ID: 1042223301

View in Genome Browser
Species Human (GRCh38)
Location 8:66494449-66494471
Sequence GTCATGGAGGTGGATGGGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 582
Summary {0: 1, 1: 0, 2: 9, 3: 57, 4: 515}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042223301_1042223310 -6 Left 1042223301 8:66494449-66494471 CCCCTCCCATCCACCTCCATGAC 0: 1
1: 0
2: 9
3: 57
4: 515
Right 1042223310 8:66494466-66494488 CATGACTCAGGCTTAGCCCCTGG No data
1042223301_1042223314 22 Left 1042223301 8:66494449-66494471 CCCCTCCCATCCACCTCCATGAC 0: 1
1: 0
2: 9
3: 57
4: 515
Right 1042223314 8:66494494-66494516 TTGTCAGCCTTGAATGAAGTAGG No data
1042223301_1042223316 27 Left 1042223301 8:66494449-66494471 CCCCTCCCATCCACCTCCATGAC 0: 1
1: 0
2: 9
3: 57
4: 515
Right 1042223316 8:66494499-66494521 AGCCTTGAATGAAGTAGGCTGGG No data
1042223301_1042223315 26 Left 1042223301 8:66494449-66494471 CCCCTCCCATCCACCTCCATGAC 0: 1
1: 0
2: 9
3: 57
4: 515
Right 1042223315 8:66494498-66494520 CAGCCTTGAATGAAGTAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042223301 Original CRISPR GTCATGGAGGTGGATGGGAG GGG (reversed) Intronic
900204845 1:1427438-1427460 GTGATGGAGGGGAAGGGGAGGGG - Intronic
900271358 1:1790920-1790942 GTCATGGATGGGCATGGAAGGGG + Intronic
900596374 1:3481950-3481972 GCCATGGAGGTGACCGGGAGAGG - Intergenic
900788188 1:4662918-4662940 TGCCTGGAGGTGGAGGGGAGAGG + Intronic
902740618 1:18435687-18435709 ATGAGGGAGGTGGATGGGAGAGG - Intergenic
902785632 1:18730938-18730960 GAAATGGAGGAGGAAGGGAGAGG + Intronic
902964289 1:19987215-19987237 GCCATGGAGGAGCATGGGGGCGG - Intergenic
903013017 1:20343793-20343815 GTCCTGGAGGCCGACGGGAGAGG - Intronic
904076963 1:27850455-27850477 GTCATGGAGAAGGGTGGGATTGG + Exonic
905111808 1:35600589-35600611 GTCATAGAGGCGGTTTGGAGAGG + Intronic
905197087 1:36288303-36288325 CTCAAGGAGAAGGATGGGAGGGG - Intronic
905243520 1:36596716-36596738 GTCCTGGAGCTGGATGTGAAAGG - Intergenic
905908728 1:41639260-41639282 GGCAAAGGGGTGGATGGGAGGGG + Intronic
906146137 1:43561738-43561760 CTCAGGGATGGGGATGGGAGAGG + Intronic
906639216 1:47431665-47431687 GTGGTGGTGGTGGATGGGGGAGG + Intergenic
907076916 1:51587407-51587429 GTCATGGAGGTGGGTGGAAATGG - Intronic
907900938 1:58740971-58740993 GTGGTGGTGGTGGTTGGGAGTGG + Intergenic
908140574 1:61180133-61180155 GCCATGATGCTGGATGGGAGGGG - Intronic
908155652 1:61350044-61350066 GGCATGGAGGTGAAAGGGTGGGG - Intronic
909340669 1:74527876-74527898 GTCTATGTGGTGGATGGGAGTGG + Intronic
910480783 1:87656056-87656078 GACATGGTGGTGGAATGGAGAGG + Intergenic
910655837 1:89617079-89617101 GTGATAGTGGTGTATGGGAGAGG - Intergenic
913599601 1:120410426-120410448 GACATGGAGTTGTAAGGGAGTGG + Intergenic
914087780 1:144469189-144469211 GACATGGAGTTGTAAGGGAGTGG - Intergenic
914310832 1:146465015-146465037 GACATGGAGTTGTAAGGGAGTGG + Intergenic
914314342 1:146495707-146495729 GACATGGAGCTGTAAGGGAGTGG - Intergenic
914500007 1:148237674-148237696 GACATGGAGCTGTAAGGGAGTGG + Intergenic
914591272 1:149108131-149108153 GACATGGAGTTGTAAGGGAGTGG - Intergenic
915452213 1:156013939-156013961 GTGATTGAAATGGATGGGAGAGG - Intronic
915970652 1:160352860-160352882 GAGATGGAGGTAGGTGGGAGGGG - Intronic
916853449 1:168726881-168726903 GCCATGGGGGTGGATGAGAATGG + Intronic
918233921 1:182560534-182560556 GCCCTGGAGGTGTATGGGTGAGG - Exonic
919848117 1:201654403-201654425 GTGATGGGGGTGGGTGGTAGGGG - Intronic
920086447 1:203421232-203421254 GGCAGGGAGGGGGAGGGGAGGGG + Intergenic
920121465 1:203661816-203661838 GTAATGGAGGTGGAGGCCAGTGG - Intronic
921445266 1:215239032-215239054 GTCGTTGAGGTGGTTGGGGGAGG - Intergenic
922456652 1:225778643-225778665 ATAATGGAGGTGGATGTCAGAGG + Intronic
922579465 1:226686185-226686207 GCCATGGGGGTGGATGGGCAGGG + Intronic
922817566 1:228460968-228460990 GTCATTGAGGTGGAAAGGAGAGG - Intergenic
923432541 1:233937065-233937087 TTCATGGGGGTAGATGGGAGTGG - Intronic
924255605 1:242179761-242179783 GGCATGGTGGTGCATGGCAGTGG + Intronic
924297683 1:242604780-242604802 GAAATGGGGGTGGATGGAAGAGG + Intergenic
1063109877 10:3026299-3026321 GTTATGGAGATAGATGGTAGTGG - Intergenic
1063859909 10:10295788-10295810 GTCGGGGTGGTGGAGGGGAGCGG - Intergenic
1064204959 10:13315004-13315026 GTCTTGAATGAGGATGGGAGTGG - Intergenic
1065092032 10:22244876-22244898 GTTATGGAGGTAGAATGGAGAGG - Intergenic
1065210539 10:23398264-23398286 TCCCTGGAGGTGGATGGGAGGGG + Intergenic
1066183230 10:32983511-32983533 GCCAGTGAGGTGGATGAGAGTGG + Intronic
1067085782 10:43237450-43237472 GAAATGGAGGTGGGGGGGAGGGG - Intronic
1067428436 10:46226552-46226574 GGCATGGAGGTGATTGGGACAGG - Intergenic
1068956189 10:62819928-62819950 GTGCTGGAGGTGGAGGGGTGTGG + Intronic
1069617618 10:69816192-69816214 GTCATGGAGGTGGTGAGAAGGGG + Intronic
1069837696 10:71319527-71319549 CTCAGGGAGGAGGAGGGGAGAGG - Intronic
1070065266 10:73027633-73027655 GTCAGGGAGGGGGAGGGGGGAGG + Intronic
1070939012 10:80326830-80326852 GCCAGGGAGGGGGATGGCAGGGG - Intergenic
1071173962 10:82901553-82901575 CTCCTAGAGCTGGATGGGAGTGG - Intronic
1071305924 10:84298720-84298742 GTCATAGAAAGGGATGGGAGTGG + Intergenic
1071331939 10:84569386-84569408 GGTATGGAGGGGCATGGGAGAGG + Intergenic
1071416342 10:85445178-85445200 GGGATGGAGGTGTCTGGGAGAGG + Intergenic
1071665203 10:87548323-87548345 TTCTTGGAGGGGGAGGGGAGGGG - Intronic
1071806900 10:89132299-89132321 GTCCAGGATGTGGATGGGATTGG + Intergenic
1071992047 10:91109070-91109092 GGCATGGAGGTGCATGGAATGGG + Intergenic
1072464056 10:95646811-95646833 GGCATGGTGGGGGATGGGAGGGG + Intronic
1072713610 10:97734854-97734876 GACAGGGTGGGGGATGGGAGTGG + Intergenic
1072743181 10:97922505-97922527 GCCAAGGAGGTGGGTGGCAGGGG + Intronic
1073095507 10:100977292-100977314 GAGAAGGAGCTGGATGGGAGAGG + Intronic
1073289259 10:102405295-102405317 GTCTAGGGGATGGATGGGAGTGG - Intronic
1073519766 10:104117099-104117121 ATCTTGCAGGTGGAAGGGAGAGG + Intergenic
1074072804 10:110090013-110090035 GTGATGGTGGGGGTTGGGAGAGG - Intronic
1074138604 10:110650506-110650528 GTCATGCATGTGTTTGGGAGTGG + Intronic
1074917525 10:117971819-117971841 CCCATTGAGGTGGAGGGGAGTGG + Intergenic
1075616494 10:123893664-123893686 GCCATGGAGGAGGGTGGGTGGGG - Intronic
1075620974 10:123928076-123928098 TACATGGTGGTGGAGGGGAGTGG - Intronic
1076555419 10:131318128-131318150 GGCAGGGAGGTAGAAGGGAGAGG + Intergenic
1076809435 10:132878952-132878974 GACAAGGAGGGGGGTGGGAGTGG + Intronic
1076879826 10:133234723-133234745 GGCATGGAGGTGTCGGGGAGGGG + Intergenic
1077192298 11:1260515-1260537 GTCCTGGAGGGCCATGGGAGGGG + Intronic
1077351281 11:2094353-2094375 GGCATGGAGGAGGGTGGCAGTGG + Intergenic
1078467248 11:11559504-11559526 GGCATGGAGAGGGATGGGATAGG + Intronic
1078922727 11:15845451-15845473 GTCCTGAAGGTGGATGGGAGGGG - Intergenic
1079077833 11:17394851-17394873 GGCATGCAGGTGGATGGGGCAGG + Intronic
1079299207 11:19262502-19262524 GTCTTGGTGGTGGATGAGAGAGG - Intergenic
1080056938 11:27916279-27916301 GTAATGGAGATGGAAAGGAGGGG + Intergenic
1081732094 11:45378769-45378791 GTAATGGAGGTTGTAGGGAGGGG + Intergenic
1082869113 11:57927668-57927690 TTGATGGAGGAGGTTGGGAGGGG - Intergenic
1083281173 11:61628154-61628176 TTCATGGAGGTGGCTAGGATGGG + Intergenic
1083384360 11:62296670-62296692 TTCATGGAGGAGGAGGGGAGGGG + Intronic
1083880915 11:65547876-65547898 GGCATGCAGGTGGGTGGGGGGGG - Intronic
1084394378 11:68899130-68899152 CTCAGGTAGGTGGAGGGGAGAGG + Intronic
1084634579 11:70382439-70382461 GTCATGGGGGTGGAGTGGGGAGG + Intronic
1084734499 11:71095639-71095661 GGGATGGAGGGGGATGGGATGGG - Intronic
1084999315 11:73015216-73015238 GTAATGAAGGTGGATGAGAATGG - Intronic
1085196167 11:74673090-74673112 GCCAGAGAGGTGGAGGGGAGAGG - Intergenic
1085335665 11:75692400-75692422 GTCATAGAACTGGCTGGGAGCGG - Intergenic
1086599717 11:88617859-88617881 GACCAGGAGGTGGGTGGGAGAGG + Intronic
1086736389 11:90311001-90311023 GTCTTGTAGGTGGATGATAGTGG - Intergenic
1087176960 11:95104995-95105017 GGCATGGAGGTGGGTGGGAGAGG + Intronic
1088582803 11:111331661-111331683 GGCATGGAGAGGGATGGAAGTGG + Intergenic
1088714268 11:112535054-112535076 GACATGGGGGTGGAGGGGAGAGG + Intergenic
1088714890 11:112540375-112540397 GTGATTGAAGTGGATGGGGGTGG + Intergenic
1089271045 11:117301417-117301439 GACATGGAGGTGTGTGGGAGGGG - Intronic
1089292981 11:117449698-117449720 CTAGTGGAGGTGGATGGCAGAGG - Intronic
1089452137 11:118606283-118606305 GACAAGGAGGGGGAGGGGAGAGG - Intergenic
1089597578 11:119590851-119590873 TTCCTGGAGGTGGAAGGGAGAGG + Intergenic
1089776555 11:120841194-120841216 GTTCTGGAGGTGGATGGTATTGG - Intronic
1091269148 11:134293419-134293441 GTCATGGAGATGAGTGGGAAGGG + Intronic
1091283472 11:134395395-134395417 GTCATGATGGGTGATGGGAGTGG + Intronic
1091354312 11:134923901-134923923 ATGAGGGAGCTGGATGGGAGAGG + Intergenic
1091541911 12:1469865-1469887 GGCATTGAGGAGGATGGGGGTGG - Intronic
1091624755 12:2113402-2113424 GTTGGGGAGGTGGCTGGGAGAGG + Intronic
1091657587 12:2356814-2356836 GGAATGCAGGTGGAGGGGAGGGG - Intronic
1091760793 12:3085827-3085849 GACCTGGAGGTGGATGGAGGAGG + Intronic
1091807836 12:3368244-3368266 TCCTTGGAGGTGGAGGGGAGAGG - Intergenic
1092091618 12:5808517-5808539 ATCATGGAGGGGGAGGAGAGGGG + Intronic
1092817354 12:12323145-12323167 GGAAGGGAGGGGGATGGGAGGGG + Intergenic
1093065797 12:14656877-14656899 TCCATGGAGGTGGCAGGGAGTGG + Intronic
1093315624 12:17646620-17646642 GTCATTGAGGAGGAGAGGAGAGG + Intergenic
1093417415 12:18935622-18935644 GGCATGTAGGTGGGTGGGTGGGG - Intergenic
1094015111 12:25854656-25854678 GACAGGGAGGTGGATGGCTGGGG - Intergenic
1094423490 12:30296297-30296319 GGAATGGGGATGGATGGGAGGGG - Intergenic
1094603410 12:31930329-31930351 GAGATGCAGGTGGCTGGGAGCGG - Intergenic
1095919259 12:47513042-47513064 GTTGTGGAGGGGGAGGGGAGAGG + Intergenic
1096009070 12:48197973-48197995 GCTATGGAGGTGGATGTGATTGG + Intergenic
1097011668 12:55957565-55957587 GTCATGGAGCTGGAGGGCAAAGG + Exonic
1097187299 12:57202664-57202686 GACATGGAGTGGGATGGGTGAGG - Intronic
1098431262 12:70422461-70422483 CTCAAGGAGGTCGATGGAAGAGG + Intronic
1100613091 12:96208507-96208529 GTGAAGGAGCTGGAAGGGAGAGG + Intronic
1101353227 12:103952824-103952846 GACATGGAGGAGGATGAGGGAGG + Intronic
1101724185 12:107375737-107375759 GCAGTGGAGGTGGAAGGGAGGGG - Intronic
1101819525 12:108173231-108173253 GTCTGGGATGAGGATGGGAGGGG - Intronic
1102772942 12:115494392-115494414 TTCATGGAAGGGGATGGGATAGG + Intergenic
1102885663 12:116519821-116519843 GTCCTGGAGGGGGATCAGAGAGG + Intergenic
1102929013 12:116848557-116848579 GTTGTTGGGGTGGATGGGAGAGG - Intronic
1103948654 12:124540489-124540511 GAGCTGGAGGGGGATGGGAGTGG + Intronic
1103948753 12:124540745-124540767 GAGATGGAGGGGGATGGGGGTGG + Intronic
1103948908 12:124541201-124541223 GTGATGGAGGGGGATGGAGGTGG + Intronic
1103949094 12:124541753-124541775 GAGATGGAGGGGGATGGGGGTGG + Intronic
1103949104 12:124541775-124541797 GATATGGAGGGGGATGGGGGTGG + Intronic
1104165998 12:126230179-126230201 GTCATGGAGGTGGCTGAGGCCGG + Intergenic
1104340125 12:127941254-127941276 GTCATGGGAGTGGCTGGCAGTGG - Intergenic
1105673980 13:22650450-22650472 GTCATGACGGTGGATGGAGGAGG - Intergenic
1106447481 13:29849863-29849885 GACATGGAGAGGGGTGGGAGGGG + Exonic
1106694869 13:32162587-32162609 GTCAGGAAGGAGGAAGGGAGTGG - Intronic
1107193947 13:37624316-37624338 GGGATGGAGGTGGGTGGGAGTGG + Intergenic
1108431733 13:50360286-50360308 GTGCTGGAGGTGTAGGGGAGAGG + Intronic
1108483255 13:50897300-50897322 GTGGTGGAGGTGGCAGGGAGTGG + Intergenic
1109245715 13:59952620-59952642 ATAATGAAGGTGGTTGGGAGTGG - Intronic
1109267690 13:60219933-60219955 GTGAAGGGGGTGGGTGGGAGGGG + Intergenic
1110082408 13:71331951-71331973 GTCATGGGGTTGGGTGGGGGGGG + Intergenic
1110884851 13:80619857-80619879 GTGGTGGAGGTGGGTGGAAGTGG - Intergenic
1111102362 13:83605091-83605113 GTCTTGGAGGTGGATCCTAGTGG + Intergenic
1111779426 13:92702829-92702851 GTCATGGAGGGAGGAGGGAGTGG - Intronic
1112569268 13:100579387-100579409 GTCTTGGGGGAGGATGAGAGGGG - Intronic
1113948436 13:114057976-114057998 GTCCCGGAGGTGGGTGGGGGTGG + Intronic
1113966381 13:114155753-114155775 GGCGTGGAGGTGGAGGGGTGGGG + Intergenic
1114575913 14:23713320-23713342 GTCTGGAAGGTGGAAGGGAGGGG + Intergenic
1114660507 14:24340551-24340573 GTCGTGCAGGTGGCTGGGAAAGG + Intergenic
1115886215 14:37974767-37974789 GTCTTGGAGGTTAGTGGGAGAGG + Intronic
1117138261 14:52760064-52760086 GTCATGGTGGTGCATGGCTGTGG + Intronic
1117540055 14:56738255-56738277 TTCATGGAGGTGAAAGGGGGTGG + Intergenic
1117623493 14:57611736-57611758 GTGAAGGAGGTGGAAGGAAGAGG + Intronic
1117992243 14:61445438-61445460 GCCATGGAGGTAGATGGAATGGG + Intronic
1118832930 14:69451957-69451979 GTCTGGGAGGTCGATGGGGGAGG - Intronic
1120752363 14:88209687-88209709 GGCATGGAGGTGGGTGGGGCTGG - Intronic
1121275842 14:92667013-92667035 GCCAGGGAAGTGGATGGCAGGGG - Intronic
1121416042 14:93779941-93779963 GGGATGGAGGTGGTTTGGAGGGG - Intronic
1122112131 14:99510306-99510328 GTCATGTAGCTGGAGGGGGGTGG - Exonic
1122119558 14:99544857-99544879 GGCATGGAGGTGGATCTCAGGGG - Intronic
1122545354 14:102518758-102518780 CTCCTGGAGGAGGATGGGACTGG + Intergenic
1122636510 14:103132152-103132174 GGGATGGGGGTGGATAGGAGGGG - Intronic
1122801262 14:104230742-104230764 GTCAGTGGGGTGGAGGGGAGAGG + Intergenic
1122906641 14:104804770-104804792 CTCATGCTGGTGGATGGGGGAGG + Intergenic
1123042503 14:105496125-105496147 GACTTGGGGGTGGGTGGGAGGGG + Intronic
1123430541 15:20211853-20211875 GTGATAGAGATGGAGGGGAGTGG - Intergenic
1124198111 15:27651021-27651043 GTTCTGGAGGTGGATGGCAGTGG + Intergenic
1124798759 15:32809090-32809112 GTCATGGGGGTGGATGTGAGGGG + Intronic
1124862625 15:33457918-33457940 GTCATGGAGCGGTTTGGGAGTGG + Intronic
1125381351 15:39090859-39090881 GTCATGGAGGTGGCTGGGCACGG + Intergenic
1125976134 15:43953382-43953404 GTGGTGGAGATGGGTGGGAGAGG + Intronic
1126572436 15:50166560-50166582 TTCCTGGAGGTGGATGGAAGTGG - Intronic
1126744700 15:51814195-51814217 GTCATTGCTGTGGGTGGGAGAGG + Exonic
1127783947 15:62339848-62339870 TGCATGGATGTGTATGGGAGAGG - Intergenic
1128464890 15:67902155-67902177 TTCCTGGAGGTTGATGGGTGGGG - Intergenic
1128702076 15:69812291-69812313 GTCATGCAGCTGGCAGGGAGAGG + Intergenic
1128705707 15:69836313-69836335 GTGAGGCAGGTGCATGGGAGGGG - Intergenic
1129054946 15:72812632-72812654 GGGATGAAGGTGGAAGGGAGAGG - Intergenic
1129236260 15:74225526-74225548 GAGATGGAGGTGGAGGGTAGGGG - Intergenic
1129243965 15:74268695-74268717 GTCTTGGAGGTGGCGGGGAGGGG + Intronic
1129595336 15:76959494-76959516 CTCATGGAGGTAGAGGGGGGAGG - Intergenic
1129998375 15:80026216-80026238 GTAAAGGAGATGGTTGGGAGGGG + Intergenic
1130397936 15:83520801-83520823 GTTGTGGGGGTGGGTGGGAGAGG - Intronic
1132243567 15:100278206-100278228 GTTCTGGAGGTGGATGGTGGTGG + Intronic
1132775179 16:1589591-1589613 GTGATGAAGGTGAGTGGGAGTGG - Exonic
1132806945 16:1779277-1779299 GACAGGGAGGAGGCTGGGAGGGG - Intronic
1133022929 16:2974727-2974749 CTCTTGGAGGTGGGTGGGAGAGG + Intronic
1134014969 16:10881759-10881781 GTTCTGGAGATGGATGGTAGCGG - Intronic
1135100084 16:19597498-19597520 GGCAGTGAGGTGGATGGGATGGG + Intronic
1135277911 16:21129157-21129179 GTCACGGAGGTGGGTAGGAGAGG - Intronic
1136058712 16:27709927-27709949 GTCATGCAGCTGGAAGGTAGTGG + Intronic
1136133785 16:28241736-28241758 GTCATTGCGGTGGGTGGGGGGGG - Intergenic
1136298373 16:29316754-29316776 GTCCTGCAGGTGGCTGTGAGGGG + Intergenic
1136407138 16:30054689-30054711 GACGAGGAGGTGGCTGGGAGAGG - Intronic
1136462250 16:30418610-30418632 GTGAGTGAGGTGGGTGGGAGAGG + Exonic
1136854092 16:33639357-33639379 GTGATAGAGATGGAGGGGAGTGG + Intergenic
1137368969 16:47887149-47887171 GTCAGGAAAGTGGGTGGGAGAGG - Intergenic
1138144152 16:54594231-54594253 GTCATGGATGTGGCTGGGCAGGG - Intergenic
1138168090 16:54821276-54821298 GTCTTGGAGGAGGGTGTGAGAGG + Intergenic
1138216185 16:55207272-55207294 ACCATGAAGGAGGATGGGAGAGG + Intergenic
1138339690 16:56280579-56280601 GGCAGGGAGGGGGATGGCAGGGG + Intronic
1138351030 16:56346283-56346305 GTCGTGGATGTGGATGTGGGAGG + Exonic
1138541186 16:57688822-57688844 GACAAGGAGGAGGAGGGGAGAGG - Exonic
1138803459 16:60063665-60063687 TTCATGGACCTGGATGGAAGTGG - Intergenic
1140342003 16:74173691-74173713 GTCATGAGGGTGGATGGGATTGG - Intergenic
1140995952 16:80259713-80259735 GTCAAGGAGGTCAAGGGGAGAGG - Intergenic
1141531757 16:84651209-84651231 CCCAAGGAGGTGGATGGGACAGG + Intronic
1142060033 16:88023259-88023281 GTCCTGCAGGTGGCTGTGAGGGG + Intronic
1203115669 16_KI270728v1_random:1487796-1487818 GTGATAGAGATGGAGGGGAGTGG + Intergenic
1143644755 17:8223098-8223120 GTCAAGGAAGTGGGAGGGAGTGG + Intergenic
1144028969 17:11302855-11302877 GTCATCCAGGTGGAGAGGAGGGG + Intronic
1144663729 17:17088158-17088180 GTGATGGAAGGTGATGGGAGCGG + Intronic
1145711671 17:26983816-26983838 GGCATGGAGGTGGAAGGCATTGG + Intergenic
1145737751 17:27244908-27244930 GTCCTAGAGGAGGAAGGGAGAGG + Intergenic
1146627742 17:34446927-34446949 GCCAGGGAGGGGAATGGGAGTGG - Intergenic
1146942942 17:36856512-36856534 ATCAGAGAGGTGGAGGGGAGTGG + Intergenic
1147375472 17:40020148-40020170 GGCATGGAGAGGGAAGGGAGGGG + Intronic
1147673178 17:42188677-42188699 ATCTTGGAGGCTGATGGGAGGGG - Intergenic
1148071996 17:44914005-44914027 GTCAGGGAGGTGGAGGGGAGGGG - Intronic
1148195773 17:45711509-45711531 GGCATGGAGGTGGTGGGGAGGGG - Intergenic
1148671739 17:49415633-49415655 GGCAGGGAGGAGGAGGGGAGAGG - Intronic
1148760157 17:49995513-49995535 GGCGTGGAGGTGGAGGGGAAGGG + Intergenic
1148866840 17:50633208-50633230 GGTATGGAGGGGGATTGGAGGGG + Intergenic
1148912764 17:50951926-50951948 GTGATGGTGGAGGAGGGGAGTGG - Intergenic
1149376322 17:56047665-56047687 GTCATGGTGGGGGCAGGGAGGGG - Intergenic
1149768521 17:59300864-59300886 GACAGGGAGGGGGAAGGGAGAGG - Intergenic
1150155774 17:62851822-62851844 GTAATGGTGGTGGCTGGGTGCGG + Intergenic
1150300829 17:64045612-64045634 GTCATGGATGAGGGAGGGAGGGG - Intronic
1150626685 17:66846110-66846132 GTCAGGGAGGTTGCTGGGGGAGG - Intronic
1150811453 17:68360332-68360354 GTCATGGAGGAGGAAGGGCATGG - Intronic
1151230940 17:72684640-72684662 ATCATGGGGGTGGATGATAGTGG - Intronic
1151454519 17:74218055-74218077 TGCATGGAGGTGGAGGGGAATGG - Intronic
1151475591 17:74342890-74342912 GCCAGGGAGGTGGTGGGGAGTGG - Intronic
1151877101 17:76873063-76873085 GCCCTGTAGGTGGATGTGAGTGG + Intronic
1152298932 17:79484442-79484464 GCCAGGGAGGTGGCTGGGAGAGG + Intronic
1152637256 17:81435197-81435219 GGCCTGGGGGTGGTTGGGAGGGG + Intronic
1153559021 18:6351424-6351446 GTTCTGGAGGTGGATGGTAGTGG + Intronic
1153842028 18:9015960-9015982 CTCTTGGAGGTGGGTGGGAAGGG - Intergenic
1155891905 18:31280518-31280540 GTAATGGAGGTGGGAGGAAGTGG - Intergenic
1156315077 18:35962222-35962244 GGCAAGGGGGTGGGTGGGAGGGG - Intergenic
1156449317 18:37258152-37258174 GGCATGGTGTTAGATGGGAGAGG - Intronic
1157094951 18:44679497-44679519 GGAAGGGAGGTGGATCGGAGCGG - Intergenic
1157160468 18:45309274-45309296 GTCCTGGAGTCCGATGGGAGGGG - Intronic
1157280102 18:46341312-46341334 GTCAGGGAGGGGGGTGGGACAGG + Intronic
1157464171 18:47930434-47930456 GGGATGGAGGGGGCTGGGAGGGG + Exonic
1157869854 18:51219944-51219966 GTGATGGTGGTGGGTGGGGGTGG + Intergenic
1158215574 18:55097380-55097402 TTCATGGAGCTGGTTGGGGGTGG - Intergenic
1158548821 18:58417702-58417724 GTCATGTAGGTGGATGGGAAAGG - Intergenic
1158891440 18:61875842-61875864 ACCATGGAGGTGGGTGGGGGAGG - Intronic
1159968764 18:74622677-74622699 GTGATGGGGCTGGATGGGAGAGG + Intronic
1160048229 18:75407349-75407371 TTCATGTTGGTGGATGGGGGTGG + Intronic
1160134403 18:76260300-76260322 GTCCTGGGGGTGGGGGGGAGGGG + Intergenic
1160257251 18:77258479-77258501 GTGATGGTGGTGGGTGGTAGTGG + Intronic
1160257357 18:77258975-77258997 GTGATGGTGGTGGATGGTGGTGG + Intronic
1160257381 18:77259090-77259112 GTGATGGTGGTGGATGGTGGTGG + Intronic
1160257408 18:77259223-77259245 GTGATGGTGGTGGATGGTGGTGG + Intronic
1160257433 18:77259341-77259363 GTGATGGTGGTGGATGGTGGTGG + Intronic
1160299275 18:77665544-77665566 GTCATGGAGGTGCCACGGAGGGG + Intergenic
1160427488 18:78788123-78788145 AGCCAGGAGGTGGATGGGAGTGG - Intergenic
1160482641 18:79256710-79256732 AGCATGTAAGTGGATGGGAGAGG - Intronic
1161157538 19:2740315-2740337 GGCTTGGAGGTGGATGGGAAGGG + Intergenic
1161202071 19:3020555-3020577 GTCATGAAGGTGGAGGAGGGAGG - Intronic
1161226078 19:3146632-3146654 GTCATGGAGCTGGAGAGGAGAGG - Intronic
1161957689 19:7505775-7505797 GCCACGGAGGAGGATCGGAGTGG - Intronic
1161984112 19:7644553-7644575 GTCAGGGAAGGGGATGGGAGAGG - Intronic
1162362169 19:10226977-10226999 GCGATGGGGGGGGATGGGAGGGG - Intronic
1162848414 19:13412092-13412114 GTCATGGAGGTGGGGAGGGGTGG - Intronic
1163243984 19:16081129-16081151 GCCATTCAGGTGAATGGGAGCGG + Intronic
1163600905 19:18248418-18248440 GGCATGGAGGGGGAGGGGCGGGG + Intronic
1163665561 19:18602316-18602338 GTCATGGGGTTGGCTGGGTGCGG + Intronic
1163714541 19:18866204-18866226 CTCAAGGAGAAGGATGGGAGGGG + Intronic
1164249997 19:23467965-23467987 GTGGAGGAGGAGGATGGGAGAGG - Intergenic
1164785096 19:30924255-30924277 CCCATGGAGGGGGAAGGGAGGGG + Intergenic
1164832295 19:31331932-31331954 GGCAAGGAGGAGGAAGGGAGAGG + Intronic
1165477854 19:36042062-36042084 GTGATGGAGGAGGAGGGGAAGGG + Intronic
1165958918 19:39518699-39518721 GTCATGGGGTTGCAGGGGAGGGG - Intronic
1166050108 19:40254065-40254087 GGCAGGGAGGTGGATGGAAAGGG + Intronic
1166147917 19:40849981-40850003 CTGATGGAGGTGGGTGGGAGTGG + Intronic
1166303643 19:41925862-41925884 GTCACGGAGGAGGATGGGTGAGG + Intronic
1166689184 19:44812578-44812600 GTCCTGGAGGAGGAGGGGACAGG + Intronic
1166867724 19:45850872-45850894 GACATGGGGCTGCATGGGAGCGG + Intronic
1167568342 19:50271336-50271358 GTGATGGGGAAGGATGGGAGCGG - Intronic
925003476 2:424647-424669 GTGGTGGAGGTGGGTGGGGGTGG - Intergenic
925017495 2:542600-542622 GTCATGGATGGGGCTGGGAATGG + Intergenic
925191624 2:1889449-1889471 GACATGGAGGTGGATGAGAACGG - Exonic
925613213 2:5720760-5720782 GAGATGGAGGTGGCTGGGTGAGG + Intergenic
926195732 2:10762704-10762726 GCCATGGAGGTGGGAGGGATGGG - Intronic
926472701 2:13280785-13280807 TTCATGGTGGTGGAAGGCAGGGG - Intergenic
926800667 2:16657324-16657346 GCCTTGGAGGGGGATGGCAGAGG - Intronic
926985253 2:18615785-18615807 GTAATGCAAGTGGATGGTAGAGG - Intergenic
927441282 2:23119733-23119755 GCAATGGAGGTGGAGGGGATGGG - Intergenic
928088511 2:28360217-28360239 CTCATGGGAGTGGATGGGAGTGG + Intergenic
928262753 2:29782464-29782486 GTGATGGTGGTGAATGGGTGCGG - Intronic
928922635 2:36541474-36541496 GTCATGGAGCTGGTTAGCAGAGG + Intronic
929575777 2:43050761-43050783 CTCGTGGAGGTGGATGTGAGGGG - Intergenic
930001175 2:46862472-46862494 GGCTTGGAGGTGGGGGGGAGAGG + Intergenic
931135824 2:59399471-59399493 GACATGGGGTTGGATGGGAGGGG - Intergenic
932103621 2:68923561-68923583 GTCATGGATGTGGGTGGGAGTGG - Intergenic
932177862 2:69619196-69619218 GTCATCGAGGGGAATGAGAGAGG - Intronic
932336192 2:70932724-70932746 GTCAAGGAGGGAGATGGGACAGG - Intronic
932776002 2:74528868-74528890 TTCATGGAGATGAATGGGCGGGG - Exonic
932777365 2:74536261-74536283 GGCATGGAGGTGGGAGGGAGAGG - Intronic
933161380 2:79027817-79027839 CTGATGGAGATGGATGGGAGTGG + Exonic
934559637 2:95306515-95306537 GAGATGGAGGTGCATGGGGGAGG + Intronic
934856942 2:97735404-97735426 GTCATGGAGATGGCTGGGGGCGG + Exonic
934896832 2:98126881-98126903 GCCAAGGAGGTGGAAGGGATAGG - Intronic
935644114 2:105318886-105318908 GCCCTGGAAGTGGAAGGGAGAGG - Intronic
935871208 2:107451969-107451991 GGGATAGAGGTGGAGGGGAGCGG + Intergenic
935946259 2:108289342-108289364 GCCCTGGAGGAGGATGGGACAGG - Intronic
936491470 2:112976404-112976426 AGCATGAAGGTGGAGGGGAGGGG - Intronic
936678532 2:114743858-114743880 GTCTTGGTGGTGGATGTGATCGG + Intronic
937276960 2:120691062-120691084 CTCCTGGAGGTGGGTGGGAGTGG - Intergenic
937339329 2:121081148-121081170 GTCTTGGTGGTGGGTGGGTGGGG + Intergenic
937435215 2:121874441-121874463 GACATGGAGGTGTATGGAACAGG + Intergenic
939231276 2:139429284-139429306 CTGATGGAGGTGGGTGGGGGAGG - Intergenic
939251847 2:139691009-139691031 TTCATGGAGTGGGAGGGGAGGGG + Intergenic
939356905 2:141114408-141114430 GTGATGGAGGTGGCTGTCAGTGG + Intronic
939628652 2:144509359-144509381 GTCATGGGGGTGGATAGGAGGGG + Intronic
940639668 2:156333164-156333186 GTGACGAAGGTGGGTGGGAGAGG - Intronic
941045228 2:160667546-160667568 GTCATGTAGGTTGAAGGTAGAGG + Intergenic
941161599 2:162041939-162041961 ATAATGGAGGTGGGTGGGAGAGG + Intronic
941172438 2:162155854-162155876 TTCTTGGAAGAGGATGGGAGAGG + Intergenic
942307317 2:174621493-174621515 GCGATGGGGGTGGAGGGGAGGGG - Intronic
942776369 2:179587101-179587123 GTCAACCAGGTGGAAGGGAGTGG - Intronic
944152122 2:196570974-196570996 GTCATTGAGATAGATGTGAGTGG - Intronic
944404005 2:199361509-199361531 GGAAGGGAGGTGGGTGGGAGGGG - Intronic
945234035 2:207617890-207617912 GTCAAGGAGTTGGGTGGGGGCGG + Intronic
945411135 2:209508949-209508971 GTTTTGTAGGTGGATGGGATAGG - Intronic
945583757 2:211630255-211630277 TTCAAGGGGGTAGATGGGAGTGG - Intronic
946181829 2:217953617-217953639 CTCAGTGAGGTGGGTGGGAGTGG - Intronic
946402859 2:219477653-219477675 GTCATGGTGTTAGGTGGGAGGGG - Intronic
946431435 2:219628915-219628937 GTCATGAAGGGGGCTGGGAGGGG - Intronic
946750701 2:222893306-222893328 ATGATGGTGGTGGATGTGAGGGG + Intronic
947447982 2:230179317-230179339 GGCATGGGGGTGGAGGGTAGTGG + Intronic
948264767 2:236628491-236628513 TTCAGGGAGGCGGATGGGACAGG - Intergenic
949014060 2:241699667-241699689 GTCAAGGATGTGGCTGGGGGTGG + Intergenic
949056815 2:241932376-241932398 GTCAGGGGGCTGGAGGGGAGGGG - Intergenic
1168821264 20:775145-775167 GGGATGGACGTGGAGGGGAGGGG - Intergenic
1169664082 20:8015150-8015172 GTGGAGGAGGTGGATGGAAGTGG + Intronic
1169806732 20:9567368-9567390 GTCCTTGGGGTGGATGGTAGGGG - Intronic
1170323378 20:15127684-15127706 TAAAGGGAGGTGGATGGGAGAGG + Intronic
1171255931 20:23689081-23689103 GGCATGGAGGTGGGTGGGGCTGG - Intergenic
1171263279 20:23750978-23751000 GGCATGGAGGTGGGTGGGGCTGG - Intronic
1172234591 20:33362064-33362086 GTGGTGGAGGTGGGTGGAAGAGG + Intronic
1172619021 20:36307387-36307409 GGGATGGAGGGGGATCGGAGCGG - Intronic
1172636857 20:36415847-36415869 GGCCTGGAGATGGAGGGGAGGGG + Intronic
1172802440 20:37585713-37585735 ATCATGGAGGTGGATGCCTGTGG - Intergenic
1172952134 20:38728942-38728964 GTCATCGAGGGGGTTGGGAAGGG + Exonic
1172977822 20:38919847-38919869 CTGATGGAGGTGGAAGGGGGTGG - Exonic
1173558478 20:43984901-43984923 GGCTGGGAGGTGGCTGGGAGGGG - Intronic
1173671677 20:44803497-44803519 GGCAGGGATGTGGATGGGGGTGG - Intronic
1173746899 20:45444504-45444526 GTGATGGGGGTTGAAGGGAGAGG + Intergenic
1173777286 20:45720689-45720711 ATCATGGGGGTGGTAGGGAGAGG + Intergenic
1174149641 20:48477030-48477052 GTCATGGAGCTGGAGAGGGGAGG - Intergenic
1174192942 20:48753180-48753202 GCCATGGATGTGGCAGGGAGAGG + Intronic
1175093076 20:56520564-56520586 GTCCTGGAGGTGGACGGAGGAGG - Intronic
1175283852 20:57823790-57823812 GACATGGAGGTGGAAGACAGTGG - Intergenic
1175516546 20:59574067-59574089 GGCACGGAGGAGGATGGAAGTGG - Intergenic
1176120629 20:63453056-63453078 GTCTTGGGGGTGGCGGGGAGGGG - Intronic
1176236790 20:64057151-64057173 GACGTGCAGGTGGAGGGGAGAGG - Intronic
1176242894 20:64083289-64083311 GTCTGTGAGGTGCATGGGAGAGG + Intronic
1176968029 21:15233599-15233621 ATCATGGGGGTGGAGGGGAGGGG + Intergenic
1178145379 21:29734176-29734198 GTGATGGAGGTGCTTGGAAGTGG - Intronic
1178240516 21:30894280-30894302 TTCACGCAGGTGGAGGGGAGTGG + Intergenic
1179655143 21:42839974-42839996 CCCAGGGGGGTGGATGGGAGGGG + Intergenic
1179714488 21:43280309-43280331 GAGGTGGAGGTGGAGGGGAGGGG + Intergenic
1179920657 21:44505488-44505510 GTTCTGGAGGTGGATGGTGGGGG - Intronic
1180161716 21:46001177-46001199 GCCAGGGCGGTGGAGGGGAGGGG + Intronic
1180199354 21:46215400-46215422 GGCCTGGGGGTGGGTGGGAGGGG - Intronic
1180960236 22:19759219-19759241 GTCATGGAGGTCCCTGGGAATGG + Intronic
1181722633 22:24787560-24787582 GGGATGGAAGGGGATGGGAGGGG - Intergenic
1182551304 22:31102246-31102268 GTCCTGGGGGTGGGAGGGAGAGG + Intronic
1182738367 22:32547383-32547405 GAGAAGGAGGTGGAAGGGAGAGG - Intronic
1184345586 22:43910649-43910671 GACACGAAGGTGGGTGGGAGTGG - Intergenic
1184347680 22:43923663-43923685 GGCTTGGAGGGGGATGGGGGTGG - Intergenic
1184744748 22:46449746-46449768 GGCATGGAGGTGGAGGGGAGGGG + Intronic
1185175113 22:49321938-49321960 GTCAGGGAGATGGATGGAGGCGG + Intergenic
950478970 3:13233036-13233058 GTCCTGGAGATGGGTGGCAGTGG + Intergenic
950481525 3:13247256-13247278 GTCCTGGGGGTGTCTGGGAGGGG - Intergenic
951312922 3:21151590-21151612 GACATGGAGGTGGGAGGAAGTGG - Intergenic
951604904 3:24422390-24422412 GTTTTGGAGGTGGAGGTGAGTGG + Intronic
952794421 3:37226130-37226152 GTCCTGGGGGGTGATGGGAGGGG + Intergenic
952886995 3:38018080-38018102 GTCATGGGGGTGGGTAGTAGTGG + Intronic
952983744 3:38759228-38759250 GCCATGGAGGTGGGTGAGATGGG + Intronic
954291973 3:49654577-49654599 GTCAGTGAGGATGATGGGAGTGG - Exonic
954366419 3:50148684-50148706 GCCATGGAGGTGTCTGGGATGGG + Intergenic
954788036 3:53109273-53109295 GTCATAGAGGTGACTGAGAGGGG - Intronic
955131328 3:56171932-56171954 GGTGTGGAGGTGGATGGAAGGGG + Intronic
955296185 3:57737474-57737496 GTCATGGAAGTGGGATGGAGAGG - Intergenic
955485463 3:59430308-59430330 GTCTTGGGGGTGGAAGGGGGTGG + Intergenic
956433841 3:69214042-69214064 GTATTGGAGGTGGGTGGCAGAGG + Intronic
958907360 3:99956635-99956657 TACATGGAGGTGGCTGGGCGCGG - Intronic
959263493 3:104110191-104110213 ATCATAGAGGTGCATGAGAGAGG - Intergenic
960004968 3:112772498-112772520 AGGATGGAGGTGGATGGTAGGGG - Intronic
960823141 3:121755671-121755693 GTCATGGATGGGGTTGGGAAGGG + Intergenic
961577783 3:127852167-127852189 CTCACGGAGCTGGATGGGAGCGG + Intergenic
962828189 3:139118136-139118158 GTCTTGGGGGTGGATGGGGTGGG + Intronic
963004114 3:140710166-140710188 GTCATGAAGGAGGATTTGAGAGG - Intergenic
963225535 3:142858091-142858113 GTCTAGGAATTGGATGGGAGAGG - Intronic
966441608 3:179951109-179951131 TTCATTGAGGTGGGAGGGAGAGG - Intronic
966917883 3:184594744-184594766 GAGCTGGAGGGGGATGGGAGGGG + Intronic
967207581 3:187138223-187138245 GTTGTGGAGGTGGCGGGGAGGGG + Intronic
968704664 4:2072341-2072363 GTCTGGGAGGTGGCTGGGGGTGG - Intronic
968731241 4:2270368-2270390 GTGATGGAGGTGGACAAGAGTGG - Exonic
968816515 4:2824408-2824430 GGCATGGAGGGGCATGGAAGAGG - Intronic
969352225 4:6604430-6604452 GCCTTGGTGGTGGGTGGGAGTGG + Intronic
969388002 4:6869185-6869207 TTCATGGTGGGGGATGGGACAGG - Intronic
969391751 4:6896030-6896052 GAGATGGAGGTAGATGTGAGGGG - Intergenic
970326045 4:14926338-14926360 GAGAGGAAGGTGGATGGGAGAGG + Intergenic
970520600 4:16880108-16880130 GTCATGGAGGAGGCTGGGATCGG - Intronic
971434644 4:26607290-26607312 GTCAGGGAGGTGGGTGAGGGGGG - Intronic
972971264 4:44579121-44579143 GAGATGGAGGTGGTTGGGACTGG - Intergenic
973672857 4:53237860-53237882 GTCAGGGAGGGAGATGGGTGGGG - Intronic
973749516 4:53999603-53999625 GTGGGGGAGGAGGATGGGAGAGG - Intronic
974568663 4:63613322-63613344 TTCAGGGACGTGGATGGGACTGG + Intergenic
976443588 4:85104810-85104832 GTTTGGGATGTGGATGGGAGAGG + Intergenic
976515779 4:85964579-85964601 GGCAAGGAGGTGGAAGGGAAAGG + Intronic
977526414 4:98151614-98151636 GTGGTGGATGTGGAGGGGAGGGG + Intergenic
977660898 4:99584831-99584853 GGCATGGAGGTGAAGGGGAGAGG - Intronic
978936730 4:114386934-114386956 TCTATGGAGGTGGAAGGGAGTGG + Intergenic
979368834 4:119858598-119858620 GTCATGGGGGTGCATGGGGGTGG + Intergenic
979834367 4:125344812-125344834 GTCATGGTGGTGGGGGGCAGGGG - Intronic
980792272 4:137634696-137634718 GTCATGCAGGAGGTGGGGAGAGG - Intergenic
980821809 4:138026359-138026381 GTCATTGTGGTGGATGGTAGTGG + Intergenic
981562000 4:146058200-146058222 GTCATTTAGGAGGGTGGGAGAGG - Intergenic
981723479 4:147824594-147824616 GTCATGGTGGTGGAAGGCAAAGG + Intronic
983186831 4:164709967-164709989 GTCCTAGAGGTGGGTGGCAGAGG + Intergenic
983331570 4:166335284-166335306 GTCAAGGAGGAGGATGTCAGGGG + Intergenic
984095642 4:175429214-175429236 GTTAGGGAGGTGGAAGGTAGAGG - Intergenic
984943327 4:184952677-184952699 GTCACAGAGGAGGAGGGGAGGGG + Intergenic
985680290 5:1252639-1252661 TTCATGGAGGTGGGGGGCAGGGG - Intergenic
987414853 5:17652034-17652056 GGAAGGGAGGAGGATGGGAGGGG - Intergenic
987837701 5:23182694-23182716 GTCATCCAGGTGGAGGGCAGTGG + Intergenic
987985229 5:25137316-25137338 GTGAGGGAGGTTGTTGGGAGAGG - Intergenic
988792271 5:34619803-34619825 GTGGTGGAGGGTGATGGGAGAGG + Intergenic
989680506 5:44023134-44023156 GCCATAGGGGTGGATAGGAGTGG + Intergenic
991047782 5:62240820-62240842 GTGATAGAGATGGAGGGGAGTGG - Intergenic
991505224 5:67317672-67317694 GTCATGGGGTTGGTGGGGAGGGG + Intergenic
995533045 5:113109893-113109915 TTCATGGAGTTGCATGGCAGTGG - Intronic
995712418 5:115049156-115049178 GCCATGGTGGTGTATGGCAGTGG - Intergenic
996191391 5:120547076-120547098 GTCATGGTGCTGGAGGGAAGTGG + Intronic
996731593 5:126722594-126722616 GTAATGGAGGTGGCTGGGCGTGG + Intergenic
996846612 5:127906115-127906137 GTTGTGGAGGTGGATGGTGGCGG - Intergenic
997213212 5:132089970-132089992 GTCCTGGAGTTGGATGGTACAGG + Intergenic
997215372 5:132105463-132105485 CTAATGGGGGTGGATGGAAGTGG - Intergenic
997741707 5:136260593-136260615 GTCATAGAGATGGAGTGGAGAGG + Intronic
997837561 5:137208020-137208042 GTGAGGGAGATGAATGGGAGAGG - Intronic
998355384 5:141531150-141531172 TTCGGGGAGGTGGATGTGAGAGG - Intronic
998394738 5:141811512-141811534 GAGATGGGGATGGATGGGAGTGG - Intergenic
998443877 5:142183880-142183902 GTGATGGTGGTGGGGGGGAGTGG + Intergenic
999080420 5:148838345-148838367 GTCTTGGAGGTGGAGTGGTGGGG + Intergenic
1001339993 5:170834330-170834352 GCCATGGAGCAGGTTGGGAGAGG - Intergenic
1001422281 5:171596890-171596912 GTTAGGGAGGTGGGTGAGAGGGG + Intergenic
1001445785 5:171781744-171781766 GTCATGGAGTTGGAAGTGAGAGG + Intergenic
1001821852 5:174716557-174716579 GTAGTGGGGGTGGGTGGGAGTGG + Intergenic
1002292488 5:178209433-178209455 GTGGTGGAGGTGGAGGTGAGTGG + Exonic
1002371145 5:178755872-178755894 GCCATGGAGCAGGTTGGGAGAGG + Intergenic
1002605503 5:180380633-180380655 GGGAGGGAGATGGATGGGAGTGG + Intergenic
1002910586 6:1488245-1488267 GTTCTGGAGGTGGATGGTGGTGG + Intergenic
1002988727 6:2217767-2217789 GGCTTGGAGGGGAATGGGAGGGG - Intronic
1003188811 6:3855204-3855226 GTCTTGGAGGTTGGTGGGTGGGG - Intergenic
1003495290 6:6658366-6658388 ATGATGTAGGAGGATGGGAGAGG - Intergenic
1003911207 6:10745385-10745407 GTCAGGGAGGAGGATGTGTGGGG + Intergenic
1004175178 6:13333582-13333604 ATCATGGAGGTGGAGGCAAGAGG + Intergenic
1006136470 6:31899246-31899268 GTCATGGGGGTGGGGGGGATAGG - Intronic
1006137751 6:31906264-31906286 GTTTTGCAGATGGATGGGAGTGG - Intronic
1006247610 6:32753290-32753312 GTCATGGAGGGGGTGGGGTGTGG + Intergenic
1006440320 6:34049807-34049829 GTCATGGAGGTGGTGCGAAGGGG - Intronic
1006442206 6:34059691-34059713 GTGATGGAGGGAGATGGGTGTGG + Intronic
1006610866 6:35293619-35293641 GTCATAGTGGTGGAAGGGATGGG - Intronic
1006785696 6:36665512-36665534 GTGATGTAGGTGGATGGGCGGGG + Intergenic
1007186965 6:39980069-39980091 CTGAGGGAGGAGGATGGGAGGGG - Intergenic
1007450079 6:41935874-41935896 GGCAGGGAGGTGGGTGGCAGCGG + Exonic
1007692495 6:43711683-43711705 GCGGTGGAGGTGGCTGGGAGTGG + Intergenic
1007754046 6:44087409-44087431 CTCATGGTGGGGGATGGGAGTGG - Intergenic
1008584172 6:52933954-52933976 GTTCTGGAGATGGATGGGAATGG + Intergenic
1008938520 6:57019613-57019635 CTCTTGGGGGAGGATGGGAGTGG - Intronic
1010890824 6:81308460-81308482 GACATTGAGGTGGTTGGGGGGGG - Intergenic
1012413091 6:98982317-98982339 GTCAGGGATGGGGGTGGGAGAGG - Intergenic
1015500330 6:133925644-133925666 GTGATGCAGGGGGATGGGATAGG - Intergenic
1015526060 6:134175922-134175944 GTCAGGAATGTGGAGGGGAGGGG + Intronic
1015899017 6:138045966-138045988 GTGGTGGAGGTGGAGAGGAGTGG - Intergenic
1016363725 6:143293915-143293937 GAGGTGGAGGTGGAGGGGAGTGG - Intronic
1016819521 6:148334479-148334501 GTAATGGAGGTGAAGGGAAGTGG + Intronic
1017124258 6:151051019-151051041 TTCCTGGAGGTTGATGGGTGGGG + Intronic
1017152169 6:151290563-151290585 ATCAGTGAGGGGGATGGGAGAGG - Intronic
1017173660 6:151481392-151481414 GTCATGGAGAAGGATGTTAGTGG + Intergenic
1017651101 6:156583318-156583340 GGCCTGGATGTGGGTGGGAGGGG - Intergenic
1017931795 6:158961833-158961855 GTTGTGGAGGTGGAGGGGATGGG + Intergenic
1018091618 6:160350464-160350486 GGCATGGACTTGGATGAGAGAGG + Intronic
1018394334 6:163365970-163365992 GCCATGGAGATTGGTGGGAGGGG - Intergenic
1019571920 7:1716841-1716863 GCCATGGAGGGGGAGGGGAGAGG + Intronic
1019800417 7:3084352-3084374 AACATGGAGGTGAATGGGTGTGG + Intergenic
1023734236 7:43220780-43220802 GCCATGGGGGTGGAAGGGATTGG - Intronic
1023861397 7:44219560-44219582 AGCCTGGGGGTGGATGGGAGAGG - Intronic
1023967238 7:44969382-44969404 GCCAGGGATGTGGGTGGGAGGGG + Intronic
1024053468 7:45644911-45644933 GTGGTGGAGGTGGGTGGGAAAGG + Intronic
1024477909 7:49833477-49833499 TTCAGGGAGGTGGATTTGAGAGG - Intronic
1024546688 7:50528424-50528446 CTCATGAAGGTGCAGGGGAGAGG - Intronic
1025003663 7:55339138-55339160 GTGATGCAGGTGGAGGGGTGTGG - Intergenic
1025850262 7:65238860-65238882 GTGAGCGAGGTGGATTGGAGTGG - Intergenic
1026858183 7:73768741-73768763 GCCATGGCTGGGGATGGGAGGGG - Intergenic
1027550147 7:79582515-79582537 GTCATGGAGGTCTGTGAGAGTGG - Intergenic
1027651650 7:80875606-80875628 GTGATGGAGTTGGATGGAGGGGG - Intronic
1028875877 7:95822944-95822966 GTCATGGTGGGGGAGGGCAGGGG + Intronic
1029039282 7:97556020-97556042 GTCATGCAGGAGGTGGGGAGGGG + Intergenic
1031016865 7:116585014-116585036 GTCATGGAGTTGGATGAGAAAGG + Intergenic
1032886096 7:136140300-136140322 GTCATAGAGATGGATGGAAACGG - Intergenic
1033483263 7:141762455-141762477 GCAAAGGAGGTAGATGGGAGGGG + Intronic
1034028281 7:147732182-147732204 GTCATGGGGGTGGTGGGGGGGGG - Intronic
1035329049 7:158084697-158084719 GTCGTGGGTGTGGATGGGCGTGG - Intronic
1035329143 7:158085097-158085119 GTCATGGGTGTGGATGGGTGTGG - Intronic
1035987500 8:4450833-4450855 GTAAGGGTGGTGGATGTGAGAGG + Intronic
1037712387 8:21365301-21365323 AGGGTGGAGGTGGATGGGAGGGG - Intergenic
1038395505 8:27242924-27242946 GTTAAGGAGCTGGATAGGAGGGG + Intronic
1038863600 8:31414503-31414525 TCCATGGATGTGGGTGGGAGGGG + Intergenic
1039103968 8:33970585-33970607 GTGATGGAGGTGGCTGTCAGTGG + Intergenic
1039794202 8:40898096-40898118 GGGAAGGAGGTGGAGGGGAGAGG + Intergenic
1040795485 8:51286231-51286253 GGAATGGGGGTGGAGGGGAGAGG + Intergenic
1042146445 8:65735133-65735155 GTCAAGTAGGTTGATGGCAGGGG - Intronic
1042148583 8:65757905-65757927 GTCTTGGAGTTGGCTGGGTGTGG - Intronic
1042223301 8:66494449-66494471 GTCATGGAGGTGGATGGGAGGGG - Intronic
1043407280 8:79950948-79950970 GAAATGGAGGTGGGGGGGAGTGG - Intronic
1044877506 8:96684537-96684559 ATCATGGTGGTGGGTGGGATCGG + Intronic
1047274448 8:123395310-123395332 GGTGGGGAGGTGGATGGGAGGGG + Intronic
1047732950 8:127741462-127741484 GGGATGGTGGTGGTTGGGAGGGG - Intergenic
1050082434 9:1929025-1929047 GTAATGGAGGGCGGTGGGAGAGG + Intergenic
1050986597 9:12091137-12091159 CTGATGAAGGTGGCTGGGAGGGG + Intergenic
1051359517 9:16269574-16269596 GTCATGGAGGTGAGAGGGAGGGG - Intronic
1051500578 9:17772425-17772447 GTTATGGAGATGGATGGTGGTGG - Intronic
1053425833 9:38009287-38009309 CACATGGAGGTGGCTGGGGGTGG + Intronic
1053431306 9:38043532-38043554 AACATGGAGCTGGAGGGGAGAGG + Intronic
1053509744 9:38677770-38677792 GTCATGGAGGGCGAGTGGAGGGG + Intergenic
1055374507 9:75634430-75634452 GTCATGGAGCAGGTTGAGAGTGG + Intergenic
1056064564 9:82920660-82920682 GTGTTGGAGGTGGAAGGAAGGGG - Intergenic
1056434562 9:86562937-86562959 GTCATGGAGCAGGAAGGGATTGG + Intergenic
1058022898 9:100108815-100108837 GTCCTGGAGGAGGACTGGAGAGG + Intronic
1058249285 9:102670883-102670905 GTCATCAAGGCGGATGGGCGCGG - Intergenic
1058328552 9:103728570-103728592 GTGGTGGGGGTGGAAGGGAGAGG - Intergenic
1059259523 9:112962393-112962415 TTCATGGAGGGGGAAGGGAAAGG - Intergenic
1059303073 9:113331149-113331171 GGCATGGGAGTGGATGGGGGTGG + Intronic
1059335700 9:113567232-113567254 GACATGGAGGGGGAGGGGAGGGG - Intronic
1060568499 9:124615903-124615925 GTCATGGAGGTTGCAGTGAGCGG - Intronic
1060981370 9:127794320-127794342 GACAGGCAGGTGGGTGGGAGGGG - Intergenic
1061050202 9:128190918-128190940 GGAGTGGCGGTGGATGGGAGGGG - Intronic
1061193421 9:129095020-129095042 GTCATGGAGTTGGCAGGGAGTGG + Exonic
1061424534 9:130490831-130490853 GTTATGGAGGTGGGTGGGAAGGG - Intronic
1061657529 9:132104381-132104403 GGGATGGAGCTGGGTGGGAGAGG + Intergenic
1061776470 9:132968900-132968922 GTCCTGGAGATGGATGGTTGTGG - Intronic
1061865688 9:133490836-133490858 GTGCTGGAGGAGGAGGGGAGGGG + Intergenic
1062065327 9:134523664-134523686 GTGATGGGAGGGGATGGGAGGGG - Intergenic
1062065379 9:134523864-134523886 GTGATGGGAGGGGATGGGAGGGG - Intergenic
1062542471 9:137047735-137047757 GTCAGGGAGGTGGCGGAGAGTGG - Intergenic
1185763942 X:2709100-2709122 GTGATGGAGGAGGATGGGAGGGG + Intronic
1189235095 X:39480858-39480880 GGCTGGGAGGTGGAGGGGAGTGG + Intergenic
1190639869 X:52474012-52474034 GGCAGGGAGGTGGATGGTGGTGG - Intergenic
1190647803 X:52538853-52538875 GGCAGGGAGGTGGATGGTGGTGG + Intergenic
1190743580 X:53306723-53306745 AACAGGGAGGAGGATGGGAGAGG + Intronic
1191975689 X:66868721-66868743 GGCAGGGAGGGGGAGGGGAGGGG - Intergenic
1192246803 X:69379551-69379573 GTCAGGCAGGTGGGTGGAAGTGG - Intergenic
1194333511 X:92615336-92615358 TGCATGGAGGTGGAACGGAGAGG + Intronic
1195037371 X:100982198-100982220 GGCCTGGAGGTGGCTGGGTGTGG + Intronic
1195346132 X:103952967-103952989 GTCATGGAGTGGAATGGAAGGGG + Intronic
1196101061 X:111847636-111847658 GGTATAGACGTGGATGGGAGTGG - Intronic
1196810404 X:119624596-119624618 CTGATGCAGGGGGATGGGAGAGG + Intronic
1197391451 X:125871701-125871723 GTAATGGGGGTGGGGGGGAGAGG - Intergenic
1198686256 X:139230826-139230848 GCCTTGGATGTGGATGGGAGAGG + Intergenic
1198934836 X:141895089-141895111 GTCAGGGAGGAGGGTGGGAGGGG + Intronic
1199450648 X:147975071-147975093 GTCAGGAAGGTTGAGGGGAGAGG + Intergenic
1200642195 Y:5734341-5734363 TGCATGGAGGTGGAACGGAGAGG + Intronic
1200915267 Y:8565827-8565849 TTCATGGAGCTAAATGGGAGTGG + Intergenic
1201634310 Y:16105116-16105138 GTGATGGAGGTGGCTGTCAGTGG - Intergenic
1202176004 Y:22099473-22099495 GTCACGGAGATGAATGGAAGGGG - Intergenic
1202215357 Y:22486911-22486933 GTCACGGAGATGAATGGAAGGGG + Intergenic