGGGG + Intergenic
1177790348 21:25716071-25716093 TCTGGGAGGCGGAGGGGAGGCGG - Intronic
1178032715 21:28546072-28546094 TCAGGGTGGTGGATGGTGGGAGG + Intergenic
1178176173 21:30102139-30102161 TAATGTAGATGGATAGGAGGAGG - Intergenic
1178240517 21:30894281-30894303 TCACGCAGGTGGAGGGGAGTGGG + Intergenic
1179309249 21:40182233-40182255 TCATGTTGGTGAATAGGAGGAGG + Intronic
1179714324 21:43279931-43279953 AGGTGGAGGTGGAGGGGAGGTGG + Intergenic
1179714381 21:43280084-43280106 AGGTGGAGGTGGAGGGGAGGTGG + Intergenic
1179714404 21:43280129-43280151 AGGTGGAGGTGGAGGGGAGGTGG + Intergenic
1179714452 21:43280232-43280254 AGGTGGAGGTGGAGGGGAGGTGG + Intergenic
1179714662 21:43280718-43280740 AGATGGAGGTAGAGGGGAGGTGG + Intergenic
1179784325 21:43720864-43720886 AGTAGGAGGTGGATGGGAGGAGG - Intronic
1180011440 21:45054012-45054034 TCAGGGAGCTGGGTGGGAGCAGG + Intergenic
1180199353 21:46215399-46215421 GCCTGGGGGTGGGTGGGAGGGGG - Intronic
1180237820 21:46474926-46474948 TTGTGGAGGAGGATGGGAGGTGG + Intronic
1180949632 22:19715220-19715242 GCATGAAGGTGCAGGGGAGGTGG - Intronic
1181478847 22:23184913-23184935 TCATGGGGGTGGGTGGGGGGAGG + Intronic
1181677710 22:24467631-24467653 TATTGGGGGTGGAAGGGAGGAGG + Intergenic
1183092583 22:35532892-35532914 CCAGGGAGCTGCATGGGAGGTGG + Intergenic
1183208051 22:36432928-36432950 GCATGGGGGTGGATGGATGGAGG + Intergenic
1183526886 22:38328384-38328406 ACACGGGGGTGGAAGGGAGGAGG + Intronic
1184482198 22:44754189-44754211 GCTGGAAGGTGGATGGGAGGTGG + Intronic
949633364 3:5954255-5954277 TGAGGGTGGAGGATGGGAGGAGG - Intergenic
949779820 3:7673650-7673672 TCATGGAAGTGGATGCCAGCAGG + Intronic
949791385 3:7796363-7796385 TCAAGGAGGTGGTGGGGATGTGG - Intergenic
950485356 3:13270058-13270080 TTGTGGAGGTGTCTGGGAGGTGG - Intergenic
950560983 3:13724183-13724205 TCACTGAGCTGGATGAGAGGAGG + Intergenic
950947694 3:16966915-16966937 TCAGGGTGGAGGGTGGGAGGAGG - Intronic
951044249 3:18020439-18020461 TCATGGAGGGGAGTGGGAGCTGG + Intronic
951734289 3:25847487-25847509 TCGTGAGGGTGGATGAGAGGAGG - Intergenic
952297396 3:32073407-32073429 TCCTGCAGGTGGATGGCAGTTGG - Intronic
952994278 3:38862735-38862757 TCAAGGAGATGGGTGGGAAGAGG + Intronic
953312000 3:41889534-41889556 TCAGGGTGGAGGGTGGGAGGAGG + Intronic
953367039 3:42353956-42353978 ACATGGAGGTGGGTGGGAGGAGG - Intergenic
953462663 3:43094145-43094167 TTATGCAGGTTGTTGGGAGGAGG - Intronic
953727356 3:45411836-45411858 TGAGGGTGGTGGGTGGGAGGAGG - Intronic
954036208 3:47852607-47852629 CCGTGGAGGAGGTTGGGAGGGGG - Exonic
954380529 3:50216594-50216616 GGATGGAGGTGGGTGGGAGGAGG - Intronic
955131329 3:56171933-56171955 GTGTGGAGGTGGATGGAAGGGGG + Intronic
955274523 3:57534449-57534471 TCATGGTGGTGGTGGGGTGGGGG - Intronic
955289195 3:57674973-57674995 TGATGGTGGAGGGTGGGAGGAGG + Intronic
956057269 3:65313225-65313247 TGATGGTGGAGGGTGGGAGGAGG - Intergenic
956236104 3:67072663-67072685 TGATGGTGGAGGGTGGGAGGAGG - Intergenic
956813316 3:72886071-72886093 TCCTAGAGGTAGAAGGGAGGGGG + Intergenic
956994674 3:74811319-74811341 TCATGGAGGTAGCTGGTATGTGG + Intergenic
957484483 3:80840562-80840584 TGATGGAGGAGGGTGGGAGGAGG + Intergenic
958907359 3:99956634-99956656 ACATGGAGGTGGCTGGGCGCGGG - Intronic
958998818 3:100938144-100938166 TGAAGAAGGAGGATGGGAGGAGG + Intronic
959263492 3:104110190-104110212 TCATAGAGGTGCATGAGAGAGGG - Intergenic
960038843 3:113128853-113128875 TCATGTAGGGGGATCGGTGGAGG - Intergenic
960634590 3:119770669-119770691 TGATTGAGCTTGATGGGAGGTGG - Intergenic
960659908 3:120046072-120046094 GGGAGGAGGTGGATGGGAGGAGG + Intronic
960719332 3:120610439-120610461 TCCTGGAGCTGGATGGCTGGTGG + Intergenic
960782685 3:121337094-121337116 TGAGGGTGGTGGGTGGGAGGAGG + Intronic
960823142 3:121755672-121755694 TCATGGATGGGGTTGGGAAGGGG + Intergenic
961321242 3:126078035-126078057 TCAGGGAGGTGGGAGGCAGGTGG - Intronic
961584397 3:127910233-127910255 ACCTGGAGGTGGAGGGGAGGTGG + Intergenic
961832121 3:129628470-129628492 TCCTGGATGGGGATGGGAAGGGG - Intergenic
961910260 3:130307602-130307624 TCAGGGAGAAGAATGGGAGGAGG + Intergenic
962522154 3:136207267-136207289 GCTTGGAGGGGGAAGGGAGGTGG - Intergenic
962626359 3:137229367-137229389 TCAGTGATGTGGCTGGGAGGAGG + Intergenic
962832354 3:139155550-139155572 TGAAGGTGGTGGGTGGGAGGAGG + Intronic
962950732 3:140216209-140216231 CCATGGATGGGGGTGGGAGGCGG - Intronic
962951360 3:140222329-140222351 GGATGGGGGTGGAAGGGAGGTGG + Intronic
963053492 3:141162956-141162978 TGATGGGGGAGGGTGGGAGGAGG + Intergenic
963728246 3:148945935-148945957 TCGTGGATGTGGGTGGGAAGGGG - Intergenic
964134035 3:153324244-153324266 TGAGGGTGGTGGGTGGGAGGAGG - Intergenic
964435237 3:156644201-156644223 TGATGGAGGGGGATGGGTTGAGG - Intergenic
964676942 3:159293806-159293828 TCTCGGAGGTGGAAGGGAAGGGG + Intronic
964791938 3:160460696-160460718 TCTTGGAGGGGGCTGGGAGCAGG - Intronic
965563227 3:170081717-170081739 TGAGGGAGGAGGGTGGGAGGAGG - Intronic
966696357 3:182793794-182793816 GAATGGAGGTGGAGGGGCGGGGG - Intronic
967002631 3:185351194-185351216 TGAAGGTGGAGGATGGGAGGAGG + Intronic
967010048 3:185424019-185424041 TCATGGGGGATGATGGCAGGAGG + Intronic
967114253 3:186322424-186322446 TGAAGGTGGAGGATGGGAGGAGG + Intronic
967596395 3:191329929-191329951 TCAAGGGGGTGGTTGGGGGGGGG + Intronic
968504981 4:967427-967449 TCATGGAGGGGGAGGCCAGGTGG + Intronic
968871366 4:3244398-3244420 CCAAGGAGGTGGAAGGGTGGTGG - Intronic
969523160 4:7690551-7690573 GGATGGCGGTGGATGGGTGGTGG + Intronic
969656176 4:8499758-8499780 TGAGGGAGGAGGTTGGGAGGAGG + Intergenic
969760853 4:9180628-9180650 TCATGAAGGTGGGTGGGGGCTGG - Intergenic
969808730 4:9631492-9631514 ACATGGAGCTAGATGGGAAGAGG - Intergenic
970196205 4:13552602-13552624 TGATGGTGGAGGGTGGGAGGAGG + Intergenic
970281399 4:14459746-14459768 TCATAAAGGTGGAGGGTAGGAGG - Intergenic
970284618 4:14496179-14496201 TCAAGGGAGTGGAGGGGAGGTGG + Intergenic
970412052 4:15818150-15818172 TGATGGAGCTGGGTGGGGGGAGG + Intronic
970555175 4:17224720-17224742 TGAGGGTGGAGGATGGGAGGAGG - Intergenic
970567206 4:17343309-17343331 TCGAGAAGGTGGGTGGGAGGAGG - Intergenic
970666864 4:18346853-18346875 TGTTGGGGGTGAATGGGAGGAGG + Intergenic
970945303 4:21683974-21683996 TGAGGGAGGAGGGTGGGAGGAGG + Intronic
971177869 4:24298043-24298065 CCATGGAGGTGGCTGGTAAGAGG - Intergenic
972105953 4:35487485-35487507 TGAGGGTGGAGGATGGGAGGAGG + Intergenic
972883884 4:43461198-43461220 TCATGCAGCTGGATGTTAGGAGG + Intergenic
973181626 4:47275584-47275606 TAAGGGAGGTGGATGGGGGGAGG + Intronic
973620615 4:52722233-52722255 GCCAGGAGGTGGCTGGGAGGTGG - Intergenic
973672856 4:53237859-53237881 TCAGGGAGGGAGATGGGTGGGGG - Intronic
973740373 4:53913865-53913887 TGAGGGTGGAGGATGGGAGGAGG + Intronic
975395255 4:73868104-73868126 ACATGGAGTAAGATGGGAGGAGG - Intergenic
976071535 4:81245786-81245808 TGTTGGAGGTGGAGAGGAGGAGG + Intergenic
976318357 4:83683606-83683628 TGAGGGTGGAGGATGGGAGGAGG + Intergenic
977298750 4:95242580-95242602 CCATGGCAGTGGATGGCAGGTGG - Exonic
977526415 4:98151615-98151637 TGGTGGATGTGGAGGGGAGGGGG + Intergenic
977763328 4:100766780-100766802 TCAAGGAGAAGGATGGGATGAGG + Intronic
977903625 4:102451187-102451209 TGAGGGTGGAGGATGGGAGGAGG + Intergenic
978364540 4:107967507-107967529 TCAAGGTGGAGGGTGGGAGGAGG - Intergenic
978574365 4:110173831-110173853 TGATGGAGGAGGTTGGGAGGAGG + Intronic
979294780 4:119019059-119019081 TGATGGGGGAGGCTGGGAGGAGG + Intronic
979423967 4:120542064-120542086 GCATGCAGGTGAATGTGAGGAGG - Intergenic
979834366 4:125344811-125344833 TCATGGTGGTGGGGGGCAGGGGG - Intronic
980302972 4:131017808-131017830 TGATGGGGGAGGGTGGGAGGAGG - Intergenic
980387647 4:132107124-132107146 TAAAGCAGGTAGATGGGAGGAGG + Intergenic
980689333 4:136273914-136273936 ACATGGTGGGGGATGGGAGAAGG + Intergenic
981351238 4:143732098-143732120 TGGTGGAGGTGGAGGGGAGCAGG - Intergenic
981446956 4:144850989-144851011 TCATCTAGGTGGATGTGATGGGG + Intergenic
981907605 4:149940168-149940190 TTATGGTGGAGGGTGGGAGGAGG + Intergenic
983649058 4:170020628-170020650 TCAGGGAGGGGAATGGGAGGAGG - Intronic
984564934 4:181318127-181318149 TCATGATGGTGGAGGGGATGGGG - Intergenic
985068382 4:186144802-186144824 GCAGGGAGGAGGAGGGGAGGCGG + Intronic
985795512 5:1958891-1958913 TAATGAAGGTGCCTGGGAGGGGG + Intergenic
986549959 5:8941587-8941609 TGAAGGAGGTGGTTAGGAGGAGG + Intergenic
987068509 5:14313309-14313331 TCATGGCGGTGGAGGGGTAGTGG - Intronic
987414852 5:17652033-17652055 GAAGGGAGGAGGATGGGAGGGGG - Intergenic
988976282 5:36519452-36519474 TGAGGGTGGAGGATGGGAGGAGG + Intergenic
989153323 5:38320994-38321016 CCATGGATGAGGGTGGGAGGTGG + Intronic
989525327 5:42447291-42447313 TCAGGGAGAAGGGTGGGAGGGGG - Intronic
989991863 5:50775196-50775218 CCAAGCAGGTGGCTGGGAGGTGG + Intronic
990039192 5:51358383-51358405 TCATGGAGGTGAGGTGGAGGAGG - Intergenic
990826638 5:59907432-59907454 TGATGGTGGAAGATGGGAGGAGG + Intronic
990991689 5:61690531-61690553 TCATGGAGATGGAGTGGTGGTGG + Intronic
991155134 5:63425350-63425372 TCAGGGAAAAGGATGGGAGGTGG - Intergenic
991933062 5:71774365-71774387 TGAGGGTGGAGGATGGGAGGAGG + Intergenic
992305303 5:75431205-75431227 TGAGGGTGGAGGATGGGAGGAGG - Intronic
993104041 5:83578330-83578352 TGAGGGTGGAGGATGGGAGGAGG + Intronic
995245202 5:109927622-109927644 TGTTGGAGGGGGAGGGGAGGTGG - Intergenic
995269974 5:110208894-110208916 TGAAGGGGGAGGATGGGAGGAGG - Intergenic
995533044 5:113109892-113109914 TCATGGAGTTGCATGGCAGTGGG - Intronic
997645561 5:135479326-135479348 TCATCAAGATGGAAGGGAGGGGG - Intergenic
997754280 5:136381278-136381300 AATGGGAGGTGGATGGGAGGTGG - Intronic
998611326 5:143692526-143692548 TCAGGGAGGTTTATGTGAGGTGG + Intergenic
998661015 5:144237749-144237771 ACATGGAGGTGGAGGGTAGGAGG - Intronic
999080421 5:148838346-148838368 TCTTGGAGGTGGAGTGGTGGGGG + Intergenic
999526950 5:152417071-152417093 TCAAGGTGGAGGGTGGGAGGAGG + Intronic
999853488 5:155568064-155568086 TGATGGTGGAGGTTGGGAGGAGG + Intergenic
1001136045 5:169103728-169103750 ACATGGGGATGGGTGGGAGGGGG - Intronic
1001822867 5:174723681-174723703 TAATGGGGGTGGGGGGGAGGAGG - Intergenic
1003220727 6:4158818-4158840 AGATGGAACTGGATGGGAGGAGG - Intergenic
1003329864 6:5120965-5120987 TCAGGGAGGTAGTTGGGGGGTGG + Intronic
1003592222 6:7445892-7445914 GCATGGGGGTGGGTGGGAGAAGG + Intergenic
1003823291 6:9924469-9924491 TGAGGGAGGAGGGTGGGAGGAGG + Intronic
1004276734 6:14243286-14243308 TGAGGGTGGTGGGTGGGAGGAGG + Intergenic
1004828552 6:19451121-19451143 TCAGGGTGGTGGGTGGGAGGAGG - Intergenic
1005825001 6:29627453-29627475 ACATGGGGGTGGGTGGGAGGTGG - Intronic
1006268093 6:32942081-32942103 TGAGGGTGGAGGATGGGAGGAGG - Intronic
1006724838 6:36190811-36190833 TCCTGGATGTGAAGGGGAGGAGG - Intergenic
1007122369 6:39393719-39393741 CCCTGGATGTGGTTGGGAGGAGG + Intronic
1007725186 6:43911728-43911750 GCAGGGAGGTGGGTGTGAGGTGG - Intergenic
1008839836 6:55889159-55889181 TCATGGGGGTGGGTGGGTAGAGG - Intergenic
1009592001 6:65684884-65684906 TGAGGGTGGAGGATGGGAGGTGG - Intronic
1010962251 6:82158547-82158569 TCAGGGAGAAGGGTGGGAGGGGG + Intergenic
1012144294 6:95662127-95662149 TGAGGGTGGAGGATGGGAGGAGG + Intergenic
1012425095 6:99105278-99105300 TAATGGAGGGGGAGGGAAGGAGG + Intergenic
1012604611 6:101142767-101142789 TGAGGGTGGAGGATGGGAGGAGG - Intergenic
1012908219 6:105091675-105091697 TCCTGGACGTGGCTTGGAGGTGG - Intergenic
1013457671 6:110345778-110345800 TGAGGGTGGAGGATGGGAGGAGG + Intronic
1013864457 6:114678483-114678505 TGATGGGGGAGGGTGGGAGGAGG + Intergenic
1014015274 6:116522282-116522304 TCATGGAGTTGGATAGGACATGG - Exonic
1014707029 6:124760249-124760271 TGAAGCAGGAGGATGGGAGGAGG + Intronic
1014888242 6:126808831-126808853 TCCTGGAGGGGGGTGGGGGGTGG - Intergenic
1015192056 6:130482408-130482430 TGATGGTGGAGGATGGGAGGAGG + Intergenic
1015288844 6:131515006-131515028 TGATGGGGGAGGGTGGGAGGAGG - Intergenic
1015526061 6:134175923-134175945 TCAGGAATGTGGAGGGGAGGGGG + Intronic
1015968271 6:138716952-138716974 TTAGGGAGGAGGAAGGGAGGGGG - Intergenic
1016287931 6:142493966-142493988 TGAGGGAGGAGGGTGGGAGGAGG + Intergenic
1016612470 6:146006927-146006949 TATTGGGGGTGGATAGGAGGTGG + Intergenic
1016870619 6:148812833-148812855 TCATGGGTGTGAATGGCAGGAGG + Intronic
1017388203 6:153909926-153909948 TCATGGAGATGGAGGGTAGAAGG + Intergenic
1017611635 6:156193039-156193061 TGAGGGAGGAGGGTGGGAGGAGG - Intergenic
1018742174 6:166738337-166738359 GCAGGGAGGTGGCTGGGAAGTGG + Intronic
1018771533 6:166975300-166975322 TGATGGGGGAGGGTGGGAGGAGG - Intergenic
1019413499 7:916924-916946 CCAGGGAGGTGCACGGGAGGGGG + Intronic
1019647865 7:2140592-2140614 CCATGGATGTGGGTGGGAGCCGG + Intronic
1019686532 7:2384919-2384941 GCAGGGAGGGGGCTGGGAGGAGG + Intergenic
1019800418 7:3084353-3084375 ACATGGAGGTGAATGGGTGTGGG + Intergenic
1019932011 7:4230089-4230111 GCAGGCAGATGGATGGGAGGTGG + Intronic
1019961513 7:4464359-4464381 TCATAGAGGTGGAAGGGGTGGGG - Intergenic
1020290627 7:6719809-6719831 TGGGCGAGGTGGATGGGAGGGGG + Intergenic
1021403479 7:20237190-20237212 TGGTGGGGGTGGGTGGGAGGTGG + Intergenic
1022144859 7:27527004-27527026 ACATGGGGGTGGCAGGGAGGTGG + Intronic
1022204901 7:28154131-28154153 TCATGGGTTGGGATGGGAGGGGG - Intronic
1022861668 7:34373692-34373714 GGATGAAGGTGGATGGGAAGAGG + Intergenic
1023073731 7:36462850-36462872 TCATGCTGGTGGGAGGGAGGGGG + Intergenic
1023861396 7:44219559-44219581 GCCTGGGGGTGGATGGGAGAGGG - Intronic
1023881644 7:44324635-44324657 TCATCGAGGTGGATGGGGGCTGG - Intronic
1023967240 7:44969383-44969405 CCAGGGATGTGGGTGGGAGGGGG + Intronic
1024546687 7:50528423-50528445 TCATGAAGGTGCAGGGGAGAGGG - Intronic
1026343777 7:69456413-69456435 TGAAGGTGGAGGATGGGAGGAGG - Intergenic
1026385197 7:69839868-69839890 TGGTGGAGGTGGAGGAGAGGGGG + Intronic
1026947612 7:74326406-74326428 CCAGACAGGTGGATGGGAGGAGG + Intronic
1026975559 7:74495632-74495654 TCCTGGAGGAGGAGGGAAGGAGG + Intronic
1027246843 7:76373428-76373450 TCATGGAGGAGGATAGGAGGAGG + Intergenic
1029467708 7:100736661-100736683 GCAGGGAGGTGGCTGGGAGGCGG + Intronic
1029905119 7:104084576-104084598 TCAGGGGGAAGGATGGGAGGAGG + Intergenic
1029941223 7:104482661-104482683 TCAAGGAGGTGGCAGGGAGAAGG - Intronic
1030349221 7:108464486-108464508 TGATGGGGGAGGGTGGGAGGAGG + Intergenic
1031059263 7:117031185-117031207 TGAAGGAGGAGGGTGGGAGGAGG + Intronic
1031288081 7:119898070-119898092 TGATGGAGGAGGCTGGGAAGGGG - Intergenic
1031465463 7:122104774-122104796 TGAGGGTGGAGGATGGGAGGAGG + Intronic
1031502518 7:122537019-122537041 TGAGGGTGGAGGATGGGAGGAGG + Intronic
1031506204 7:122587259-122587281 TCATGGGGTGGGATGGGAGGAGG - Intronic
1032340590 7:131069105-131069127 TAATGGAGATGGGTGGGGGGGGG - Intergenic
1033098590 7:138451544-138451566 TGGTGGTGGTGGGTGGGAGGGGG + Intergenic
1033328608 7:140399257-140399279 TGGTGGTGGTGGATGGGGGGCGG - Intronic
1033347179 7:140534589-140534611 TCAAGGAGGGGGATGGGAGGTGG + Intronic
1033453552 7:141482546-141482568 TTGTGGAGGTGGATGGGGGAAGG - Intergenic
1034075364 7:148226362-148226384 TCTTGGTGGTTGGTGGGAGGGGG - Intronic
1034366657 7:150555533-150555555 TTAGGGTGGAGGATGGGAGGAGG + Intergenic
1036195064 8:6707293-6707315 TTATGGTGGTGGTGGGGAGGGGG + Intergenic
1036270962 8:7302479-7302501 TCATGAAGGTGGGTGGGGGCTGG - Intergenic
1036350387 8:8007865-8007887 TCATGAAGGTGGGTGGGGGCTGG + Intergenic
1036728762 8:11243409-11243431 CAAAGGAGGTGGTTGGGAGGTGG + Intergenic
1036845653 8:12168290-12168312 TCATGAAGGTGGGTGGGTGCTGG + Intergenic
1036867021 8:12410609-12410631 TCATGAAGGTGGGTGGGTGCTGG + Intergenic
1036964912 8:13286253-13286275 ACAGGGAGGTGGAGAGGAGGTGG + Intronic
1037096511 8:14992950-14992972 TGAAGGAGGAGGATGGGTGGGGG - Intronic
1037692621 8:21195042-21195064 GCATGGAGGGGGCTGTGAGGTGG + Intergenic
1037718018 8:21416156-21416178 TCATGAAGGCTGATGGGAGATGG + Intergenic
1037886140 8:22597429-22597451 GCATGGCGGTGGTGGGGAGGAGG + Intronic
1038419056 8:27420446-27420468 ACAGGGAGGTGGCTGGCAGGTGG - Intronic
1038483018 8:27914707-27914729 GCATGGAGGTGGCTGGGACAAGG + Intronic
1039631342 8:39114863-39114885 TGAAGGTGGAGGATGGGAGGAGG - Intronic
1039864514 8:41489896-41489918 TGAGGGATGTGGATGGGAGCTGG + Intergenic
1039948497 8:42150264-42150286 CCATGGAGGTGGTGAGGAGGAGG - Intergenic
1040013817 8:42683902-42683924 TCTTGGAAGTGGATTGGAAGTGG + Intergenic
1040533627 8:48286615-48286637 TGAGGGAGGAGGATAGGAGGAGG + Intergenic
1040603786 8:48910138-48910160 TCCAGGAGGTGGGTGGGAGGAGG - Intergenic
1040783861 8:51141978-51142000 TCTTGGAGGTGGAGGGGTGGAGG + Intergenic
1041914033 8:63121684-63121706 TGAGGGAGGAGGGTGGGAGGAGG - Intergenic
1042079468 8:65035304-65035326 TGAGGGTGGAGGATGGGAGGAGG - Intergenic
1042146444 8:65735132-65735154 TCAAGTAGGTTGATGGCAGGGGG - Intronic
1042210989 8:66380288-66380310 TCATGGCGGTGGAGGGGTAGAGG - Intergenic
1042223300 8:66494448-66494470 TCATGGAGGTGGATGGGAGGGGG - Intronic
1042362812 8:67901971-67901993 TTTTGGAGGTGGAGGGCAGGGGG - Intergenic
1042795263 8:72655294-72655316 TGAGGGTGGGGGATGGGAGGAGG + Intronic
1042953018 8:74220544-74220566 TTAAGGGGGTGGGTGGGAGGTGG - Intergenic
1043017356 8:74956316-74956338 CCATAGAAGTGGATGGGATGTGG + Intergenic
1043224882 8:77713607-77713629 TCATGGAGGTGGTTTGAAGTAGG - Intergenic
1043334198 8:79152802-79152824 TTATAGAGGTGGTTGGCAGGTGG - Intergenic
1043608267 8:82029187-82029209 TCATGAATGTGCATTGGAGGGGG + Intergenic
1044065824 8:87699216-87699238 TGATGGAGGAGGAAGGGTGGAGG + Intergenic
1044641224 8:94383828-94383850 TCATCCTAGTGGATGGGAGGTGG - Intronic
1044953667 8:97457719-97457741 TCAGGGGGAAGGATGGGAGGGGG + Intergenic
1045118818 8:99013311-99013333 ACTTGGAGGTGGAGGGGACGCGG + Exonic
1045819909 8:106324358-106324380 TGAGGGAGGAGGTTGGGAGGAGG + Intronic
1046432557 8:114148386-114148408 TGAGGGTGGAGGATGGGAGGAGG - Intergenic
1046611653 8:116432491-116432513 TCTTGGTAGGGGATGGGAGGTGG - Intergenic
1046670851 8:117054612-117054634 TAAGGGAGGTGGGTGGGGGGTGG - Intronic
1046819908 8:118622609-118622631 GCATGGGGGTGTAGGGGAGGAGG + Intergenic
1047168550 8:122467012-122467034 TCGGGGAGGTGTGTGGGAGGTGG - Intergenic
1047732949 8:127741461-127741483 GGATGGTGGTGGTTGGGAGGGGG - Intergenic
1048293136 8:133195689-133195711 TCAAGGAGCTGGTTGGGCGGAGG - Intronic
1049659806 8:143814927-143814949 TCAGGGAGGTGGATGGGGTTAGG - Intronic
1049663454 8:143831034-143831056 TGGAGGGGGTGGATGGGAGGTGG + Intergenic
1049883889 9:15333-15355 TCCCCGAGGTGGCTGGGAGGTGG - Intergenic
1050925898 9:11262375-11262397 GCATGGAGGAAGATGGAAGGAGG + Intergenic
1051129993 9:13850032-13850054 TGAGGGTGGAGGATGGGAGGAGG + Intergenic
1052354191 9:27487505-27487527 TCATGGAGGTGATGGGGATGTGG - Intronic
1052733306 9:32314958-32314980 TCATGGAGATAGATGGTAGAAGG + Intergenic
1053425834 9:38009288-38009310 ACATGGAGGTGGCTGGGGGTGGG + Intronic
1053516697 9:38736258-38736280 TCATTGATATGGATGGGAGCTGG - Intergenic
1054824458 9:69558724-69558746 TGAGGGTGGAGGATGGGAGGAGG - Intronic
1056129741 9:83572420-83572442 AAATGGAGGTAGATGAGAGGTGG + Intergenic
1056374246 9:85991300-85991322 TCATGGAGGTGGTTGTGTGCAGG + Intronic
1056923543 9:90813308-90813330 TGATGGAGGTGGCTGGGGTGGGG - Intronic
1057087279 9:92222843-92222865 TCATAGAGGTGAAGGGGAAGGGG + Intronic
1057362499 9:94387146-94387168 TCATTAAGGTGGGTGGGAAGGGG + Intronic
1057660838 9:97000949-97000971 TCATTAAGGTGGGTGGGAAGGGG - Intronic
1057720424 9:97527775-97527797 TCAGGGAGATGGGTGAGAGGTGG + Intronic
1057892634 9:98880882-98880904 TGAAGGTAGTGGATGGGAGGAGG + Intergenic
1058200043 9:102027934-102027956 ACATGGATGGGGATGGGTGGAGG + Intergenic
1058881276 9:109287934-109287956 TAATGGAGATGGAAGGGAAGAGG - Intronic
1058951268 9:109906083-109906105 ACATGGAAGTGGCTGAGAGGTGG + Intronic
1059372435 9:113853444-113853466 TGATGGAGGTGGGGTGGAGGAGG - Intergenic
1059622585 9:116024008-116024030 TGAGGGTGGAGGATGGGAGGAGG - Intergenic
1059654897 9:116348645-116348667 ACAGGGAAGAGGATGGGAGGAGG - Intronic
1059880593 9:118684696-118684718 TCATAGGGGTGGAGGGGAGGAGG - Intergenic
1060206050 9:121683397-121683419 TCCTCAAGGTTGATGGGAGGGGG - Intronic
1060930605 9:127487362-127487384 CCATGGAGGTGGCTGGGCAGAGG + Intronic
1061015296 9:127977837-127977859 TCATGGAGCAGGAGTGGAGGTGG - Intronic
1061491666 9:130948162-130948184 ACATGCTGGTGGATGGGATGTGG - Intergenic
1061865689 9:133490837-133490859 TGCTGGAGGAGGAGGGGAGGGGG + Intergenic
1062192135 9:135253507-135253529 TGGGGGTGGTGGATGGGAGGTGG + Intergenic
1062340155 9:136090561-136090583 TCATGGAGGGCGTTGGGAGCTGG - Intronic
1186676821 X:11826420-11826442 TAAAGGAGGAGGATAGGAGGGGG + Intergenic
1186890716 X:13956777-13956799 TGAGGGTGGAGGATGGGAGGAGG + Intergenic
1187301262 X:18052390-18052412 TGAGGGTGGAGGATGGGAGGAGG - Intergenic
1187343678 X:18443713-18443735 TGAGGGTGGAGGATGGGAGGAGG - Intronic
1187793510 X:22976952-22976974 TGAGGGAGGAGGGTGGGAGGAGG + Intergenic
1188309164 X:28596390-28596412 TGATAGAGGTGGAAGGAAGGGGG - Intronic
1188757161 X:33976069-33976091 TGAGGGTGGAGGATGGGAGGAGG + Intergenic
1189220045 X:39363734-39363756 TGATGGGGGAGGGTGGGAGGAGG + Intergenic
1190387875 X:49900473-49900495 GCGAGGAGGTGCATGGGAGGGGG + Intergenic
1190442874 X:50493516-50493538 TCTTGAAGGTGGAGGGGAGCTGG - Intergenic
1190743581 X:53306724-53306746 ACAGGGAGGAGGATGGGAGAGGG + Intronic
1190859584 X:54331056-54331078 AAATGGGGGTGGGTGGGAGGAGG + Intronic
1191162267 X:57342767-57342789 TAAAGGTGGAGGATGGGAGGAGG - Intronic
1191704199 X:64076484-64076506 TCATGGAGATGGAGGGTAGAAGG + Intergenic
1191761807 X:64654792-64654814 TCCTGCAGGTGGATGGCAGTCGG - Intergenic
1191766040 X:64699209-64699231 TCATGGAGATAGATGGTAGAAGG - Intergenic
1191975688 X:66868720-66868742 GCAGGGAGGGGGAGGGGAGGGGG - Intergenic
1192552765 X:72067263-72067285 GCATGGGGGTGGTGGGGAGGAGG - Intergenic
1192659037 X:73022424-73022446 TAAGGCAGGTGGCTGGGAGGTGG + Intergenic
1193278274 X:79617428-79617450 GCATGGGGGTGGTGGGGAGGAGG - Intergenic
1193700762 X:84758060-84758082 TCATGGGGACGGTTGGGAGGGGG - Intergenic
1193824098 X:86201285-86201307 TGAGGGGGGTGGGTGGGAGGAGG + Intronic
1193920761 X:87423138-87423160 GGAGGGTGGTGGATGGGAGGAGG + Intergenic
1194333512 X:92615337-92615359 GCATGGAGGTGGAACGGAGAGGG + Intronic
1194374726 X:93118116-93118138 TCTTGGAGGTGGAGGGTGGGAGG + Intergenic
1194406787 X:93506294-93506316 TCCTGGAGCTGGATGGTGGGAGG + Intergenic
1195275900 X:103280282-103280304 TGAGGGTGGAGGATGGGAGGAGG - Intergenic
1195483061 X:105370368-105370390 TGATGGTGGAGGGTGGGAGGAGG - Intronic
1196303244 X:114070475-114070497 TGATGGGGGAGGGTGGGAGGAGG - Intergenic
1196810405 X:119624597-119624619 TGATGCAGGGGGATGGGAGAGGG + Intronic
1197095935 X:122595200-122595222 TTTTGGAGGTGGAGGGTAGGAGG - Intergenic
1197441795 X:126500538-126500560 TCGTGGGGAAGGATGGGAGGGGG - Intergenic
1197526312 X:127568755-127568777 TAATGGAGGAGTATGGGAGGAGG - Intergenic
1197735445 X:129847521-129847543 TAAGGGAGGGAGATGGGAGGGGG - Intergenic
1198934837 X:141895090-141895112 TCAGGGAGGAGGGTGGGAGGGGG + Intronic
1199090159 X:143681763-143681785 TGAGGGAGGAGGATGGGAGGAGG - Intergenic
1199306544 X:146273523-146273545 TGAGGGAGGAGGTTGGGAGGGGG - Intergenic
1199309332 X:146304780-146304802 TGATAGAGGTGGTTGTGAGGAGG - Intergenic
1199601443 X:149543708-149543730 TCACAGAGGTGGAAGGGAGGTGG + Intronic
1199648933 X:149935776-149935798 TCACAGAGGTGGAAGGGAGGTGG - Intronic
1200067137 X:153509335-153509357 TCCCGGAGGAGGTTGGGAGGTGG + Exonic
1200211635 X:154349223-154349245 TCCAGGAGGTGGCAGGGAGGTGG + Intronic
1200403651 Y:2786187-2786209 TTATGGAGATGGAAGGGCGGGGG - Intergenic
1200642196 Y:5734342-5734364 GCATGGAGGTGGAACGGAGAGGG + Intronic
1200682750 Y:6232182-6232204 TCTTGGAGGTGGAGGGTGGGAGG + Intergenic
1200914866 Y:8562732-8562754 CCATGGAGGTGTGTAGGAGGTGG + Intergenic
1200934227 Y:8724267-8724289 CCATGGAGGTGGGTTGGTGGTGG - Intergenic
1201762109 Y:17551778-17551800 TGATGGAGGAGGGTGGGAGGAGG + Intergenic
1201839443 Y:18354210-18354232 TGATGGAGGAGGGTGGGAGGAGG - Intergenic
1202370899 Y:24194778-24194800 TCTTGGAGGTGGTGGGGCGGTGG + Intergenic
1202499885 Y:25475339-25475361 TCTTGGAGGTGGTGGGGCGGTGG - Intergenic