ID: 1042223303

View in Genome Browser
Species Human (GRCh38)
Location 8:66494451-66494473
Sequence GAGTCATGGAGGTGGATGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 546
Summary {0: 1, 1: 0, 2: 3, 3: 56, 4: 486}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042223303_1042223310 -8 Left 1042223303 8:66494451-66494473 CCTCCCATCCACCTCCATGACTC 0: 1
1: 0
2: 3
3: 56
4: 486
Right 1042223310 8:66494466-66494488 CATGACTCAGGCTTAGCCCCTGG No data
1042223303_1042223314 20 Left 1042223303 8:66494451-66494473 CCTCCCATCCACCTCCATGACTC 0: 1
1: 0
2: 3
3: 56
4: 486
Right 1042223314 8:66494494-66494516 TTGTCAGCCTTGAATGAAGTAGG No data
1042223303_1042223316 25 Left 1042223303 8:66494451-66494473 CCTCCCATCCACCTCCATGACTC 0: 1
1: 0
2: 3
3: 56
4: 486
Right 1042223316 8:66494499-66494521 AGCCTTGAATGAAGTAGGCTGGG No data
1042223303_1042223315 24 Left 1042223303 8:66494451-66494473 CCTCCCATCCACCTCCATGACTC 0: 1
1: 0
2: 3
3: 56
4: 486
Right 1042223315 8:66494498-66494520 CAGCCTTGAATGAAGTAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042223303 Original CRISPR GAGTCATGGAGGTGGATGGG AGG (reversed) Intronic
900179680 1:1305727-1305749 GAGTCATGGCTTTGGTTGGGGGG - Intronic
902331821 1:15734574-15734596 GAGCAAAGGGGGTGGATGGGGGG + Exonic
902675166 1:18003582-18003604 CTGTTATGGAGGTGGAGGGGTGG + Intergenic
902784079 1:18721680-18721702 CACTCATGGTGGTGGATGTGGGG + Intronic
902798222 1:18813399-18813421 GAGACGTGAAGGAGGATGGGAGG + Intergenic
903879894 1:26501166-26501188 GAGTCTGGGCGCTGGATGGGCGG + Intergenic
904418220 1:30375575-30375597 GAGTCAGGGAGGTGGAGAAGTGG - Intergenic
904418234 1:30375629-30375651 GAGTCAGGGAGGTGGAGAAGTGG - Intergenic
904418262 1:30375738-30375760 GAGTCAGGGAGGTGGAGAAGTGG - Intergenic
904418289 1:30375844-30375866 GAGTCAGGGAGGTGGAGAAGTGG - Intergenic
904418331 1:30376008-30376030 GAGTCAGGGAGGTGGAGAAGTGG - Intergenic
904418344 1:30376062-30376084 GAGTCAGGGAGGTGGAGAAGTGG - Intergenic
904788263 1:32998712-32998734 GGGTGATGGGGGTGGAGGGGGGG - Intergenic
905010275 1:34742375-34742397 GAGACAATGAGGTGGATGGTGGG - Intronic
905532592 1:38693884-38693906 GTGGCACAGAGGTGGATGGGAGG - Intergenic
906785084 1:48608532-48608554 GAGTCAGAGAAGTGGATGGATGG + Intronic
907838900 1:58137549-58137571 GGGTGATAGAGGTGGATGGATGG - Intronic
907883409 1:58572102-58572124 GAGGGATGGGGATGGATGGGGGG - Intergenic
908155654 1:61350046-61350068 TAGGCATGGAGGTGAAAGGGTGG - Intronic
909571952 1:77123692-77123714 AAGTTCTGGAGATGGATGGGGGG + Intronic
909782578 1:79564594-79564616 GAGTCATGTAGGTAGAAGAGGGG + Intergenic
910100378 1:83569176-83569198 GTGTAATGGAGGTGTAAGGGTGG - Intergenic
910165535 1:84323990-84324012 GTGTCATGGAATTGGATGGATGG - Intronic
912741154 1:112198888-112198910 GAGGCAGGGTGGAGGATGGGGGG - Intergenic
913272534 1:117108409-117108431 GGGTGATGGAGGCGGATGGGTGG + Intergenic
913356679 1:117929785-117929807 GAGTCCTGGAGGTGCGTGGTTGG + Intronic
913941461 1:125112038-125112060 GAGTTATGGAGATGGATGGTAGG - Intergenic
913955957 1:143293569-143293591 GAATTATGGAGATGGATGGTAGG - Intergenic
913981477 1:143521871-143521893 GAATTATGGAGATGGATGGTAGG + Intergenic
914075849 1:144348526-144348548 GAATTATGGAGATGGATGGTAGG + Intergenic
914103329 1:144617970-144617992 GAATTATGGAGATGGATGGTAGG - Intergenic
914860850 1:151384712-151384734 GGGCCAGGGAGGAGGATGGGAGG + Intergenic
915602131 1:156929148-156929170 TAGGCAGGGAGGTGGGTGGGAGG + Intronic
915625048 1:157109257-157109279 GTTCCATGGAGTTGGATGGGTGG + Intergenic
915653067 1:157333778-157333800 GAGTGATGGGGGTGGGCGGGTGG - Intergenic
915937013 1:160095581-160095603 CAGACATGGAGGTGGGTGAGTGG - Intronic
915970654 1:160352862-160352884 GAGAGATGGAGGTAGGTGGGAGG - Intronic
919674690 1:200369623-200369645 GAGTGACGGGGGTGGATGTGGGG - Intergenic
920099877 1:203510390-203510412 GAGTGTTGGAGGTGGAAGTGGGG + Intergenic
920168002 1:204049732-204049754 GAGGCCTGTTGGTGGATGGGGGG - Intergenic
920893992 1:210025074-210025096 GAGTCAGAGAGGTAGTTGGGGGG + Intronic
921131287 1:212222045-212222067 GAGTCATGGAGATGGAAGGAGGG + Intergenic
922206949 1:223456355-223456377 GTGTGGTGGGGGTGGATGGGTGG - Intergenic
922738976 1:228005270-228005292 GGGTCAGGGAGGGGGAGGGGAGG - Intergenic
922798953 1:228355376-228355398 GAGTCCTTGAGGTGACTGGGAGG + Intronic
922891867 1:229067872-229067894 TGGTCATGGAGGTGAATGTGTGG - Intergenic
1062812586 10:477594-477616 GAGGGAGGAAGGTGGATGGGTGG + Intronic
1063114357 10:3063666-3063688 GAGGCATGGAGGTGGGGTGGAGG + Intergenic
1063218154 10:3942626-3942648 GAGCCATGGAGGGGGGTGAGGGG + Intergenic
1063972287 10:11389522-11389544 GAGGCAGGGATGTGGAGGGGAGG - Intergenic
1066324281 10:34340667-34340689 GAGTCAGGGAAGAGGATTGGGGG + Intronic
1066782174 10:38963584-38963606 GAGTTATGGAGATGGATGGTAGG - Intergenic
1066951230 10:42119500-42119522 GAATTATGGAGATGGATGGTAGG + Intergenic
1066954944 10:42157045-42157067 GAGTTATGGAGATGGATGGTGGG + Intergenic
1067187944 10:44045825-44045847 GAGTTCTGGAGATGGATGGTGGG + Intergenic
1067434968 10:46270277-46270299 AAGGCATTGAGGTGGATGTGGGG - Intergenic
1067997422 10:51289703-51289725 GTGTCTGGGTGGTGGATGGGTGG + Intronic
1069196796 10:65561169-65561191 GATCCATTGAGGTGGTTGGGGGG - Intergenic
1069635720 10:69923645-69923667 GAGTCAGGGAGGTGGAAGAGTGG + Intronic
1069954268 10:72040265-72040287 AAGTGGTGGTGGTGGATGGGTGG + Intergenic
1070332530 10:75428681-75428703 GAGTCATGGAGTGGGGTGAGAGG + Intergenic
1070576067 10:77680063-77680085 GTGTCATGGAGGTGAGTTGGTGG + Intergenic
1070591098 10:77801702-77801724 CACTCATGGTGGTGGACGGGTGG + Intronic
1070645374 10:78198456-78198478 GAGTTAAGGAGGTGGCAGGGAGG + Intergenic
1070674171 10:78400609-78400631 GAGTCATGGAGGAGTAATGGAGG - Intergenic
1070939014 10:80326832-80326854 GAGCCAGGGAGGGGGATGGCAGG - Intergenic
1071379254 10:85041470-85041492 GAGTTATGGAGAGGGATGGTGGG + Intergenic
1071425777 10:85547931-85547953 TAGTCATGGAAGTGCATGGCAGG + Intergenic
1071492379 10:86144549-86144571 GAGTCATGGAGGCTGATGCAGGG - Intronic
1072079748 10:92017273-92017295 AAGTCATGCAGGTGTATGGGGGG + Intronic
1072464054 10:95646809-95646831 GTGGCATGGTGGGGGATGGGAGG + Intronic
1073076604 10:100828513-100828535 GAGTCAGGGAGGAGGATGCAGGG - Exonic
1073241821 10:102064263-102064285 GAGTGATGGAGGTGGAAGTGGGG + Intergenic
1074121216 10:110495872-110495894 GAGTCTGGGGGATGGATGGGAGG - Intergenic
1074896923 10:117785278-117785300 AATTCATGGAGGTGGGTGGTAGG - Intergenic
1075542361 10:123325557-123325579 GAGATATGAAGGTAGATGGGTGG - Intergenic
1075686191 10:124366933-124366955 GAGGCAGGGAGGTCGTTGGGAGG - Intergenic
1075735454 10:124662025-124662047 GAGTCATGGAGGTGAGGGGTTGG - Intronic
1076270928 10:129151529-129151551 GAGAGATGGAGGTGGGGGGGGGG - Intergenic
1076386126 10:130057305-130057327 GAGTTCTGGAGATGGATAGGGGG - Intergenic
1076869838 10:133187907-133187929 GGCTCATGGAGGTGGAGGGCGGG - Intronic
1077009858 11:375020-375042 GAGGGAGGGAGGTGGAAGGGAGG + Intronic
1077211250 11:1371888-1371910 GAGTCATGGAGGAGCCCGGGAGG + Intergenic
1077383441 11:2258068-2258090 AAGTCAGGGAGATGGGTGGGTGG - Intergenic
1077407962 11:2391081-2391103 GAGTGATGGAGGAGGAGGAGGGG + Intronic
1078922729 11:15845453-15845475 AAGTCCTGAAGGTGGATGGGAGG - Intergenic
1079422895 11:20311064-20311086 AAGTCATGTGGGTGGATGTGAGG - Intergenic
1080777621 11:35400990-35401012 GAAGCAAGGAGGTGGGTGGGCGG + Intronic
1080823118 11:35825852-35825874 GAGGGGTGGAGGTGGGTGGGTGG - Intergenic
1080887459 11:36379707-36379729 GAGCCAAGGAGGGGGATGGATGG + Intronic
1081781547 11:45716568-45716590 GAGTCATGGTGGTGGCATGGGGG - Intergenic
1083258653 11:61511328-61511350 GAGTCATGGAGGGGGTGGAGGGG - Intergenic
1083630222 11:64091448-64091470 GTGCCAGGGAGGTGGATGTGGGG + Intronic
1083977973 11:66139474-66139496 GGGTTAGGGGGGTGGATGGGAGG - Intronic
1084116296 11:67044852-67044874 AAGTCATGCAGATGGATAGGGGG + Intronic
1084265962 11:68005250-68005272 GATTCATGCAGGTGGGTGGCTGG + Intergenic
1084274480 11:68044463-68044485 GGGCCATGGAGGAGGCTGGGAGG - Intronic
1084406357 11:68976128-68976150 GACCAATGCAGGTGGATGGGAGG - Intergenic
1084984447 11:72855486-72855508 GAGTTCTGGAGATGGATGGATGG + Intronic
1086954234 11:92919353-92919375 AAGTGATGGAGGTGGATATGTGG + Intergenic
1089112921 11:116071379-116071401 GAGTCATATAGGAAGATGGGTGG + Intergenic
1089271047 11:117301419-117301441 TAGACATGGAGGTGTGTGGGAGG - Intronic
1089611328 11:119671178-119671200 GAGGGATGGAGGGGGAGGGGAGG - Intronic
1089627924 11:119763156-119763178 GAGCAATGGAGCTGGAAGGGAGG - Intergenic
1089824212 11:121258981-121259003 GAGGCAGGGAGGTGGGGGGGGGG - Intergenic
1092479225 12:8845204-8845226 GAACCACGCAGGTGGATGGGAGG - Intronic
1094015113 12:25854658-25854680 GGGACAGGGAGGTGGATGGCTGG - Intergenic
1094511123 12:31097145-31097167 AAGCAGTGGAGGTGGATGGGAGG + Intronic
1095485493 12:42680142-42680164 GAGGCAGGTAGGTGGGTGGGTGG + Intergenic
1095527258 12:43141915-43141937 GAGTCAGGGAGGTGGAGTTGAGG + Intergenic
1095953048 12:47791806-47791828 GAGTCATGGGAGGGGAGGGGTGG - Intronic
1096156947 12:49346251-49346273 GAGTCAAGGAGAGGGATGGGAGG - Intergenic
1096194413 12:49640544-49640566 GAGTCATGGAGGTGGCATGGGGG + Exonic
1096981878 12:55732789-55732811 GAGACATAGAGGAGGGTGGGAGG + Intergenic
1097233843 12:57526994-57527016 GAGGCAAGGAGGTTGCTGGGAGG - Exonic
1101116187 12:101533792-101533814 GAATCATGGAGGTGGTTGGAGGG + Intergenic
1101210380 12:102529532-102529554 GAGTCTGACAGGTGGATGGGTGG - Intergenic
1102035270 12:109767578-109767600 GAGTCATCCAGGTGGCTGTGTGG - Intronic
1102162299 12:110779307-110779329 GAGAAATGGGGGTGGATTGGAGG + Intergenic
1103013897 12:117479307-117479329 GAGTGCAGGAGGTGGATGGGTGG - Intronic
1103054761 12:117809848-117809870 GAGAAATGGATGGGGATGGGAGG + Intronic
1103216879 12:119208503-119208525 AAGTCGAGGAGGTGGATGGATGG + Intronic
1103948761 12:124540767-124540789 GAGAGCTGGAGGGGGATGGGAGG + Intronic
1104670277 12:130675529-130675551 GAGGCATGGGGGTGGACGGAAGG - Intronic
1104778091 12:131403064-131403086 GAGGCCTGGAGGTGTGTGGGGGG + Intergenic
1104963747 12:132499951-132499973 GCGTCAGGGAGGAGGCTGGGTGG + Intronic
1105913505 13:24892459-24892481 GTGTCCTGGAGCTGGATGGAGGG - Intronic
1106253492 13:28001696-28001718 GGGTCAGGGAGGTGGGTGCGGGG + Intergenic
1106418980 13:29569884-29569906 CAGCCATGGAGGTGGATCTGCGG - Intronic
1107105121 13:36634840-36634862 GTTTCATGAAGGTGCATGGGAGG + Intergenic
1107656650 13:42598491-42598513 TTGTCAGGCAGGTGGATGGGTGG - Intronic
1108416096 13:50199622-50199644 GAGTGTTGGAGATGGATGGTGGG - Intronic
1110082406 13:71331949-71331971 CAGTCATGGGGTTGGGTGGGGGG + Intergenic
1111302824 13:86367102-86367124 GGGTCATGGGGGTGGATCCGTGG + Intergenic
1111479794 13:88809894-88809916 CAGTGTTGGAGGTGGGTGGGAGG + Intergenic
1112388232 13:98959791-98959813 GAGACTTGGAGGTGGATCTGTGG + Intronic
1112581343 13:100678872-100678894 GTGTGATGGAGGAGGATAGGAGG - Intergenic
1113592703 13:111512303-111512325 GGGTCACGGAGCTGGAGGGGAGG - Intergenic
1113897318 13:113774085-113774107 AAGTGATGGAGTTGGGTGGGGGG - Intronic
1114042071 14:18688279-18688301 GATTGATGGAGGTGGGTGTGTGG - Intergenic
1114648725 14:24269957-24269979 GTTTCCTGGAGGTGGATGAGCGG - Exonic
1116799578 14:49429128-49429150 GAAGCATGGTGGGGGATGGGTGG - Intergenic
1117531067 14:56661220-56661242 GAGTCTAGGAGGAGGAGGGGTGG - Intronic
1118818334 14:69328250-69328272 GAGTGATGGTGGTTGATGGGTGG + Intronic
1119286705 14:73460716-73460738 GAGTCATTGAATTGAATGGGAGG - Intronic
1119571301 14:75675830-75675852 GAGACAGGGAGGGGGAAGGGAGG + Intronic
1120756755 14:88251866-88251888 GAGTCAAGGCCCTGGATGGGAGG - Intronic
1121011969 14:90525092-90525114 GAGACTTGGGGGTGGAGGGGGGG - Exonic
1121505142 14:94471659-94471681 GAGTCCAGTAGGTGGATGGATGG - Intronic
1121546631 14:94768166-94768188 GACTGATGGTGGTGGGTGGGTGG + Intergenic
1121835562 14:97088963-97088985 GAGTGATGGAGGTGGGTGTCAGG + Intergenic
1121894796 14:97636934-97636956 GAGAGATGGAGGTGGACGGAGGG - Intergenic
1122691317 14:103533269-103533291 AAGCCAGGGAGGTGGCTGGGAGG + Intronic
1122692540 14:103538090-103538112 AAGTCATGCAGGGGGGTGGGAGG + Intergenic
1202938464 14_KI270725v1_random:117094-117116 GAATTATGGAGATGGATGGTAGG - Intergenic
1123897369 15:24842034-24842056 GAGTTATGGATAAGGATGGGTGG - Intronic
1124347055 15:28930068-28930090 GAGTTGGGGAGGTGGAAGGGGGG + Intronic
1124348265 15:28936806-28936828 GAGACTTGGTGGGGGATGGGAGG + Intronic
1124798757 15:32809088-32809110 GAGTCATGGGGGTGGATGTGAGG + Intronic
1125520816 15:40346960-40346982 GATTCAGGCAGGGGGATGGGAGG + Intergenic
1125684399 15:41555198-41555220 GAGACATGTAGGTGGATGAGAGG - Intergenic
1126729931 15:51672340-51672362 GACTCATGGAGGGGGCGGGGTGG - Intergenic
1128446621 15:67767794-67767816 GAAAAACGGAGGTGGATGGGTGG - Intronic
1128464892 15:67902157-67902179 CATTCCTGGAGGTTGATGGGTGG - Intergenic
1128794682 15:70457050-70457072 AACTAATGGAGGAGGATGGGAGG - Intergenic
1129759133 15:78118764-78118786 GAGTTCTGGAGGTGGATCAGTGG - Intronic
1129890435 15:79068164-79068186 GAGGCTTGGAGGTGGGTGTGAGG + Intronic
1129901875 15:79157653-79157675 GAGTCAGTGGGGTGGAGGGGTGG + Intergenic
1131356495 15:91750371-91750393 CAGTGATGGTGGTGGAGGGGTGG + Intergenic
1131445596 15:92495914-92495936 TAATCATGGTGGTGTATGGGAGG + Intronic
1132776248 16:1596193-1596215 GAGGCTGGGAGGGGGATGGGGGG - Intronic
1133620637 16:7522983-7523005 GAGGCAAGGAGGAGGAGGGGAGG - Intronic
1133970541 16:10564685-10564707 GAATGGTGGTGGTGGATGGGAGG - Intronic
1133996597 16:10753168-10753190 GAGTCTTGGCGGGGGAGGGGCGG + Intronic
1134471579 16:14530999-14531021 GAGTCAAGGTGGGGGATGGATGG - Intronic
1135186046 16:20316849-20316871 GAGTGATGGAGGAGGAAAGGAGG - Intronic
1135357171 16:21779028-21779050 GAGTTCTGGAGATGGATGGTGGG + Intergenic
1135455675 16:22595144-22595166 GAGTTCTGGAGATGGATGGTGGG + Intergenic
1135791526 16:25401051-25401073 AAGTCAGAGAGGTAGATGGGTGG - Intergenic
1136133787 16:28241738-28241760 AAGTCATTGCGGTGGGTGGGGGG - Intergenic
1136137994 16:28269360-28269382 TAGTCATGGAGGTGGCTGCTTGG - Intergenic
1136172579 16:28497647-28497669 GAGCCATGGTGGAGGCTGGGGGG + Exonic
1136697094 16:32092082-32092104 GAGTTATGGAGATGGATGGTAGG + Intergenic
1136700827 16:32139213-32139235 GAATTATGGAGATGGATGGTAGG + Intergenic
1136766828 16:32788246-32788268 GAATTATGGAGATGGATGGTAGG - Intergenic
1136797593 16:33035373-33035395 GAGTTATGGAGATGGATGGTAGG + Intergenic
1136801267 16:33082132-33082154 GAATTATGGAGATGGATGGTAGG + Intergenic
1136939390 16:34507593-34507615 GAATTATGGAGATGGATGGTAGG + Intergenic
1136945087 16:34640112-34640134 GATTTATGGAGATGGATGGTAGG + Intergenic
1136948023 16:34679260-34679282 GAATTATGGAGATGGATGGTAGG + Intergenic
1136960431 16:34840968-34840990 GAATTATGGAGATGGATGGTAGG - Intergenic
1136967261 16:34928952-34928974 GAATTATGGAGATGGATGGTAGG + Intergenic
1137084991 16:36108780-36108802 GAGTTATGGAGATGGATGGTAGG + Intergenic
1137087876 16:36151063-36151085 GAATTATGGAGATGGATGGTAGG + Intergenic
1137219607 16:46435081-46435103 GAATTATGGAGATGGATGGTAGG + Intergenic
1137669222 16:50269617-50269639 GGGTCACAGAGGTGGCTGGGTGG + Intronic
1138663567 16:58542570-58542592 TATTAATGGAGGTGGGTGGGGGG + Intronic
1140483754 16:75277805-75277827 GAATCAGGGATGTGGATGGCCGG + Intergenic
1141110787 16:81269206-81269228 CAGACGTGGGGGTGGATGGGAGG - Intronic
1141575034 16:84958349-84958371 GGGTCATGGATGGGGGTGGGAGG - Intergenic
1142364309 16:89641922-89641944 GTGACATGGAGGTGGGTGAGGGG + Intergenic
1203069223 16_KI270728v1_random:1050498-1050520 GAATTATGGAGATGGATGGTAGG - Intergenic
1142470582 17:161257-161279 GAGTCAAGGGGGTGGAGGTGAGG - Intronic
1142476987 17:194440-194462 AATTCACGGAGGTGGAAGGGAGG + Intergenic
1142583967 17:959256-959278 GAGTCATGGAGGGGAAAGGAAGG - Intronic
1142712920 17:1733070-1733092 GAGTCAGGGAGGTGGACTGGCGG + Intronic
1142809041 17:2386776-2386798 GAGGCCTGGGGGTGGGTGGGGGG + Exonic
1143109416 17:4545001-4545023 GAGTGGGGGAGGTGGAGGGGGGG - Intronic
1143967949 17:10770371-10770393 GATTCATGGTTGCGGATGGGAGG - Intergenic
1143991172 17:10963513-10963535 AAGTTCTGGAGATGGATGGGTGG + Intergenic
1144028967 17:11302853-11302875 GAGTCATCCAGGTGGAGAGGAGG + Intronic
1144092269 17:11868795-11868817 GTGTCAGGGATGTGGATGGGGGG - Intronic
1145326609 17:21835725-21835747 GAGTTATGGAGATGGATGGTAGG - Intergenic
1145689585 17:26724895-26724917 GAGTTATGGAGATGGATGGTAGG - Intergenic
1145693451 17:26767168-26767190 GAGTTATGGAGATGGATGGTAGG - Intergenic
1145850860 17:28094638-28094660 TAGTCTTTGAGGTGGGTGGGTGG + Intronic
1145941707 17:28746193-28746215 GAGTCAGGTAGGTGGAAGGCAGG - Intronic
1146059038 17:29594857-29594879 GAAGCATGGAGGTGGAGGGCAGG + Intronic
1147119257 17:38326179-38326201 GAGTACTGTAGGTGGATGGGAGG + Exonic
1147254618 17:39174497-39174519 GAGGCATGGAGGTGGGGGGTGGG + Exonic
1147326528 17:39672357-39672379 GTGTCCTGGAGGAGGGTGGGGGG + Exonic
1147867094 17:43560194-43560216 TAGTCGGGGAGGTGGGTGGGAGG + Intronic
1147931025 17:43981400-43981422 TAGTCATTCTGGTGGATGGGTGG + Intronic
1148071998 17:44914007-44914029 AGGTCAGGGAGGTGGAGGGGAGG - Exonic
1148896302 17:50841058-50841080 GAGGCATTGGGGTGGATAGGTGG - Exonic
1150931407 17:69589594-69589616 GAGTCATGGAGGGATTTGGGGGG - Intergenic
1151307779 17:73274518-73274540 GAGTCCGGGAGGTGAATGGCGGG - Intergenic
1152731899 17:81976721-81976743 GAGCCATGGAGGTGGGGGGCGGG + Intergenic
1152888488 17:82866556-82866578 GTGTCATGGAGCAGGATTGGAGG + Intronic
1203190801 17_KI270729v1_random:186322-186344 GAGTTATGGAGATGGATGGTAGG - Intergenic
1154337510 18:13477376-13477398 GGGTCATGGAGGCAGCTGGGTGG - Intronic
1154516408 18:15171451-15171473 GAGTTATGGAGATGGATGGTAGG + Intergenic
1156765019 18:40642300-40642322 GAGGAATGGAGGTAGGTGGGTGG - Intergenic
1157496903 18:48162606-48162628 GAGTCTTGGAGTTAGATGTGGGG + Intronic
1157504133 18:48214223-48214245 AAGTTCTGGAGGTGGATGGTGGG - Intronic
1157600286 18:48889377-48889399 GAGTCCTGGAGGGGGTTGGGAGG + Intergenic
1157714453 18:49873803-49873825 GAGAAAGGGAGGTGGCTGGGTGG + Intronic
1157731310 18:50006749-50006771 GAGTGATGCAGGTGGCTGGCAGG + Intronic
1159010940 18:63058028-63058050 GAGTCCTGCTGGTGGATGTGGGG + Intergenic
1160379267 18:78439118-78439140 GAGTCAAGGAAGTGGAACGGGGG + Intergenic
1161719689 19:5895972-5895994 GAGTCAGAGAGGAGGATGGATGG - Intronic
1162132651 19:8536642-8536664 CAGTCCTGGGGGTGGGTGGGAGG + Intronic
1162523592 19:11195299-11195321 AAGTCCTGGGGGTGGAGGGGAGG + Intronic
1163053381 19:14701548-14701570 GAGACATGGAGGTGGAGGATGGG - Intronic
1163290861 19:16378143-16378165 GAGACAGGGAGGCGGGTGGGTGG + Intronic
1163383218 19:16982312-16982334 GAGCCAGGGAGGTCGATGTGCGG + Intronic
1163447168 19:17353494-17353516 GAGTGATGGAGGGGAACGGGAGG - Intronic
1164401604 19:27905748-27905770 GACTCATGTGGGTGCATGGGTGG - Intergenic
1164917492 19:32063694-32063716 GAGTGATGGAGAAGGATGAGCGG - Intergenic
1164920535 19:32085402-32085424 GATGGATGGATGTGGATGGGTGG + Intergenic
1165752067 19:38266214-38266236 GAGGACTGGAGGAGGATGGGAGG + Intronic
1165941087 19:39415129-39415151 GAGAGATGTAGGCGGATGGGAGG - Exonic
1166378662 19:42343413-42343435 GAGCCATGGAGGTGGTGGAGGGG + Intronic
1166889257 19:45980386-45980408 GAGCCATGGGGGTGGGGGGGTGG + Intergenic
1167103288 19:47416997-47417019 GAGGCTGGGAGGTGGATGGAGGG + Intronic
1167963384 19:53124949-53124971 GAGTAACGGAGCTGGATGTGGGG + Intronic
1202669025 1_KI270709v1_random:32761-32783 GAGTTATGGAGATGGATGGTAGG - Intergenic
925304606 2:2839345-2839367 GAATCATGAGGGTGGATGGATGG + Intergenic
925371569 2:3349335-3349357 GAGTCGGGGAGGTGGGTGAGTGG - Intronic
925411658 2:3643183-3643205 GAGAAATGGAGGTGCAGGGGTGG - Intronic
925485364 2:4322919-4322941 GAGGTAAGGTGGTGGATGGGTGG - Intergenic
926240479 2:11081157-11081179 GAGGCATGGAGGGGGGAGGGAGG - Intergenic
927197702 2:20559553-20559575 GATGAATGGAGGTGGATGGGTGG + Intergenic
927664209 2:25018579-25018601 GGGTGTTGGAGGTGGGTGGGGGG - Intergenic
931135826 2:59399473-59399495 CAGACATGGGGTTGGATGGGAGG - Intergenic
932776004 2:74528870-74528892 GCTTCATGGAGATGAATGGGCGG - Exonic
933143120 2:78817982-78818004 GAGTCAGGGAGGTTGAAGGTTGG - Intergenic
933236207 2:79867403-79867425 GAGAGATGGAGATGGATGGATGG - Intronic
933729730 2:85447483-85447505 GAGTCATGAAGGTGGGTGCGTGG - Intergenic
933748216 2:85585754-85585776 GAGGCTAGGAGATGGATGGGTGG - Intronic
934252262 2:90367106-90367128 GAGTTATGGAGATGGATGGTAGG + Intergenic
934257180 2:91435839-91435861 GAGTTATGGAGATGGATGGTAGG - Intergenic
934330827 2:92066423-92066445 GAATTATGGAGATGGATGGTAGG - Intergenic
934948557 2:98560399-98560421 GACTCATGGGGCTGTATGGGTGG - Intronic
935127972 2:100240641-100240663 GGGCCATGGTGGAGGATGGGAGG - Intergenic
935212633 2:100951734-100951756 GAGTCCTTGAGGTGGATGGTGGG + Intronic
936166107 2:110120902-110120924 GAGTCATGGTGGTGGGGGGCGGG - Intergenic
936371533 2:111905869-111905891 GAGTCTTGGAGGTGGCAGGCAGG + Intronic
937339327 2:121081146-121081168 AAGTCTTGGTGGTGGGTGGGTGG + Intergenic
937342598 2:121100855-121100877 GAGTCATGGTGGCAGCTGGGTGG + Intergenic
938032851 2:128010215-128010237 GAGTGAAGGAGGAGGATGGCAGG + Intronic
938268146 2:129944252-129944274 GATTGATGGAGGTGTGTGGGCGG + Intergenic
938516731 2:132016445-132016467 GAGTTATGGAGATGGATGGTAGG + Intergenic
938801044 2:134763542-134763564 GAGTCATGAAGGCAGATGAGTGG - Intergenic
939628650 2:144509357-144509379 GGGTCATGGGGGTGGATAGGAGG + Intronic
940267877 2:151859238-151859260 GAGTCAGTGGGGTGGATGGGGGG - Intronic
940886652 2:158995664-158995686 GAGGCAGGGAGGAGGAAGGGAGG - Intronic
941192301 2:162400286-162400308 GTCTCCTGGAGGTGCATGGGTGG + Exonic
941754119 2:169166410-169166432 GAGTCAGAGAGGAGGATGGCAGG + Intronic
942297947 2:174535357-174535379 GAGACATGCAGATGGATGGTGGG + Intergenic
942657179 2:178226118-178226140 TAGTCATGGAGGAGGAAGTGTGG + Intronic
943185927 2:184607584-184607606 GTGTCATGGGGGTGGAAGGGGGG - Intronic
943309124 2:186304780-186304802 GAGTCATGGAGATGTATGATTGG - Intergenic
945616333 2:212073092-212073114 GAGGCCTGGAGGTGGAAGGAAGG + Intronic
945816602 2:214612438-214612460 GAGCCTTGGAGAAGGATGGGTGG + Intergenic
946262650 2:218507680-218507702 GAATGATGGAGGTGGAGGGAGGG + Intronic
948028939 2:234800747-234800769 AAGTAAGGGAGGTGGATGGGAGG - Intergenic
948683256 2:239652252-239652274 GGGTCAGGGATGGGGATGGGTGG + Intergenic
948761986 2:240198045-240198067 CAGTGATGGACGTTGATGGGCGG - Intergenic
948762058 2:240198435-240198457 CAGTGATGGACGTTGATGGGCGG - Intergenic
949000528 2:241610409-241610431 GAGTCAGGGCGGAGGCTGGGCGG + Intronic
1169040775 20:2493620-2493642 GCGTCATGGTGGGGGGTGGGGGG - Intronic
1169248725 20:4044464-4044486 TAGTCCTGGTGGTGGATGGAAGG + Intergenic
1170520164 20:17177184-17177206 CAGGCATGGAGGTGGATGTAAGG - Intergenic
1170559113 20:17540644-17540666 GAGGCATGGAGAAGGATGGAGGG - Intronic
1172636855 20:36415845-36415867 GAGGCCTGGAGATGGAGGGGAGG + Intronic
1172694926 20:36815974-36815996 GGATCATGGAGGTGGCTGTGGGG - Exonic
1173194071 20:40899609-40899631 GAGTCAGGGGGGTGGGAGGGAGG - Intergenic
1173582672 20:44158740-44158762 GAGTGATAGAGGTGGCTGGCTGG + Intronic
1173800915 20:45893889-45893911 GGGTCAGGGAGGTTGGTGGGAGG + Intronic
1174485403 20:50857968-50857990 TGGGCATGGAGGTGGATGGAAGG - Intronic
1175489912 20:59372965-59372987 GTGTCAAGTAGGAGGATGGGGGG - Intergenic
1175505215 20:59478572-59478594 AAGTTCTGGAGGTGGATGGTGGG - Intergenic
1175514810 20:59562264-59562286 AAGTTCTGGAGGTGGATGGTGGG + Intergenic
1175698151 20:61117857-61117879 GAGTCATGCAGGGGCCTGGGTGG - Intergenic
1176584849 21:8572042-8572064 GAATTATGGAGATGGATGGTAGG + Intergenic
1176968027 21:15233597-15233619 AAATCATGGGGGTGGAGGGGAGG + Intergenic
1177459294 21:21389350-21389372 GTGTCATGGAAGGGGATTGGTGG - Intronic
1177804459 21:25860430-25860452 GAGAGGTGGAGGTGGAGGGGTGG - Intergenic
1178211773 21:30542923-30542945 GAGTGATGGAGGAGTAGGGGTGG - Intronic
1178360440 21:31944635-31944657 GAGTCAAGGAGGAGAAGGGGAGG + Intronic
1178374484 21:32055582-32055604 AAGTCATGGAGGTCGCTGAGAGG - Intergenic
1178431263 21:32520584-32520606 GACTCATGGAGAAGGCTGGGGGG - Intergenic
1178850505 21:36208800-36208822 GAGGCAGGGAGGCGGATGGACGG - Exonic
1179920659 21:44505490-44505512 GCGTTCTGGAGGTGGATGGTGGG - Intronic
1180033171 21:45226024-45226046 GACTGGTGGAGGTGGATGGCAGG + Exonic
1180121198 21:45749508-45749530 GAGTCAGGGAGAGGGAGGGGTGG + Intronic
1180237819 21:46474923-46474945 AAGTTGTGGAGGAGGATGGGAGG + Intronic
1180267660 22:10548944-10548966 GAATTATGGAGATGGATGGTAGG + Intergenic
1181290291 22:21786911-21786933 CAGCCATGGGGGTGGGTGGGGGG + Intronic
1181478846 22:23184910-23184932 CACTCATGGGGGTGGGTGGGGGG + Intronic
1182003009 22:26936494-26936516 GAGGAATGGAGGAGGATGAGGGG - Intergenic
1182044360 22:27262663-27262685 AAGTCACGGAGGGGGCTGGGAGG + Intergenic
1182676356 22:32042652-32042674 GAGTCAGGAATGTGGGTGGGTGG + Intergenic
1182868763 22:33627730-33627752 GGGTCATGGATGTGGATTGGAGG - Intronic
1183219726 22:36504842-36504864 GAGCCAGGCAGGTGGGTGGGTGG - Intronic
1183375764 22:37464172-37464194 GGGTCAGGGAGGTGGAAGTGGGG - Intergenic
1183466986 22:37984759-37984781 TAGTCTGGGAGGTGGAGGGGAGG + Intronic
1184744746 22:46449744-46449766 CTGGCATGGAGGTGGAGGGGAGG + Intronic
1184764566 22:46564720-46564742 CAGTCCTGGAGATGGATGGTGGG + Intergenic
1185229931 22:49673948-49673970 GAGCCATGGAGGGGGACAGGAGG + Intergenic
1203325614 22_KI270738v1_random:12588-12610 GAGTTATGGAGATGGATGGTAGG + Intergenic
949492626 3:4604302-4604324 GAGTTGTGGAGGTGGAAGGGAGG + Intronic
950044906 3:9943323-9943345 GAGTCAGGGTGCTGGGTGGGGGG + Intronic
950449751 3:13058965-13058987 GGGTGCAGGAGGTGGATGGGGGG + Intronic
950653275 3:14421096-14421118 GGGGCATGGAGATGGAGGGGTGG + Intronic
951034867 3:17921749-17921771 GACTAATGCAGGTGGATTGGGGG + Intronic
951788531 3:26452535-26452557 GACTCATGGAGATCGATGTGGGG + Intergenic
952632963 3:35491778-35491800 TAGTTTTGGAGGTGGGTGGGTGG - Intergenic
953367040 3:42353959-42353981 GGAACATGGAGGTGGGTGGGAGG - Intergenic
953536859 3:43783216-43783238 GAGTCAAGGAGTGGGAGGGGAGG + Intergenic
953660556 3:44888523-44888545 GAGTCTGGGATCTGGATGGGAGG - Intronic
953885465 3:46712364-46712386 GAGACCTGTAGGTAGATGGGTGG + Exonic
953926922 3:46987357-46987379 GAGTCAGAGAGGTGGACAGGGGG - Intronic
954441163 3:50522877-50522899 GAGTCAGGGTTGTGGATTGGGGG + Intergenic
954996153 3:54883712-54883734 GAGTCATGTAGGTGGCAGGAAGG - Intronic
956179635 3:66505041-66505063 TTGTCAAGGAGATGGATGGGTGG + Intergenic
957464102 3:80563521-80563543 GAGTTTGGGAGGTGGATGAGGGG + Intergenic
957483215 3:80826092-80826114 GAGCGAAGGAGATGGATGGGTGG + Intergenic
958430460 3:94033955-94033977 GAGTCATGGGGGTGGTAGTGGGG + Intronic
958480906 3:94644175-94644197 GGGTCATTATGGTGGATGGGTGG - Intergenic
960576306 3:119233235-119233257 GAATGAGGGAGGTGGATGTGTGG - Intronic
960580416 3:119273488-119273510 GAGACATGGGGGTGAAAGGGAGG + Intergenic
960934622 3:122890465-122890487 GAGTTGTGGAGGTGGAGGTGGGG + Intergenic
961006921 3:123411651-123411673 GAGTCCTGGGGTTGGATTGGGGG - Intronic
961138514 3:124535139-124535161 TAGTAAATGAGGTGGATGGGGGG + Intronic
961410256 3:126715278-126715300 GAGTCAGGGAGGTGGAACGTGGG - Intronic
961471064 3:127113083-127113105 GAGTCATGGAGGTTGGAGGATGG - Intergenic
961551949 3:127674408-127674430 GAGACGTGGAGGTGAATGTGCGG + Exonic
961584396 3:127910230-127910252 GAGACCTGGAGGTGGAGGGGAGG + Intergenic
961697889 3:128718759-128718781 CAGTGATGGAGGTGGAAGTGAGG - Intergenic
961737891 3:129013820-129013842 TAGTCAGGGGGCTGGATGGGGGG + Intronic
962025647 3:131544635-131544657 AAGTGATGGAGGTGGTAGGGAGG + Intronic
962390740 3:134970457-134970479 AAGCCATGGAGGGAGATGGGAGG - Intronic
962951359 3:140222326-140222348 GAGGGATGGGGGTGGAAGGGAGG + Intronic
964102005 3:152998168-152998190 CTGTCATGGAGTTGAATGGGGGG + Intergenic
964719581 3:159757795-159757817 GAGGCATGGAGGTAGCTTGGTGG - Intronic
966696360 3:182793797-182793819 GACGAATGGAGGTGGAGGGGCGG - Intronic
969523159 4:7690548-7690570 GATGGATGGCGGTGGATGGGTGG + Intronic
970820650 4:20208058-20208080 GTGATATGGAAGTGGATGGGTGG - Intergenic
970960137 4:21861957-21861979 GAGGCTTGGAGGAGGGTGGGAGG - Intronic
973532382 4:51845325-51845347 GAGTGATGGAGGTGGGTTAGTGG + Intronic
974391766 4:61279750-61279772 GGGGCATGGCGGTGGATGAGGGG - Intronic
974497418 4:62650539-62650561 GAATCATGGCGGGGGTTGGGGGG - Intergenic
975395256 4:73868107-73868129 GAGACATGGAGTAAGATGGGAGG - Intergenic
975578860 4:75889294-75889316 GAGTAATGGAGGTGAGGGGGTGG - Intronic
977323266 4:95546938-95546960 GAGCCATGGGGGTGGGTGGCGGG - Intronic
977937858 4:102827182-102827204 GCGTGGTGGAGGTGGCTGGGCGG - Intronic
978324390 4:107535578-107535600 GTGTCTTGGAGGTGGAGGAGAGG - Intergenic
978453271 4:108860231-108860253 TGGTCATGGTGGTGCATGGGAGG - Intronic
980158524 4:129133795-129133817 GAGTCATGGAGGTGGAGACCAGG + Intergenic
981065384 4:140478262-140478284 GAGACATGGTGGTGTTTGGGTGG - Intronic
981511029 4:145558586-145558608 GAGTATTTGAGGTGGGTGGGGGG + Intergenic
982233841 4:153233658-153233680 GAGGCGTGGAGGTGGTAGGGAGG + Intronic
982611305 4:157576873-157576895 GAGTGAACGAGGTGGGTGGGTGG + Intergenic
983065193 4:163201744-163201766 GAGTTATTGAGGTGGAAGAGGGG - Intergenic
983302298 4:165942297-165942319 GAGTCTTGGCGGAGGATGGAGGG - Intronic
983319512 4:166178129-166178151 GAGTAAGGGAGGTGGAGAGGTGG - Intergenic
983501880 4:168508785-168508807 GAGACATGAAGGTGGAGAGGGGG - Intronic
983649059 4:170020631-170020653 CAGTCAGGGAGGGGAATGGGAGG - Intronic
983717675 4:170805286-170805308 CTCTCATTGAGGTGGATGGGAGG - Intergenic
984168962 4:176338287-176338309 GAGTCAAGGGGAAGGATGGGGGG + Intergenic
984519013 4:180778060-180778082 GAGTTGTGGAGATGGATAGGAGG - Intergenic
984959471 4:185081589-185081611 GAGGCAGGGTGGAGGATGGGGGG - Intergenic
986160058 5:5219380-5219402 GTGTAGTGGAGGGGGATGGGAGG - Intronic
986967046 5:13286441-13286463 GAATCATGGGGGTGGTGGGGGGG + Intergenic
988814392 5:34819433-34819455 CAGTCATGGAGGTGGCATGGTGG - Intronic
989076419 5:37568147-37568169 GAGCCAGGTGGGTGGATGGGTGG - Intronic
989142069 5:38211220-38211242 CATTCATGGAGGTGACTGGGGGG + Intergenic
989151230 5:38301693-38301715 GGGTCATGGAGCTTGAAGGGGGG + Intronic
990825212 5:59892168-59892190 CAGGCGTGGAGGTGGATGTGGGG - Intronic
996116545 5:119626737-119626759 GAGTCAAGAAGGAGGATGAGAGG - Intronic
996556871 5:124787114-124787136 AAGTAATGGAGATGGATGGATGG + Intergenic
998179569 5:139927070-139927092 GAGTCCTGGGGGTGGGTGGCTGG - Intronic
999080418 5:148838343-148838365 CAGTCTTGGAGGTGGAGTGGTGG + Intergenic
999361288 5:150988705-150988727 GTATCAAGGAGGTGGAGGGGCGG + Intergenic
999731667 5:154480013-154480035 GGGCCCTGGAGGTGCATGGGGGG + Intergenic
1000197474 5:158973382-158973404 AAGTCATGTAGGTGAAGGGGTGG - Intronic
1000516615 5:162243215-162243237 GAGTCAGGAAGGTGGCTCGGTGG + Intergenic
1001019612 5:168172097-168172119 GAGTCATGGTGGTGGGGAGGTGG + Intronic
1002358573 5:178651235-178651257 CAGTCATGGGGGTGGATGGAGGG + Intergenic
1002542816 5:179917354-179917376 GAGGCAGGGGGGTGGATGTGTGG + Intronic
1002988729 6:2217769-2217791 GAGGCTTGGAGGGGAATGGGAGG - Intronic
1003144497 6:3498562-3498584 GAGACATGGAGGGGGTTGTGGGG - Intergenic
1003454750 6:6271389-6271411 CAGTCATGGATGTTGATGGATGG - Intronic
1004318153 6:14609756-14609778 GAGTCAGGGAGGTGGGTGGGTGG + Intergenic
1006147835 6:31969891-31969913 GAGTCTTGGGGGGTGATGGGAGG + Exonic
1006311544 6:33264535-33264557 GAATGTTGGAGGGGGATGGGAGG + Intronic
1006785694 6:36665510-36665532 TCGTGATGTAGGTGGATGGGCGG + Intergenic
1007289869 6:40777591-40777613 GAGTCAGGGAGGTGGAAGTGGGG - Intergenic
1008618903 6:53252716-53252738 GGGTAATGGAGCTGGATGAGGGG + Intergenic
1008869771 6:56259347-56259369 GAGTCAGAGAGATGGATGGAAGG - Intronic
1010128632 6:72465222-72465244 GAGTCATGGTGGTTCAAGGGAGG - Intergenic
1010890826 6:81308462-81308484 GAGACATTGAGGTGGTTGGGGGG - Intergenic
1011168485 6:84478638-84478660 GAATCATGATGGTAGATGGGAGG + Intergenic
1011238670 6:85246822-85246844 GAGTACTGGAGGGGGAAGGGAGG - Intergenic
1013630722 6:111983496-111983518 GAGTCAAGGAGGGGGATATGTGG + Intergenic
1014694024 6:124596254-124596276 CAGTGCTGGAGGTGGATGTGAGG + Intronic
1015865688 6:137724214-137724236 AAGTCCTGGAGGTGAATGTGGGG + Intergenic
1016459757 6:144270125-144270147 GAGGCAAGGAGGGGGGTGGGGGG - Intergenic
1016494363 6:144643250-144643272 GAGTCATGGAAGTTGGTAGGGGG + Intronic
1017725287 6:157272720-157272742 GAGGCATGGAGTTGGTGGGGGGG + Intergenic
1019160737 6:170065944-170065966 GAGGGATGGGGGTGGATGGAGGG - Intergenic
1019160941 6:170066540-170066562 GAGGGATGGGGGTGGATGGAGGG - Intergenic
1019160949 6:170066558-170066580 GAGGGATGGGGGTGGATGGAGGG - Intergenic
1019710132 7:2514430-2514452 GAGGCATGCGGGTGGCTGGGAGG - Intronic
1019871919 7:3771841-3771863 GAGTTCTGGAGATGGATGGGGGG - Intronic
1019879002 7:3841995-3842017 CAGCCATGGAGGTGGAGGAGAGG - Intronic
1021555633 7:21915194-21915216 GAGTCAAGGAGATGGAAGAGGGG + Intronic
1022795351 7:33727433-33727455 GAGTGAAGGAGGGGGGTGGGGGG + Intronic
1023291793 7:38675851-38675873 GAGTGGTGGAGGCTGATGGGTGG - Intergenic
1024807146 7:53155882-53155904 GAGTTATGGAGATGGATGGTAGG + Intergenic
1025003095 7:55334308-55334330 GAGTTGTTGAGGGGGATGGGCGG + Intergenic
1025213605 7:57036320-57036342 GCTTTATGGAGATGGATGGGTGG + Intergenic
1025319542 7:58080308-58080330 GAGTTATGGAGATGGATGGTAGG - Intergenic
1025483382 7:61014921-61014943 GAATTATGGAGATGGATGGTAGG + Intergenic
1025564705 7:62419293-62419315 GAATTATGGAGATGGATGGTAGG + Intergenic
1025658348 7:63540503-63540525 GCTTTATGGAGATGGATGGGTGG - Intergenic
1025995329 7:66524079-66524101 TGGACATGGAGGTGGATGGGTGG - Intergenic
1026832505 7:73618710-73618732 GAGACATGGAGGTGGGGGTGGGG + Intronic
1027246842 7:76373425-76373447 GAGTCATGGAGGAGGATAGGAGG + Intergenic
1027651652 7:80875608-80875630 GTGTGATGGAGTTGGATGGAGGG - Intronic
1028097863 7:86784704-86784726 GGGGAATGGAGGTGAATGGGTGG - Intronic
1028343970 7:89757768-89757790 GATTCTTGGAGGTGGTTGGGTGG - Intergenic
1029693906 7:102200942-102200964 GAGCCAGGGAGGTGGAGGGTGGG + Intronic
1030675734 7:112383821-112383843 GGGTCATGGAGGTGGGTTAGGGG + Intergenic
1030756517 7:113293129-113293151 TAGTCATTAAGGTGGATGTGTGG + Intergenic
1031995323 7:128226729-128226751 GAAGGATGGAGATGGATGGGAGG - Intergenic
1032435919 7:131900225-131900247 GTGTCATGGAAGTGGCTTGGTGG + Intergenic
1032694842 7:134326149-134326171 GAGTTCTGGAGCTGGATGGTGGG - Intergenic
1032801320 7:135319360-135319382 GAGACATGGTGGTGGGTGCGGGG - Intergenic
1033149207 7:138898547-138898569 GAGTCATGCAGGAAGCTGGGAGG - Intronic
1033550015 7:142438539-142438561 GAGTCAGGGAGCTGGGTTGGAGG + Intergenic
1034978610 7:155461796-155461818 GAGTCATAGAGGAGCTTGGGTGG + Intronic
1036690767 8:10943438-10943460 GAGCCATGGATGTGGCTGGAGGG - Intronic
1037096514 8:14992953-14992975 GATTGAAGGAGGAGGATGGGTGG - Intronic
1037308927 8:17534881-17534903 GAGTCAAGGAAGAGGATGAGTGG - Intronic
1037712389 8:21365303-21365325 GAAGGGTGGAGGTGGATGGGAGG - Intergenic
1038003112 8:23407193-23407215 GAGTGGTGGAGGTGGCAGGGTGG - Intronic
1038579586 8:28736055-28736077 GAGTTCTGGAGATGGATGGCAGG + Intronic
1039588902 8:38730192-38730214 CATTCAAGGAGGCGGATGGGAGG - Intronic
1040783860 8:51141975-51141997 TAATCTTGGAGGTGGAGGGGTGG + Intergenic
1041748120 8:61231542-61231564 GTGCCAGGGAGGTGGGTGGGAGG - Intronic
1042028098 8:64445291-64445313 GAGAAAGGGAGGAGGATGGGAGG - Intergenic
1042223303 8:66494451-66494473 GAGTCATGGAGGTGGATGGGAGG - Intronic
1043398915 8:79864822-79864844 GAGTAATGGAGCTGGCAGGGTGG - Intergenic
1043732047 8:83694679-83694701 GAATCACAGAGGTGGCTGGGAGG + Intergenic
1044118795 8:88367920-88367942 GAAACATGGAGGGGGTTGGGGGG - Intergenic
1044120905 8:88393744-88393766 GAGTCCTTGAGGTGGTTGAGTGG - Intergenic
1044839583 8:96326528-96326550 GCGACATGCAGGTGGCTGGGGGG + Intronic
1045090210 8:98734141-98734163 GGATCATGGAGGTGGATTGGAGG - Intronic
1046611654 8:116432494-116432516 GAGTCTTGGTAGGGGATGGGAGG - Intergenic
1047310128 8:123684976-123684998 GAATCATGGACGTGGCCGGGAGG - Intronic
1048340027 8:133531552-133531574 GGGTCAGGGAGGTGGCAGGGAGG - Intronic
1048450415 8:134528666-134528688 GAGTCATTGAAGTGTAAGGGTGG - Intronic
1049942853 9:565216-565238 TAGTCAGGGAGTTGAATGGGTGG - Intronic
1050423038 9:5486949-5486971 GGGTCAAGGAAGTGGATGTGTGG + Intergenic
1050425954 9:5512805-5512827 GAGCCATGGGGGAGGAAGGGTGG - Intronic
1051359519 9:16269576-16269598 CAGTCATGGAGGTGAGAGGGAGG - Intronic
1053003331 9:34589755-34589777 GAGGGAGGGAGGAGGATGGGGGG - Intronic
1053945437 9:43304492-43304514 GAATTATGGAGATGGATGGTAGG - Intergenic
1054442681 9:65281716-65281738 GAATTATGGAGATGGATGGTAGG - Intergenic
1054472440 9:65549117-65549139 GAGTTGTGGGGGAGGATGGGTGG + Intergenic
1054487598 9:65739785-65739807 GAATTATGGAGATGGATGGTAGG + Intergenic
1054703975 9:68444248-68444270 GAGACTTGCAGTTGGATGGGTGG - Intronic
1054762843 9:69018669-69018691 GAGTCAAGGAGGGGGATTGTGGG + Intergenic
1055002302 9:71465647-71465669 GAGTCATGGAGGCAGTTGGTGGG + Intergenic
1059334269 9:113558973-113558995 GAGGCTTGGAGGTGGTGGGGGGG + Intronic
1059335702 9:113567234-113567256 AAGACATGGAGGGGGAGGGGAGG - Intronic
1059376727 9:113887711-113887733 GAGACCTGGAGGTGGGTGAGCGG + Intronic
1060088322 9:120721201-120721223 GAGTCATTGACGTTGATGGTAGG - Intergenic
1060253042 9:122001508-122001530 GAATCATGAAGGGGGAAGGGGGG + Intronic
1060633001 9:125176681-125176703 GATTGATGGTGGTGGAGGGGTGG + Intronic
1060734911 9:126060627-126060649 GAGCCAGGGAGGTGGGAGGGTGG + Intergenic
1061134074 9:128723460-128723482 GGGAAATGGAGGTGGGTGGGTGG + Intronic
1061478252 9:130883609-130883631 GAGTGATGTGGGTGGGTGGGGGG - Intronic
1061942589 9:133891517-133891539 GAGGCATGGAGGGGGAAGGATGG + Intronic
1061942699 9:133891809-133891831 GAGGGATGGAGGGGGATGGAGGG + Intronic
1061981171 9:134104381-134104403 GATGGATGGAGGTGGATGGATGG - Intergenic
1062665018 9:137665830-137665852 GAGGCCTGGAGGTGCCTGGGCGG + Intronic
1203588572 Un_KI270747v1:33070-33092 GAATTATGGAGATGGATGGTAGG - Intergenic
1203614756 Un_KI270749v1:49561-49583 GAATTATGGAGATGGATGGTAGG + Intergenic
1185484721 X:473682-473704 GAGTCATGGAGATGGAGAGGAGG - Intergenic
1185763940 X:2709098-2709120 GGGTGATGGAGGAGGATGGGAGG + Intronic
1185922716 X:4112154-4112176 GAGTCATGGAGGTGGATCCCTGG - Intergenic
1185954156 X:4470850-4470872 GTGTCATTGTGGGGGATGGGGGG + Intergenic
1186200812 X:7153413-7153435 GAGTCAAGGAGGAGGACAGGAGG - Intergenic
1186765773 X:12769220-12769242 AAGTCATGGAGGAGTATGTGAGG + Intergenic
1186993646 X:15096211-15096233 AAGTAATGGAGATGGAGGGGTGG - Intergenic
1187128681 X:16479919-16479941 TATTCATGGAGTTAGATGGGTGG + Intergenic
1187214380 X:17262296-17262318 GAGATATGGAGATGGGTGGGAGG - Intergenic
1187294343 X:17984495-17984517 GAGCCCTGGAGTTGGAGGGGTGG - Intergenic
1187486363 X:19707885-19707907 AAGCCAGGGAGGTGGATGGGAGG + Intronic
1187601985 X:20841583-20841605 GAGGTGTGGAGGTGGATGGGAGG + Intergenic
1187718081 X:22123621-22123643 GAGTGAGGGAGGTGCCTGGGGGG + Intronic
1189302228 X:39960352-39960374 GAGGGATGAAGGTGGAAGGGTGG - Intergenic
1190712502 X:53080924-53080946 GAGGCATGGTGGTGGAGGGCTGG - Intergenic
1190736200 X:53257078-53257100 GAGGCATGGAGGAGGCTGTGGGG + Intronic
1191216932 X:57942287-57942309 GCGTGAAGGAGGAGGATGGGAGG - Intergenic
1196193728 X:112819151-112819173 CAGTCATCGAGGTGGCAGGGTGG - Intronic
1196631674 X:117948051-117948073 GAATCATGGGGGTGGAAGGAGGG - Intronic
1197526313 X:127568758-127568780 GGGTAATGGAGGAGTATGGGAGG - Intergenic
1197689086 X:129477787-129477809 AAGGCAGGGAGGTGGGTGGGTGG - Intronic
1198934834 X:141895087-141895109 GGGTCAGGGAGGAGGGTGGGAGG + Intronic
1199425497 X:147696474-147696496 GAGTCTAAGAGGTGGAAGGGTGG + Intergenic
1199675963 X:150189657-150189679 AAGGCATGGAAGTGGCTGGGAGG - Intergenic