ID: 1042223302

View in Genome Browser
Species Human (GRCh38)
Location 8:66494450-66494472
Sequence AGTCATGGAGGTGGATGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 516
Summary {0: 1, 1: 0, 2: 4, 3: 61, 4: 450}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042223302_1042223315 25 Left 1042223302 8:66494450-66494472 CCCTCCCATCCACCTCCATGACT 0: 1
1: 0
2: 4
3: 61
4: 450
Right 1042223315 8:66494498-66494520 CAGCCTTGAATGAAGTAGGCTGG No data
1042223302_1042223314 21 Left 1042223302 8:66494450-66494472 CCCTCCCATCCACCTCCATGACT 0: 1
1: 0
2: 4
3: 61
4: 450
Right 1042223314 8:66494494-66494516 TTGTCAGCCTTGAATGAAGTAGG No data
1042223302_1042223310 -7 Left 1042223302 8:66494450-66494472 CCCTCCCATCCACCTCCATGACT 0: 1
1: 0
2: 4
3: 61
4: 450
Right 1042223310 8:66494466-66494488 CATGACTCAGGCTTAGCCCCTGG No data
1042223302_1042223316 26 Left 1042223302 8:66494450-66494472 CCCTCCCATCCACCTCCATGACT 0: 1
1: 0
2: 4
3: 61
4: 450
Right 1042223316 8:66494499-66494521 AGCCTTGAATGAAGTAGGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042223302 Original CRISPR AGTCATGGAGGTGGATGGGA GGG (reversed) Intronic
900091288 1:921875-921897 AGACAAGGAGGTGGTGGGGAAGG + Intergenic
900481018 1:2899368-2899390 AGACAGGGAGGTGGAGGGCAGGG - Intergenic
900580404 1:3405859-3405881 AGCCGTGGAGGAGGACGGGATGG - Intronic
901970087 1:12901394-12901416 AGTCATTTAGATGAATGGGAAGG - Intronic
902015084 1:13300387-13300409 AGTCATTTAGATGAATGGGAAGG + Intergenic
902093553 1:13923730-13923752 AGTGGTGGAGGTGGAAGGGGAGG + Intergenic
902199434 1:14822752-14822774 AGCGATGGAGGTGAGTGGGAAGG - Intronic
902449184 1:16485766-16485788 AGCCAGGGAGGTGGATGTTAGGG - Intergenic
902468576 1:16632472-16632494 AGCCAGGGAGGTGGATGTTAGGG - Intergenic
902505564 1:16937518-16937540 AGCCAGGGAGGTGGATGTTAGGG + Intronic
902675167 1:18003583-18003605 TGTTATGGAGGTGGAGGGGTGGG + Intergenic
902822796 1:18953828-18953850 AGTCTTGGAGGGAGATGGGTTGG - Intronic
903154549 1:21435175-21435197 AGCCAGGGAGGTGGATGTTAGGG + Intergenic
903278899 1:22238963-22238985 AATCAAGGAGGTGGCTGGGCAGG + Intergenic
903489594 1:23718221-23718243 AGTCCTGGAGATGGATAAGATGG + Intergenic
904813695 1:33180728-33180750 AGTCGGGGATGCGGATGGGATGG - Intronic
905197088 1:36288304-36288326 ACTCAAGGAGAAGGATGGGAGGG - Intronic
905978847 1:42204282-42204304 AATCAAGGAGGTGGGTGGGGAGG + Intronic
906055920 1:42916983-42917005 AGGCATGCAGGTGCATGGCACGG - Intergenic
906102348 1:43271652-43271674 AATCGTGGAGGAGGATGGCATGG + Intronic
906844873 1:49181072-49181094 AGTCATGGTGGAGGCAGGGAGGG + Intronic
908155653 1:61350045-61350067 AGGCATGGAGGTGAAAGGGTGGG - Intronic
910205429 1:84744480-84744502 AGTCAAGTAGGAGGGTGGGATGG - Intergenic
910310226 1:85815053-85815075 AATCATGGAGGTGGGGTGGATGG - Intronic
913272535 1:117108410-117108432 GGTGATGGAGGCGGATGGGTGGG + Intergenic
913941460 1:125112037-125112059 AGTTATGGAGATGGATGGTAGGG - Intergenic
913955956 1:143293568-143293590 AATTATGGAGATGGATGGTAGGG - Intergenic
913981478 1:143521872-143521894 AATTATGGAGATGGATGGTAGGG + Intergenic
914075850 1:144348527-144348549 AATTATGGAGATGGATGGTAGGG + Intergenic
914103328 1:144617969-144617991 AATTATGGAGATGGATGGTAGGG - Intergenic
915102309 1:153509215-153509237 AGGCATGGAGCTGGGTGTGAGGG + Intergenic
915602132 1:156929149-156929171 AGGCAGGGAGGTGGGTGGGAGGG + Intronic
915626066 1:157114833-157114855 AGTGAGGGAGCTGGGTGGGAAGG + Intergenic
915970653 1:160352861-160352883 AGAGATGGAGGTAGGTGGGAGGG - Intronic
916823816 1:168425734-168425756 ATTCTTGGATGTGGCTGGGATGG + Intergenic
918174574 1:182031616-182031638 ACTCAAGGAGGTTGATGGAAAGG + Intergenic
919773685 1:201179417-201179439 GGTGTTGGAGGTGGAGGGGAAGG - Intergenic
919927529 1:202200056-202200078 AGTAAAGGAGGAGGGTGGGAGGG - Intronic
920098340 1:203500614-203500636 ATTCATGGAGGTTCTTGGGATGG - Intronic
920507469 1:206526631-206526653 GGTCATGTTGGTGAATGGGAAGG - Intronic
920988716 1:210915247-210915269 GGTGATGGAGGTGGATAGGAAGG - Intronic
921073272 1:211679613-211679635 AGTCCTGTAGGTGGAAGAGATGG + Intergenic
921835158 1:219771213-219771235 AGTGATGGACGTGGATTGGCAGG - Intronic
922579464 1:226686184-226686206 GGCCATGGGGGTGGATGGGCAGG + Intronic
922854669 1:228764322-228764344 GGTGATGGAGGTGGAAGGGGAGG + Intergenic
922905071 1:229168108-229168130 AGTGGAGGAGGTGGAAGGGAAGG + Intergenic
923366703 1:233268785-233268807 AGTCATGGGGGTGGAGAGGCTGG - Intronic
923399568 1:233603150-233603172 AGACATGAAGGTGGAAGGGGAGG + Intergenic
1062911137 10:1213112-1213134 AGCCAGGGAGGAGGATGAGATGG + Intronic
1064286078 10:13992444-13992466 GGACATGGAGGTGGGTGGGCAGG - Intronic
1064555791 10:16545940-16545962 AGTCATGGGGGAGGCTGGGGTGG + Intergenic
1064615268 10:17147486-17147508 AGTTCTGGAGGTGGATGGGGAGG - Exonic
1065210538 10:23398263-23398285 TTCCCTGGAGGTGGATGGGAGGG + Intergenic
1066351792 10:34642716-34642738 ATTTAGGGAGGTGGATTGGAAGG - Intronic
1066782173 10:38963583-38963605 AGTTATGGAGATGGATGGTAGGG - Intergenic
1066951231 10:42119501-42119523 AATTATGGAGATGGATGGTAGGG + Intergenic
1066954945 10:42157046-42157068 AGTTATGGAGATGGATGGTGGGG + Intergenic
1066968746 10:42296066-42296088 AGGCATGGAATTGGATGGAATGG - Intergenic
1067665043 10:48270583-48270605 AGACATGGCTGTGGAGGGGATGG - Intronic
1068616477 10:59123929-59123951 AGCCATGGAGGTGGGAGGCAAGG + Intergenic
1068661993 10:59632189-59632211 TGTCATGGAGGTGGGTTGCAAGG - Intergenic
1069617617 10:69816191-69816213 AGTCATGGAGGTGGTGAGAAGGG + Intronic
1069635721 10:69923646-69923668 AGTCAGGGAGGTGGAAGAGTGGG + Intronic
1070684705 10:78472093-78472115 AGTGAGGGAAGTGGAGGGGAGGG - Intergenic
1070939013 10:80326831-80326853 AGCCAGGGAGGGGGATGGCAGGG - Intergenic
1071425778 10:85547932-85547954 AGTCATGGAAGTGCATGGCAGGG + Intergenic
1071490704 10:86134636-86134658 AGTCATGGGTGTGCAGGGGAGGG - Intronic
1071992046 10:91109069-91109091 TGGCATGGAGGTGCATGGAATGG + Intergenic
1072464055 10:95646810-95646832 TGGCATGGTGGGGGATGGGAGGG + Intronic
1072729557 10:97836435-97836457 AGTTTTGGGGGTGGATGAGAAGG - Intergenic
1072743180 10:97922504-97922526 AGCCAAGGAGGTGGGTGGCAGGG + Intronic
1074322352 10:112414925-112414947 AATCTTGGAGGTGGTTGGGGAGG - Intronic
1074658102 10:115617761-115617783 AGGCATGGAGATTGTTGGGAAGG + Intronic
1074896922 10:117785277-117785299 ATTCATGGAGGTGGGTGGTAGGG - Intergenic
1076239337 10:128892244-128892266 ACTCCTAGAGGTGGAAGGGAAGG + Intergenic
1076435507 10:130438566-130438588 AGGGATGGGGGTGCATGGGAAGG - Intergenic
1077009859 11:375021-375043 AGGGAGGGAGGTGGAAGGGAGGG + Intronic
1077009871 11:375051-375073 AGGGAGGGAGGTGGAAGGGAGGG + Intronic
1077009883 11:375081-375103 AGGGAGGGAGGTGGAAGGGAGGG + Intronic
1077009913 11:375156-375178 AGGGAGGGAGGTGGAAGGGAGGG + Intronic
1077145160 11:1041314-1041336 GGGCCTGGAGGTGGCTGGGATGG + Intergenic
1077211251 11:1371889-1371911 AGTCATGGAGGAGCCCGGGAGGG + Intergenic
1078408923 11:11095467-11095489 AGTCATGCAGGGGGAGGGGCAGG + Intergenic
1078599476 11:12717590-12717612 AATAATGGAAGTGGAAGGGAGGG + Intronic
1078720322 11:13878139-13878161 GGTCATAGAGCTGGATGTGATGG + Intergenic
1078922728 11:15845452-15845474 AGTCCTGAAGGTGGATGGGAGGG - Intergenic
1079820294 11:25118703-25118725 AATGAGGGAGATGGATGGGATGG - Intergenic
1080107279 11:28524320-28524342 AGTCATAGACTTGGGTGGGAAGG - Intergenic
1081528078 11:43940709-43940731 AGTGAGAGAGGGGGATGGGAAGG - Intronic
1081641338 11:44756493-44756515 AGTTATGGAGATGGATGGCATGG - Intronic
1081704151 11:45170943-45170965 ACCCATGGAGGGGGATGGGGTGG - Intronic
1083281172 11:61628153-61628175 CTTCATGGAGGTGGCTAGGATGG + Intergenic
1083384359 11:62296669-62296691 TTTCATGGAGGAGGAGGGGAGGG + Intronic
1083486192 11:62984325-62984347 AGTCACGATGGTAGATGGGAAGG + Exonic
1083526442 11:63370433-63370455 AGTCACGATGGTGGATGAGAAGG - Exonic
1083945731 11:65921589-65921611 AGGCAGGTGGGTGGATGGGATGG - Intergenic
1083977972 11:66139473-66139495 GGTTAGGGGGGTGGATGGGAGGG - Intronic
1083997388 11:66279028-66279050 GGTCAGGGAGGGGGCTGGGAAGG - Intronic
1084532908 11:69739566-69739588 ATTCATGGAGGTGGATATAATGG + Intergenic
1084734500 11:71095640-71095662 TGGGATGGAGGGGGATGGGATGG - Intronic
1085943881 11:81242069-81242091 ACTCACGGAGATGGATGGCATGG + Intergenic
1086945066 11:92836726-92836748 AGTGGTGGATGTGGATGGGAAGG - Intronic
1087222631 11:95562854-95562876 AGTCATGTAGGAGAAAGGGAGGG + Intergenic
1087270007 11:96101394-96101416 AGTCATTGAGGAGAAAGGGAAGG + Intronic
1089180291 11:116579043-116579065 AGTGAGGCAGGAGGATGGGAAGG + Intergenic
1089271046 11:117301418-117301440 AGACATGGAGGTGTGTGGGAGGG - Intronic
1089313286 11:117574049-117574071 ATTCTAGGAGCTGGATGGGAGGG + Intronic
1089534545 11:119152626-119152648 AGACATGGAAGTGGAGGGGAAGG - Intronic
1089609373 11:119660920-119660942 AGGCGTGGAGCTGGAGGGGATGG - Intronic
1089627923 11:119763155-119763177 AGCAATGGAGCTGGAAGGGAGGG - Intergenic
1091269147 11:134293418-134293440 CGTCATGGAGATGAGTGGGAAGG + Intronic
1091642894 12:2250939-2250961 AGTCACCAGGGTGGATGGGATGG - Intronic
1091652202 12:2318858-2318880 AGGGAGGGAGGTGGATGGGGAGG + Intronic
1091668882 12:2438391-2438413 AGTCATGGTGGTGGTGGTGATGG + Intronic
1092091617 12:5808516-5808538 AATCATGGAGGGGGAGGAGAGGG + Intronic
1094042741 12:26134712-26134734 AGTCCTAGTGGGGGATGGGAGGG - Intronic
1094307101 12:29032508-29032530 AGTGATGGAAATAGATGGGAGGG - Intergenic
1094423491 12:30296298-30296320 AGGAATGGGGATGGATGGGAGGG - Intergenic
1095160596 12:38910284-38910306 ACTGATAGAGGGGGATGGGAAGG - Intergenic
1095527259 12:43141916-43141938 AGTCAGGGAGGTGGAGTTGAGGG + Intergenic
1096533601 12:52257121-52257143 ACTCATGGAGTTGGATGAAAAGG - Intronic
1097766284 12:63530867-63530889 AGTCCTGGAGGTAGGTGGTAGGG - Intergenic
1097782720 12:63726704-63726726 AGTCCTGGAGGTAGGTGGTAGGG - Intergenic
1097979803 12:65726163-65726185 AGTAAAGGAGGTGGAAGGGAAGG + Intergenic
1098149784 12:67534936-67534958 AGCCATGGAGGTGGTTGTGGAGG + Intergenic
1101549793 12:105751161-105751183 AGTCATGCAGGTGGGTAGGGTGG + Intergenic
1101712953 12:107285766-107285788 AATCAAGGAGATGGATGGGCTGG + Intergenic
1101760143 12:107651624-107651646 AGGCTGGGAGGTGGATGGAAAGG - Intronic
1101777316 12:107806425-107806447 AGTCATGTAGGTGGGAGAGAAGG + Intergenic
1101824260 12:108208440-108208462 AGTCAAGAAGATGGAAGGGATGG + Intronic
1104315542 12:127696786-127696808 AGTGATGGTGGTGGAGAGGATGG + Intergenic
1104513856 12:129405528-129405550 AGGCATGGAGGTGGGTCGGGAGG + Intronic
1104663138 12:130626827-130626849 AGTCATGGTGATGGAGGAGATGG - Intronic
1104670276 12:130675528-130675550 AGGCATGGGGGTGGACGGAAGGG - Intronic
1105828677 13:24144828-24144850 AGGCAAGGAGGTGGATGGCCAGG - Intronic
1106190318 13:27446830-27446852 GGTGATGGGGGCGGATGGGAAGG + Intronic
1106418979 13:29569883-29569905 AGCCATGGAGGTGGATCTGCGGG - Intronic
1109267689 13:60219932-60219954 AGTGAAGGGGGTGGGTGGGAGGG + Intergenic
1110082407 13:71331950-71331972 AGTCATGGGGTTGGGTGGGGGGG + Intergenic
1112581342 13:100678871-100678893 TGTGATGGAGGAGGATAGGAGGG - Intergenic
1113024348 13:105923752-105923774 AGTCAAGGAGATGGATGTTATGG + Intergenic
1113452054 13:110417619-110417641 AGGACTGGAGGTGGAGGGGAGGG - Intronic
1115517961 14:34205162-34205184 GGTAGTGGAGGTGGGTGGGAAGG - Intronic
1115716078 14:36105056-36105078 AGTTATGGTTGTGGATGAGATGG + Intergenic
1116039044 14:39663417-39663439 AGTGATGGTGGTGGAGGGGAAGG + Intergenic
1117006534 14:51426357-51426379 GGGCTTGCAGGTGGATGGGAAGG - Intergenic
1117992242 14:61445437-61445459 TGCCATGGAGGTAGATGGAATGG + Intronic
1119156919 14:72419951-72419973 AGACAGAGAAGTGGATGGGAAGG + Intronic
1122268106 14:100556171-100556193 AGTGAAGGAGGGGGAGGGGAGGG - Intronic
1202938463 14_KI270725v1_random:117093-117115 AATTATGGAGATGGATGGTAGGG - Intergenic
1124526205 15:30455725-30455747 AGACATGGTGGTGGTGGGGATGG + Intergenic
1124772448 15:32551959-32551981 AGACATGGTGGTGGTGGGGATGG - Intergenic
1124798758 15:32809089-32809111 AGTCATGGGGGTGGATGTGAGGG + Intronic
1124823594 15:33071492-33071514 TTTCATGGAGGTGGAAGGCAGGG - Intronic
1125684398 15:41555197-41555219 AGACATGTAGGTGGATGAGAGGG - Intergenic
1128464891 15:67902156-67902178 ATTCCTGGAGGTTGATGGGTGGG - Intergenic
1128705708 15:69836314-69836336 AGTGAGGCAGGTGCATGGGAGGG - Intergenic
1128794681 15:70457049-70457071 ACTAATGGAGGAGGATGGGAGGG - Intergenic
1128940469 15:71784006-71784028 AGGCAAAAAGGTGGATGGGAAGG - Intergenic
1129205653 15:74035713-74035735 AGCCATGGAGGAGAAGGGGAGGG - Intronic
1129243964 15:74268694-74268716 TGTCTTGGAGGTGGCGGGGAGGG + Intronic
1129336238 15:74853806-74853828 AGTGGTGGTGGTGGGTGGGATGG + Intronic
1129360156 15:75019475-75019497 ACTCTTGGTGGTGGGTGGGAGGG + Exonic
1129998374 15:80026215-80026237 AGTAAAGGAGATGGTTGGGAGGG + Intergenic
1130848241 15:87767544-87767566 AATAATGGAGCTGGATGGAAGGG + Intergenic
1132008636 15:98254411-98254433 AATCATGGAGGAAGATGGCACGG - Intergenic
1133703542 16:8331961-8331983 AGTGAGGGAGGTGAAGGGGAAGG - Intergenic
1134273240 16:12753567-12753589 AGACCTGGAGGAGGAGGGGAGGG - Intronic
1134819210 16:17232589-17232611 AGTGATGGTGGTGGAGGTGATGG + Intronic
1135100083 16:19597497-19597519 GGGCAGTGAGGTGGATGGGATGG + Intronic
1135186045 16:20316848-20316870 AGTGATGGAGGAGGAAAGGAGGG - Intronic
1135259267 16:20966744-20966766 AGTCTGGGAGGTGGGTTGGATGG + Intronic
1135721221 16:24820246-24820268 AGTCCCGGAGGTGGGCGGGACGG - Exonic
1135921396 16:26652030-26652052 AGAAGTGGAGGTGGAAGGGATGG - Intergenic
1135949482 16:26900419-26900441 AGTTTGGGAGGTGGACGGGACGG + Intergenic
1136133786 16:28241737-28241759 AGTCATTGCGGTGGGTGGGGGGG - Intergenic
1136298372 16:29316753-29316775 AGTCCTGCAGGTGGCTGTGAGGG + Intergenic
1136697095 16:32092083-32092105 AGTTATGGAGATGGATGGTAGGG + Intergenic
1136700828 16:32139214-32139236 AATTATGGAGATGGATGGTAGGG + Intergenic
1136766827 16:32788245-32788267 AATTATGGAGATGGATGGTAGGG - Intergenic
1136797594 16:33035374-33035396 AGTTATGGAGATGGATGGTAGGG + Intergenic
1136801268 16:33082133-33082155 AATTATGGAGATGGATGGTAGGG + Intergenic
1136939391 16:34507594-34507616 AATTATGGAGATGGATGGTAGGG + Intergenic
1136945088 16:34640113-34640135 ATTTATGGAGATGGATGGTAGGG + Intergenic
1136948024 16:34679261-34679283 AATTATGGAGATGGATGGTAGGG + Intergenic
1136955415 16:34779139-34779161 AATTATGGAGATGGATGGAATGG + Intergenic
1136960430 16:34840967-34840989 AATTATGGAGATGGATGGTAGGG - Intergenic
1136967262 16:34928953-34928975 AATTATGGAGATGGATGGTAGGG + Intergenic
1137017696 16:35393571-35393593 ACTCATTGAGGTGTAAGGGAGGG - Intergenic
1137084992 16:36108781-36108803 AGTTATGGAGATGGATGGTAGGG + Intergenic
1137087877 16:36151064-36151086 AATTATGGAGATGGATGGTAGGG + Intergenic
1137092321 16:36209221-36209243 AATTATGGAGATGGATGGTAGGG + Intergenic
1137219608 16:46435082-46435104 AATTATGGAGATGGATGGTAGGG + Intergenic
1138144153 16:54594232-54594254 GGTCATGGATGTGGCTGGGCAGG - Intergenic
1138663568 16:58542571-58542593 ATTAATGGAGGTGGGTGGGGGGG + Intronic
1139436432 16:66939273-66939295 AGACATGGAGTCGGAAGGGAAGG - Exonic
1139436748 16:66940937-66940959 AATCATCTAGGCGGATGGGATGG + Intronic
1139489039 16:67276779-67276801 AGTCTGGGAGGTAGATGGGAAGG + Intergenic
1140963979 16:79945954-79945976 AGTCATGGAGATGGAAAGAATGG + Intergenic
1141575033 16:84958348-84958370 GGTCATGGATGGGGGTGGGAGGG - Intergenic
1142012153 16:87721008-87721030 GGTCTCGGATGTGGATGGGAAGG - Intronic
1203069222 16_KI270728v1_random:1050497-1050519 AATTATGGAGATGGATGGTAGGG - Intergenic
1143029784 17:3961504-3961526 AGTGAGGGAGGAGGGTGGGAAGG + Intronic
1143098325 17:4490367-4490389 AGTCATGGAGGGGTGTGGTATGG + Intergenic
1143172453 17:4938116-4938138 GGGCCTGGAGGTGGGTGGGAGGG - Intronic
1143622882 17:8091091-8091113 AGTCATCGAGGTGGTTGAGGAGG - Intergenic
1143786185 17:9257453-9257475 TGACATGGAGGAGGAGGGGAAGG + Intronic
1143857358 17:9862098-9862120 AGACAAAGAGGTGGATGGGATGG - Intronic
1144028968 17:11302854-11302876 AGTCATCCAGGTGGAGAGGAGGG + Intronic
1145326608 17:21835724-21835746 AGTTATGGAGATGGATGGTAGGG - Intergenic
1145689584 17:26724894-26724916 AGTTATGGAGATGGATGGTAGGG - Intergenic
1145693450 17:26767167-26767189 AGTTATGGAGATGGATGGTAGGG - Intergenic
1145908370 17:28528630-28528652 AGTCATGGTGGTGGACAGGTCGG - Intronic
1148071997 17:44914006-44914028 GGTCAGGGAGGTGGAGGGGAGGG - Exonic
1148195774 17:45711510-45711532 GGGCATGGAGGTGGTGGGGAGGG - Intergenic
1148760156 17:49995512-49995534 GGGCGTGGAGGTGGAGGGGAAGG + Intergenic
1148866839 17:50633207-50633229 AGGTATGGAGGGGGATTGGAGGG + Intergenic
1149189529 17:54042809-54042831 TGTCTTGGAGGTGGAGAGGAGGG - Intergenic
1149448465 17:56731979-56732001 AGTCTTGGAAGTGGCTGGAAAGG - Intergenic
1149510476 17:57237124-57237146 AGTGCTGGAGGTGGCTGGCAAGG - Intergenic
1149641370 17:58205049-58205071 AGTCATGGTGAGGGAGGGGAGGG - Exonic
1150148670 17:62792487-62792509 AGTCATGGTGGTGGTGGTGATGG - Intronic
1150300830 17:64045613-64045635 AGTCATGGATGAGGGAGGGAGGG - Intronic
1150920557 17:69477860-69477882 AGTCTTGTAGATGGAAGGGAAGG + Intronic
1152412212 17:80133049-80133071 ACTCATGGAGGTTCTTGGGAGGG - Intergenic
1152521393 17:80858733-80858755 AAACATGGAGGTGGCAGGGAGGG + Intronic
1152637255 17:81435196-81435218 AGGCCTGGGGGTGGTTGGGAGGG + Intronic
1203190800 17_KI270729v1_random:186321-186343 AGTTATGGAGATGGATGGTAGGG - Intergenic
1153707505 18:7761131-7761153 GGTCATGGAAAAGGATGGGAAGG + Intronic
1153842029 18:9015961-9015983 TCTCTTGGAGGTGGGTGGGAAGG - Intergenic
1154516409 18:15171452-15171474 AGTTATGGAGATGGATGGTAGGG + Intergenic
1157160469 18:45309275-45309297 AGTCCTGGAGTCCGATGGGAGGG - Intronic
1157169152 18:45386124-45386146 AGTTATGGAGGTGAAAGTGATGG + Intronic
1157481064 18:48054122-48054144 AGTCTTGGGCGTGGGTGGGACGG + Intronic
1157504132 18:48214222-48214244 AGTTCTGGAGGTGGATGGTGGGG - Intronic
1157600287 18:48889378-48889400 AGTCCTGGAGGGGGTTGGGAGGG + Intergenic
1157731311 18:50006750-50006772 AGTGATGCAGGTGGCTGGCAGGG + Intronic
1157882202 18:51331132-51331154 AGAAATGAAAGTGGATGGGAAGG + Intergenic
1158110970 18:53941206-53941228 AGTCTGGAAGGTGTATGGGAGGG - Intergenic
1158663804 18:59414409-59414431 AGGCATGAAGTTGGAGGGGAAGG - Intergenic
1159119739 18:64154859-64154881 AGTCATGAAGATAGAGGGGAAGG - Intergenic
1159910206 18:74138577-74138599 AGTCATGGAGCTGGGTGAGGTGG - Intronic
1160134402 18:76260299-76260321 AGTCCTGGGGGTGGGGGGGAGGG + Intergenic
1161157537 19:2740314-2740336 AGGCTTGGAGGTGGATGGGAAGG + Intergenic
1162859198 19:13492861-13492883 AGAGATGGAGGGGAATGGGAAGG - Intronic
1164800011 19:31068480-31068502 ATTCAGGGTGGGGGATGGGAGGG + Intergenic
1165477853 19:36042061-36042083 GGTGATGGAGGAGGAGGGGAAGG + Intronic
1166050107 19:40254064-40254086 GGGCAGGGAGGTGGATGGAAAGG + Intronic
1168287989 19:55343849-55343871 GGTCAGGCAGGTGGATGGGCAGG + Intronic
1168306549 19:55439025-55439047 GATCATGGAGATGGATGGGCTGG - Intronic
1168571617 19:57475631-57475653 AGTCACTGGGGTGGATGTGACGG + Intronic
1202669024 1_KI270709v1_random:32760-32782 AGTTATGGAGATGGATGGTAGGG - Intergenic
926044287 2:9698412-9698434 TGTCATGGAGCAGGATGGCAGGG + Intergenic
926195733 2:10762705-10762727 AGCCATGGAGGTGGGAGGGATGG - Intronic
927441283 2:23119734-23119756 GGCAATGGAGGTGGAGGGGATGG - Intergenic
927790174 2:26003434-26003456 TGTCGGGGAGGGGGATGGGAAGG - Intergenic
928206457 2:29288049-29288071 ACTCATGGGGGTGGGAGGGATGG + Intronic
929311316 2:40429335-40429357 GGTTCTGGAGGTGGATGAGAGGG - Exonic
929575778 2:43050762-43050784 CCTCGTGGAGGTGGATGTGAGGG - Intergenic
929879954 2:45826895-45826917 AGTGATGATGGTGGCTGGGAAGG - Intronic
930234794 2:48878283-48878305 AGTAAAGGGGATGGATGGGATGG - Intergenic
931014808 2:57964434-57964456 AGTGGTGGAGGTGGAAGGGATGG + Intronic
931135825 2:59399472-59399494 AGACATGGGGTTGGATGGGAGGG - Intergenic
933284572 2:80371745-80371767 AGCAATGGAGGTGGAAGGTAAGG + Intronic
934117143 2:88808819-88808841 AGTGATGGAGGGTGATGGGTAGG + Intergenic
934156655 2:89207359-89207381 CATCATGGAGGTAGATGGGCCGG + Intergenic
934210660 2:89975392-89975414 CATCATGGAGGTAGATGGGCCGG - Intergenic
934252263 2:90367107-90367129 AGTTATGGAGATGGATGGTAGGG + Intergenic
934257179 2:91435838-91435860 AGTTATGGAGATGGATGGTAGGG - Intergenic
934330826 2:92066422-92066444 AATTATGGAGATGGATGGTAGGG - Intergenic
934561436 2:95315521-95315543 GGTCAGGGAGGTGGAGGGGCAGG - Intronic
935077971 2:99764263-99764285 AGTCAAGGAGGTGAAAGGTAGGG - Intronic
936160584 2:110081463-110081485 AGTGATGGAGGGTGATGGGTAGG + Intergenic
936184080 2:110289891-110289913 AGTGATGGAGGGTGATGGGTAGG - Intergenic
936371534 2:111905870-111905892 AGTCTTGGAGGTGGCAGGCAGGG + Intronic
936681344 2:114775952-114775974 ATTCATGGAGGCACATGGGAAGG + Intronic
937339328 2:121081147-121081169 AGTCTTGGTGGTGGGTGGGTGGG + Intergenic
938239903 2:129735500-129735522 AGTCATGGTGGTGGTAGTGATGG + Intergenic
938239968 2:129735880-129735902 AGTCGTGGTGGTGGTAGGGATGG + Intergenic
938478331 2:131635831-131635853 AGTCAAGGAAGTGGATGGCCAGG + Intergenic
938516732 2:132016446-132016468 AGTTATGGAGATGGATGGTAGGG + Intergenic
939628651 2:144509358-144509380 GGTCATGGGGGTGGATAGGAGGG + Intronic
939977480 2:148735615-148735637 AATCATGGAGGTGGAAGAAAAGG - Intronic
941221291 2:162785040-162785062 AGTCATGGAGCTGTTTTGGAGGG + Intronic
941745442 2:169081900-169081922 AGACATGGAAGTGGGTAGGATGG + Intronic
943064876 2:183075128-183075150 AGCCATGGAGCTGAATGAGATGG - Intergenic
943185926 2:184607583-184607605 TGTCATGGGGGTGGAAGGGGGGG - Intronic
943931041 2:193853762-193853784 AGTAATGCAGGTGGAGGGAAAGG + Intergenic
944404006 2:199361510-199361532 AGGAAGGGAGGTGGGTGGGAGGG - Intronic
946431436 2:219628916-219628938 GGTCATGAAGGGGGCTGGGAGGG - Intronic
947913816 2:233819267-233819289 AGTCATGGAGTGGCAGGGGAGGG + Intronic
948109123 2:235440389-235440411 AGGCTGGGAGGTGGATGGCATGG + Intergenic
948662345 2:239515250-239515272 TGCCATGGAGATGCATGGGAGGG - Intergenic
1169248726 20:4044465-4044487 AGTCCTGGTGGTGGATGGAAGGG + Intergenic
1169750979 20:8994343-8994365 AGTCATGGGGGTAGAGTGGAGGG - Intergenic
1170853405 20:20024665-20024687 GGTCCTAGAGGTCGATGGGAGGG + Intronic
1171083402 20:22212030-22212052 AGTTCTGGAGATGGATGGTAAGG - Intergenic
1172318957 20:33981114-33981136 ATCCATGGAGGTGGAGGGGAAGG + Intergenic
1172636856 20:36415846-36415868 AGGCCTGGAGATGGAGGGGAGGG + Intronic
1172744164 20:37193876-37193898 AGCCATGGGCATGGATGGGATGG + Intronic
1172824055 20:37765187-37765209 ATTCTTGCAGGTGGATGGGCAGG + Exonic
1172952133 20:38728941-38728963 AGTCATCGAGGGGGTTGGGAAGG + Exonic
1174467610 20:50730276-50730298 GGGAATGGAGGTGGAGGGGAAGG - Intergenic
1175505214 20:59478571-59478593 AGTTCTGGAGGTGGATGGTGGGG - Intergenic
1175514811 20:59562265-59562287 AGTTCTGGAGGTGGATGGTGGGG + Intergenic
1175608206 20:60328682-60328704 AATTAGGGAGGTGGAGGGGATGG - Intergenic
1175974345 20:62702837-62702859 ATTCATGGGTGTGGATGAGATGG - Intergenic
1176584850 21:8572043-8572065 AATTATGGAGATGGATGGTAGGG + Intergenic
1176968028 21:15233598-15233620 AATCATGGGGGTGGAGGGGAGGG + Intergenic
1177013565 21:15756927-15756949 AGATATGGAAGTGGATTGGATGG + Intronic
1177338547 21:19765589-19765611 AGTCATGCAGATGGATGGCATGG + Intergenic
1177518794 21:22190338-22190360 AGTCATGGAGGGGGAAGAGTAGG - Intergenic
1178342014 21:31793731-31793753 AGTCAGTGAGGTGGCTGGGAAGG + Intergenic
1178360441 21:31944636-31944658 AGTCAAGGAGGAGAAGGGGAGGG + Intronic
1178486956 21:33025521-33025543 AGTCAGGTTGGGGGATGGGATGG - Intergenic
1178727007 21:35062108-35062130 AGACAGGGAGGAGGATGGGGAGG - Intronic
1178808106 21:35856366-35856388 AGACAGTGAGGTTGATGGGAAGG + Intronic
1179076281 21:38124951-38124973 GGTTCTGGAGGTGGATGGTAGGG - Intronic
1180199355 21:46215401-46215423 AGGCCTGGGGGTGGGTGGGAGGG - Intronic
1180267661 22:10548945-10548967 AATTATGGAGATGGATGGTAGGG + Intergenic
1181485106 22:23225568-23225590 AGGTCTGGAGGTGGCTGGGATGG + Intronic
1182548802 22:31090352-31090374 AGCCATGGGGGTGGAGGGGGAGG - Intronic
1182829158 22:33290707-33290729 AGTCAAGTAGGTGGGTGTGAGGG + Intronic
1182868762 22:33627729-33627751 GGTCATGGATGTGGATTGGAGGG - Intronic
1183291185 22:37002888-37002910 AGCCTGGGAGGTGGCTGGGATGG - Intronic
1183951865 22:41356936-41356958 AGCCATGGGGGTGGTGGGGAAGG + Intronic
1184274297 22:43401390-43401412 AGTTGAGGAGGTGGATGAGATGG + Intergenic
1184671275 22:46013405-46013427 CCTCATGGAGCTGGAAGGGACGG - Intergenic
1184744747 22:46449745-46449767 TGGCATGGAGGTGGAGGGGAGGG + Intronic
1184764567 22:46564721-46564743 AGTCCTGGAGATGGATGGTGGGG + Intergenic
1185062330 22:48613579-48613601 ATTCACGGAGGAGGCTGGGAAGG - Intronic
1185229932 22:49673949-49673971 AGCCATGGAGGGGGACAGGAGGG + Intergenic
1203325615 22_KI270738v1_random:12589-12611 AGTTATGGAGATGGATGGTAGGG + Intergenic
950017660 3:9765689-9765711 AGGAAAGGAGGAGGATGGGAGGG + Intronic
950334349 3:12181828-12181850 AGTCCTGAAGGCTGATGGGATGG + Intronic
950387719 3:12673218-12673240 AGCCATGGAGGTGGTGGGGGAGG - Intergenic
950580879 3:13861333-13861355 GGTCAGGGAGGTGGAGGGGAAGG - Intronic
950899730 3:16486683-16486705 AGTAATGGAGACTGATGGGATGG - Intronic
951444441 3:22762111-22762133 ATTCTAGGAGGTGAATGGGAAGG - Intergenic
951975764 3:28506469-28506491 AGTGAGAGAGGTGGAAGGGATGG + Intronic
952983743 3:38759227-38759249 AGCCATGGAGGTGGGTGAGATGG + Intronic
953211497 3:40879035-40879057 ATTCACAGAGGAGGATGGGATGG - Intergenic
953660555 3:44888522-44888544 AGTCTGGGATCTGGATGGGAGGG - Intronic
954366418 3:50148683-50148705 AGCCATGGAGGTGTCTGGGATGG + Intergenic
954996152 3:54883711-54883733 AGTCATGTAGGTGGCAGGAAGGG - Intronic
956664661 3:71631209-71631231 AGCCATGGGGTTGGATGAGATGG - Intergenic
956787088 3:72651804-72651826 GGTGATGGTGGTGGATGTGATGG - Intergenic
960369444 3:116815848-116815870 AGTCAGGGAGGTAGAAGGGGAGG - Intronic
960823140 3:121755670-121755692 TGTCATGGATGGGGTTGGGAAGG + Intergenic
962012078 3:131401442-131401464 AGTCATGGGGGTGGGAGAGATGG + Intergenic
962244068 3:133776785-133776807 AGGCATGGGTGTGGGTGGGAGGG + Intronic
962301745 3:134250150-134250172 AGGCAGTGAGGAGGATGGGATGG + Intronic
962693627 3:137926379-137926401 AGTCTTGGAGTTGGAGGGCATGG - Intergenic
962706761 3:138051325-138051347 AGTGATGGTGGTGGATGTGGAGG + Intergenic
962828188 3:139118135-139118157 TGTCTTGGGGGTGGATGGGGTGG + Intronic
963055317 3:141181847-141181869 ACTCCTGGAGGTGGAGGAGAAGG - Intergenic
964647359 3:158972582-158972604 AATCATGGAGGCTGAGGGGATGG + Intronic
965792243 3:172402172-172402194 AGTGATGGAGGTGGGTGGGGAGG - Intergenic
965835156 3:172843087-172843109 AGACATGGCGGTGGAAGGTAAGG - Intergenic
966623659 3:181993379-181993401 AGTCAGGGAGAAAGATGGGAAGG + Intergenic
968801184 4:2744164-2744186 AGTTATGGAGGAGGCTGGCATGG - Intronic
971242027 4:24897999-24898021 AGTATTGGAGGTGGCAGGGATGG - Intronic
971703150 4:30006871-30006893 AGTCAGGGATGGGGATGAGATGG - Intergenic
972045973 4:34664621-34664643 AGTCATTGAAGAGGATAGGAAGG - Intergenic
973854408 4:54996446-54996468 AGTGATAGAGATTGATGGGATGG - Intergenic
974819602 4:67049613-67049635 CGACAGGGAGGTGGAGGGGAAGG + Intergenic
974915833 4:68177217-68177239 AGGGATGGAGGTGCTTGGGAAGG - Intergenic
975544472 4:75547157-75547179 AGGCATGGAGGAGGAGGGAAGGG - Intronic
977982110 4:103336476-103336498 AGGCAGGGAGGAGGAAGGGAGGG - Intergenic
978324389 4:107535577-107535599 TGTCTTGGAGGTGGAGGAGAGGG - Intergenic
978345034 4:107757732-107757754 AGTCATGGAAATGTATTGGATGG - Intergenic
979834368 4:125344813-125344835 AGTCATGGTGGTGGGGGGCAGGG - Intronic
980158525 4:129133796-129133818 AGTCATGGAGGTGGAGACCAGGG + Intergenic
980341397 4:131552414-131552436 AGTCAGGAAGGTGTATTGGAAGG - Intergenic
980622605 4:135328702-135328724 ATTTATGGTGGTGGATGGGGCGG - Intergenic
981486769 4:145295041-145295063 ATCCATGTAGGTGGCTGGGAAGG - Intergenic
981949180 4:150385543-150385565 AGTCAAGGAAATGGATGGGTAGG + Intronic
982373115 4:154656352-154656374 AGCCATGGAAGTGGATGAGGTGG + Intronic
983805031 4:171983845-171983867 AGTAAAGGAGGTGGTGGGGAAGG + Intronic
984519012 4:180778059-180778081 AGTTGTGGAGATGGATAGGAGGG - Intergenic
986238456 5:5934753-5934775 TGTCATGGAGGTGGATAGGAAGG + Intergenic
986730081 5:10628855-10628877 AGACCTGGAGTTGGAAGGGATGG + Intronic
986814438 5:11393003-11393025 ACTCATGCGGGTGGATGTGAAGG - Intronic
987416994 5:17672089-17672111 AGTCTTGGACCTGGATGTGATGG + Intergenic
987557047 5:19465964-19465986 AGTGATGAAGGTTGATGGGAAGG + Intergenic
988814391 5:34819432-34819454 AGTCATGGAGGTGGCATGGTGGG - Intronic
988836934 5:35042775-35042797 AGAGATGGAGGTGGAGGGGAAGG + Intronic
990962974 5:61414273-61414295 AGTGATGGCATTGGATGGGATGG + Intronic
991061482 5:62380840-62380862 AGTGGAGGAGGTGGAAGGGATGG + Intronic
993464035 5:88222517-88222539 GGTCAGGGAAGTGGATGGAAAGG + Intronic
997374706 5:133389433-133389455 AGTTCTGCAGGTGGGTGGGAAGG + Intronic
997655862 5:135553894-135553916 AGTGATGGAGGAGGAAGTGAAGG + Intergenic
998207366 5:140167716-140167738 AGCCATGGAGGAGGTTGGCATGG - Intergenic
998771401 5:145549985-145550007 AGGCATTGAGGAGGGTGGGAAGG + Intronic
999080419 5:148838344-148838366 AGTCTTGGAGGTGGAGTGGTGGG + Intergenic
999635513 5:153617879-153617901 AGTTTTGAAGGTGGAGGGGAAGG - Intronic
1000197473 5:158973381-158973403 AGTCATGTAGGTGAAGGGGTGGG - Intronic
1000928370 5:167221210-167221232 AGTCATGGAAATGAATTGGAAGG + Intergenic
1002358574 5:178651236-178651258 AGTCATGGGGGTGGATGGAGGGG + Intergenic
1002596004 5:180323725-180323747 AGGCAGGGAGGGGCATGGGAGGG + Intronic
1002988728 6:2217768-2217790 AGGCTTGGAGGGGAATGGGAGGG - Intronic
1003454749 6:6271388-6271410 AGTCATGGATGTTGATGGATGGG - Intronic
1003509476 6:6767611-6767633 AATGTTGGAGGTGGGTGGGAGGG - Intergenic
1004396319 6:15248775-15248797 CGTCACGGAGGAGGAGGGGAAGG - Intronic
1004418728 6:15448663-15448685 AGTCTGGGAGGTTGGTGGGAAGG + Intronic
1004754882 6:18600640-18600662 AGTCATGGAGCTGGGTGGGTCGG + Intergenic
1005934302 6:30508231-30508253 GGACATGCAGGTGGAGGGGAGGG + Intergenic
1006311545 6:33264536-33264558 AATGTTGGAGGGGGATGGGAGGG + Intronic
1006604477 6:35246100-35246122 AGCCAAGGAGGTGGGTGAGAAGG + Intronic
1006610867 6:35293620-35293642 TGTCATAGTGGTGGAAGGGATGG - Intronic
1006785695 6:36665511-36665533 CGTGATGTAGGTGGATGGGCGGG + Intergenic
1007186966 6:39980070-39980092 ACTGAGGGAGGAGGATGGGAGGG - Intergenic
1007464103 6:42039831-42039853 AGCCAAGAAGGTGGAAGGGAGGG - Intronic
1010890825 6:81308461-81308483 AGACATTGAGGTGGTTGGGGGGG - Intergenic
1011238669 6:85246821-85246843 AGTACTGGAGGGGGAAGGGAGGG - Intergenic
1011353658 6:86451325-86451347 AGTCATTGCTGTGGGTGGGAAGG + Intergenic
1012169042 6:95995479-95995501 ACTCAGGGAGAAGGATGGGAAGG + Intergenic
1012221131 6:96650769-96650791 AATCATGGAGGTGGAGGTGGAGG - Intergenic
1014214405 6:118738817-118738839 AGTCATGGTGCTGAATGGGCTGG - Intergenic
1015369485 6:132434958-132434980 AGTAATGCAGGAGGAAGGGAGGG + Intergenic
1015865689 6:137724215-137724237 AGTCCTGGAGGTGAATGTGGGGG + Intergenic
1017028605 6:150201839-150201861 AGTTATGGTGATGGATTGGATGG + Intronic
1017931794 6:158961832-158961854 TGTTGTGGAGGTGGAGGGGATGG + Intergenic
1018869010 6:167767440-167767462 TGTCATGGAGCAGGATGGCACGG - Intergenic
1019710131 7:2514429-2514451 AGGCATGCGGGTGGCTGGGAGGG - Intronic
1019863910 7:3686948-3686970 AGTAAGGGAAGTGGTTGGGATGG + Intronic
1019961515 7:4464361-4464383 AATCATAGAGGTGGAAGGGGTGG - Intergenic
1023025614 7:36047342-36047364 AGTCCTGGAGTTGGATAAGAAGG + Intergenic
1023546847 7:41326710-41326732 TTTCATGGAGTTGGATGGCAAGG - Intergenic
1023967237 7:44969381-44969403 AGCCAGGGATGTGGGTGGGAGGG + Intronic
1024023305 7:45390384-45390406 AGCCATTGAGGAAGATGGGAAGG + Intergenic
1024807147 7:53155883-53155905 AGTTATGGAGATGGATGGTAGGG + Intergenic
1025319541 7:58080307-58080329 AGTTATGGAGATGGATGGTAGGG - Intergenic
1025483383 7:61014922-61014944 AATTATGGAGATGGATGGTAGGG + Intergenic
1025564706 7:62419294-62419316 AATTATGGAGATGGATGGTAGGG + Intergenic
1026464519 7:70642722-70642744 AGTCACTGAGGAGGATGGAATGG - Intronic
1026866000 7:73824407-73824429 AGTCGGGGAGGTGGGTGGGAAGG + Intronic
1028778897 7:94712964-94712986 AGTTCTGGAGATGGATGGTAGGG + Intergenic
1029127663 7:98305907-98305929 AGCCATGGGAGTGGATGAGATGG + Intronic
1029491560 7:100873366-100873388 AGTCATACAGGTGGATGTCAGGG - Exonic
1029610756 7:101625384-101625406 AGACGGGGAGGTGGACGGGATGG + Intronic
1030346725 7:108442162-108442184 GGTCATGGAGGTGGCTGAGGTGG + Intronic
1030740923 7:113109072-113109094 AGATATGGGGGTGAATGGGAAGG + Intergenic
1032247845 7:130228413-130228435 GGTCAAAGAGGTGGGTGGGAGGG + Intergenic
1032627675 7:133610121-133610143 AGTCATGGAGGATCATGGAAAGG - Intronic
1033483262 7:141762454-141762476 AGCAAAGGAGGTAGATGGGAGGG + Intronic
1033720672 7:144056185-144056207 AGGTATGGAGGAGGGTGGGAGGG + Intergenic
1035322676 7:158043585-158043607 AGACATGGCCGTGAATGGGAAGG + Intronic
1036296771 8:7543684-7543706 AGTCCTGGAGGTGGAAGGAGAGG - Intergenic
1036325796 8:7777335-7777357 AGTCCTGGAGGTGGAAGGAGAGG + Intergenic
1037712388 8:21365302-21365324 AAGGGTGGAGGTGGATGGGAGGG - Intergenic
1038579587 8:28736056-28736078 AGTTCTGGAGATGGATGGCAGGG + Intronic
1040292834 8:46134204-46134226 AGCCCTGGGGGTGGCTGGGATGG + Intergenic
1040705194 8:50117539-50117561 AATCATGGAGGAGGAAGGTAGGG + Intronic
1042223302 8:66494450-66494472 AGTCATGGAGGTGGATGGGAGGG - Intronic
1044755642 8:95458398-95458420 GGTCAGGGAGGAGGAAGGGAAGG - Intergenic
1044841358 8:96339604-96339626 GTCCATGGAGGGGGATGGGATGG + Intergenic
1045032942 8:98154658-98154680 AGTCATAGTGGTGCAGGGGAAGG + Intronic
1045045646 8:98274301-98274323 ATTAATGGAGATAGATGGGATGG - Intronic
1046299322 8:112266105-112266127 GGTCAAGGACTTGGATGGGATGG - Intronic
1046758481 8:117995808-117995830 TGTGAAGGAGGTGGTTGGGAAGG - Intronic
1047224314 8:122943663-122943685 AAACTTGGAGGTGGGTGGGAAGG + Intronic
1047310127 8:123684975-123684997 AATCATGGACGTGGCCGGGAGGG - Intronic
1047353527 8:124098368-124098390 AGTCAGGGAGGGGGATGAGGTGG + Intronic
1047595767 8:126376218-126376240 AGACAGGGAGTTGGAAGGGATGG + Intergenic
1047732951 8:127741463-127741485 AGGGATGGTGGTGGTTGGGAGGG - Intergenic
1047822067 8:128531760-128531782 AGTCAAGGAGGTGGGTGTGTAGG - Intergenic
1048209525 8:132443247-132443269 AGTGCTGGGGGTGGAAGGGATGG - Intronic
1048233190 8:132663874-132663896 TGTCAGGGAGGTGGATGGCATGG + Intronic
1048992800 8:139771152-139771174 AGGACTGGAGGTGGCTGGGAAGG - Intronic
1049069759 8:140347266-140347288 AGGCAGGCAGGTGGCTGGGAAGG - Intronic
1049781183 8:144429691-144429713 ATTCAGGGAGCTGGGTGGGAAGG + Intronic
1049942852 9:565215-565237 AGTCAGGGAGTTGAATGGGTGGG - Intronic
1049993978 9:1017428-1017450 GGTCATGGAGGAGAATGTGATGG - Intergenic
1050319589 9:4437682-4437704 AGTGGAGGAGGTGGAAGGGAAGG - Intergenic
1051359518 9:16269575-16269597 AGTCATGGAGGTGAGAGGGAGGG - Intronic
1052109734 9:24566544-24566566 AGTGATGGTTGAGGATGGGAAGG + Intergenic
1052414421 9:28158611-28158633 AGACAAGGATGTGGGTGGGAGGG + Intronic
1053140042 9:35676426-35676448 AGTCCGGGAGGAGCATGGGATGG - Intronic
1053945436 9:43304491-43304513 AATTATGGAGATGGATGGTAGGG - Intergenic
1054442680 9:65281715-65281737 AATTATGGAGATGGATGGTAGGG - Intergenic
1054487599 9:65739786-65739808 AATTATGGAGATGGATGGTAGGG + Intergenic
1055360585 9:75485651-75485673 AGTCATGGAGGAGGAGGAAAAGG + Intergenic
1056327183 9:85489640-85489662 AGTCCAGCAGGTGGTTGGGAAGG - Intergenic
1056520021 9:87392268-87392290 AGGCATGGGGGTGGCAGGGAAGG + Intergenic
1057199246 9:93131592-93131614 AGGCAGGGAGGTGGTGGGGATGG - Intronic
1057362497 9:94387144-94387166 ATTCATTAAGGTGGGTGGGAAGG + Intronic
1057443746 9:95099554-95099576 TGTCTTGGAGGTGGAGGGAATGG + Exonic
1057550394 9:96047840-96047862 AGTCAGGGAGGGCGATGGCAAGG + Intergenic
1057660840 9:97000951-97000973 ATTCATTAAGGTGGGTGGGAAGG - Intronic
1058736232 9:107896716-107896738 AATCATGGAAGTGGATAGAAAGG - Intergenic
1059335701 9:113567233-113567255 AGACATGGAGGGGGAGGGGAGGG - Intronic
1059716632 9:116919241-116919263 AGGGATGGAGGTGGAGGGCAAGG + Intronic
1060028994 9:120197966-120197988 TCTTATGGAAGTGGATGGGAAGG + Intergenic
1060981371 9:127794321-127794343 AGACAGGCAGGTGGGTGGGAGGG - Intergenic
1061108922 9:128552967-128552989 AGGCTTGGGGGTGGTTGGGAGGG - Intronic
1061424535 9:130490832-130490854 TGTTATGGAGGTGGGTGGGAAGG - Intronic
1061660864 9:132129492-132129514 GGTCAGAGAGGTGGGTGGGAAGG + Intergenic
1203588571 Un_KI270747v1:33069-33091 AATTATGGAGATGGATGGTAGGG - Intergenic
1203614757 Un_KI270749v1:49562-49584 AATTATGGAGATGGATGGTAGGG + Intergenic
1185575482 X:1168994-1169016 AGAGATGGAGGAGGAGGGGAAGG + Intergenic
1185763941 X:2709099-2709121 GGTGATGGAGGAGGATGGGAGGG + Intronic
1186200841 X:7153559-7153581 AGTCACGGAGGAGGACAGGAAGG - Intergenic
1186926103 X:14335149-14335171 GGTCATGGAGTGGGATGGTATGG - Intergenic
1187108108 X:16266112-16266134 AGTCATGGAGGAGGTTGGCCTGG + Intergenic
1187128682 X:16479920-16479942 ATTCATGGAGTTAGATGGGTGGG + Intergenic
1191975690 X:66868722-66868744 AGGCAGGGAGGGGGAGGGGAGGG - Intergenic
1192269705 X:69567144-69567166 AGCCATGAGGGTGGACGGGATGG + Intergenic
1193814127 X:86084985-86085007 AGTCATGGATGTGTACCGGAAGG - Intergenic
1197609588 X:128623429-128623451 GGGCATGGAGGAGCATGGGAGGG - Intergenic
1197689085 X:129477786-129477808 AGGCAGGGAGGTGGGTGGGTGGG - Intronic
1198934835 X:141895088-141895110 GGTCAGGGAGGAGGGTGGGAGGG + Intronic
1199675962 X:150189656-150189678 AGGCATGGAAGTGGCTGGGAGGG - Intergenic
1200791447 Y:7303259-7303281 AGAGATGGAGGAGGAGGGGAAGG + Intergenic
1201099789 Y:10662830-10662852 AGGAATGGAGTGGGATGGGATGG - Intergenic
1201567673 Y:15383928-15383950 AGGCATGGAGGAGGCCGGGAAGG + Intergenic