ID: 1042223304

View in Genome Browser
Species Human (GRCh38)
Location 8:66494454-66494476
Sequence CCTGAGTCATGGAGGTGGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 243
Summary {0: 1, 1: 0, 2: 5, 3: 13, 4: 224}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042223304_1042223314 17 Left 1042223304 8:66494454-66494476 CCCATCCACCTCCATGACTCAGG 0: 1
1: 0
2: 5
3: 13
4: 224
Right 1042223314 8:66494494-66494516 TTGTCAGCCTTGAATGAAGTAGG No data
1042223304_1042223316 22 Left 1042223304 8:66494454-66494476 CCCATCCACCTCCATGACTCAGG 0: 1
1: 0
2: 5
3: 13
4: 224
Right 1042223316 8:66494499-66494521 AGCCTTGAATGAAGTAGGCTGGG No data
1042223304_1042223315 21 Left 1042223304 8:66494454-66494476 CCCATCCACCTCCATGACTCAGG 0: 1
1: 0
2: 5
3: 13
4: 224
Right 1042223315 8:66494498-66494520 CAGCCTTGAATGAAGTAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042223304 Original CRISPR CCTGAGTCATGGAGGTGGAT GGG (reversed) Intronic
902759504 1:18571979-18572001 CTTGACTCAAGGATGTGGATGGG - Intergenic
904540610 1:31230418-31230440 CCAGAGACAAGGAGGTGGACTGG - Intronic
905172038 1:36115201-36115223 CCTGAGGCCTGGGGGTGGCTGGG - Intronic
906107324 1:43302600-43302622 TCAGAGGCATGGAGGTGCATGGG + Intronic
906115199 1:43352169-43352191 ACTGAGCCATGGCAGTGGATTGG - Intronic
906472850 1:46145634-46145656 TTTGGGTCATGGAGGAGGATGGG - Intronic
907189689 1:52638202-52638224 CCAGAGTCAGGGAAGAGGATGGG + Intronic
907405973 1:54253736-54253758 CCCAGGACATGGAGGTGGATGGG + Intronic
908431272 1:64060866-64060888 GTTGAGTGATGGGGGTGGATTGG - Intronic
909131045 1:71737982-71738004 CCTTAGTTATGCAGATGGATAGG - Intronic
910598534 1:89005598-89005620 CCTGAGTCATGCAGGTTGTCAGG + Intergenic
913474962 1:119228173-119228195 TCTGAGACATGGAGGTGTTTGGG + Intergenic
915145169 1:153792638-153792660 CCTGAGTCATGGCGGTGGCCTGG - Intergenic
915970655 1:160352865-160352887 CCTGAGAGATGGAGGTAGGTGGG - Exonic
917057903 1:171003992-171004014 GCTGAGTCATGCAGGTGGTCAGG + Intronic
918158345 1:181872656-181872678 GCTGAGTCATGCAGGTTGTTAGG - Intergenic
919259539 1:195174278-195174300 CCTGAGTCATAGAGCTGCAAGGG - Intergenic
919429837 1:197479007-197479029 CTTGAGTAATTGAGATGGATGGG - Intergenic
919517058 1:198538819-198538841 CCTGAGAGATGGAGGTGGCAAGG + Intronic
920988717 1:210915251-210915273 TCTGGGTGATGGAGGTGGATAGG - Intronic
921046958 1:211484706-211484728 TCTGACACATGGAGGTGGGTTGG + Intronic
922206950 1:223456358-223456380 CCTGTGTGGTGGGGGTGGATGGG - Intergenic
922657892 1:227401891-227401913 TCTGAATCATGCAGGTTGATAGG - Intergenic
922737891 1:227999159-227999181 CCTGGGTGATGGGGGTGGACAGG + Intergenic
1063114355 10:3063663-3063685 CCCGAGGCATGGAGGTGGGGTGG + Intergenic
1063210738 10:3878858-3878880 CCTGGGTAAAGGAGGTGGATCGG - Intergenic
1064908157 10:20370276-20370298 GCTGAGTCATGCAGGTTGTTAGG + Intergenic
1067764439 10:49074623-49074645 CCTGGCTCCTGGAGGTGCATGGG + Intronic
1068537366 10:58255280-58255302 CCTGTGACATGGAGCTGGAGTGG + Intronic
1068861868 10:61855660-61855682 CCTGAGGAAAGGAGGTGGGTAGG + Intergenic
1070771276 10:79083785-79083807 CCTGTTTCACGGAGGTGGACAGG - Intronic
1076531349 10:131147397-131147419 CCTGCGGCATGGAGGTGCACGGG + Intronic
1076785930 10:132749945-132749967 ACTGAGTCCTGGAGGTGGCAGGG - Intronic
1079791735 11:24747806-24747828 GCTGAGTCATGCAGGTTGTTGGG + Intronic
1079932702 11:26585011-26585033 CATGACTCATGGAGGTGAAAGGG - Intronic
1080700107 11:34637463-34637485 CCTGAGACATGGCGGGAGATAGG - Intronic
1085514747 11:77105652-77105674 CCTGAGTCTGGGAGGGGGTTGGG - Intronic
1088606900 11:111541173-111541195 CCAGAGTTATGGGGGTGGGTTGG + Intronic
1088888528 11:114026647-114026669 CCTGTGTCTTCCAGGTGGATAGG + Intergenic
1089954246 11:122555813-122555835 GCTGAGTCATGCAGGTTGTTAGG + Intergenic
1091193837 11:133715645-133715667 CCTCACTCATGGAAGTGGAGAGG - Intergenic
1091649677 12:2300807-2300829 AATGAGCCATGGAGGTGGCTGGG + Intronic
1095665168 12:44788902-44788924 GCTGAGTCATGAAGGTTGTTAGG - Intronic
1097172324 12:57123629-57123651 CATGAGTGATGGAGCTGGAGAGG - Intronic
1098837853 12:75443034-75443056 CCTGTTACATGGAGGTGAATGGG - Intergenic
1098882542 12:75930961-75930983 CCTGATTCATGGAGGTGGCTAGG + Intergenic
1101549791 12:105751157-105751179 GCAGAGTCATGCAGGTGGGTAGG + Intergenic
1104513854 12:129405524-129405546 ACAGAGGCATGGAGGTGGGTCGG + Intronic
1105898911 13:24740555-24740577 CCTGAGGCCTGGAGGAGGAAGGG + Intergenic
1106018560 13:25892630-25892652 CCTGTGTCATGCAGGTGTACTGG + Intronic
1106929002 13:34643484-34643506 CCTAAGGAATGGAGCTGGATAGG - Intergenic
1107858158 13:44635567-44635589 TTTGGGTCATGGGGGTGGATTGG + Intergenic
1108030728 13:46226514-46226536 TATCAGTCAGGGAGGTGGATAGG + Intronic
1109206404 13:59487651-59487673 TCTGAGTCATGGGGGTAGATGGG - Intergenic
1110517251 13:76428779-76428801 CCTGAGTCAGAGAAGTGGAAGGG - Intergenic
1113890194 13:113731543-113731565 CCTGAGGCCTGCAGGTGGAGGGG + Intronic
1115131432 14:30056735-30056757 CCACAGCCATGAAGGTGGATGGG - Intronic
1116746395 14:48824735-48824757 CCTGCTTGATGGAGGAGGATGGG + Intergenic
1117786779 14:59293991-59294013 CCTGAGAAATGGATGTGGCTTGG - Intronic
1119720188 14:76885007-76885029 CCTGGGTCCTGGAGGTGCAAAGG - Intergenic
1119895904 14:78219902-78219924 ACTGAGTTACTGAGGTGGATGGG + Intergenic
1120523465 14:85550970-85550992 ACAGAATCATGGAGGAGGATAGG - Intronic
1122056807 14:99104543-99104565 CCTGAGTGATGGGAGTTGATGGG + Intergenic
1122601344 14:102923362-102923384 ACTGGGGCATGGAGGAGGATGGG - Intronic
1123035605 14:105470756-105470778 CCTGAGTCAGGGAGAGGGACTGG - Intergenic
1128464893 15:67902160-67902182 CCTCATTCCTGGAGGTTGATGGG - Intergenic
1133317371 16:4893045-4893067 CCCAAGTCATGGAGGTGGCAGGG - Intronic
1134094791 16:11412213-11412235 GCTGAGACATGGAGGTGGAGAGG - Intronic
1135277912 16:21129162-21129184 TGTGAGTCACGGAGGTGGGTAGG - Intronic
1137753057 16:50880699-50880721 CCTCAGGCAAGGAGGTGGAGGGG + Intergenic
1138979437 16:62249383-62249405 CCTGAATTGTGGAGGTGGGTGGG - Intergenic
1139751489 16:69111680-69111702 CCTCAGTCATGGAGGGAGTTAGG + Intronic
1140342004 16:74173696-74173718 GATGAGTCATGAGGGTGGATGGG - Intergenic
1140557541 16:75938887-75938909 CCTGTGTGATGCAGGGGGATTGG + Intergenic
1141295819 16:82768008-82768030 CCTGAGTCATGGGCGTGCCTTGG + Intronic
1144451132 17:15379841-15379863 TCTGAGTAATTCAGGTGGATTGG - Intergenic
1146962884 17:36999885-36999907 CCAGAGTCATGGGGGTCGGTGGG + Intronic
1147213366 17:38885144-38885166 ACTGAGTGCTGGAGGTGGCTGGG + Intronic
1147969790 17:44213108-44213130 TCTGAGGCATGGAAGAGGATGGG - Intronic
1149047675 17:52266728-52266750 TCTGAGTTATGGAGATGGACTGG - Intergenic
1149623485 17:58063322-58063344 CCTGGGCCAGGGAGGTGGAAAGG + Intergenic
1150811454 17:68360337-68360359 CCAGAGTCATGGAGGAGGAAGGG - Intronic
1151016365 17:70558180-70558202 ACTGAGTGCTGGAGGTGGGTCGG + Intergenic
1151125780 17:71843441-71843463 CCTGAGTGATGGATGTGGCTGGG - Intergenic
1151351282 17:73533571-73533593 CCTGAGTCTTGGAGGTGGAGAGG - Intronic
1154171236 18:12052734-12052756 CCTGAGTGATTGTGGTGGCTTGG - Intergenic
1156335778 18:36170127-36170149 CCTCAGTCCTGGACGTGGGTGGG + Exonic
1156462444 18:37328723-37328745 CCTGAGTTATCTGGGTGGATAGG - Intronic
1156478424 18:37421025-37421047 CTTGAGTCAAGGAGTTGGAAAGG - Intronic
1156678116 18:39555730-39555752 GCTGAGTGATGGAGATGGACTGG + Intergenic
1157894491 18:51452122-51452144 CCTGAGACCTGGGGGTGGAGGGG + Intergenic
1158454409 18:57593655-57593677 ACTGAGTCCTGGAGGTGGGCAGG + Intergenic
1161820319 19:6526727-6526749 CTTGAGCCAAGGAGGTGGACTGG + Intergenic
1163751632 19:19081653-19081675 CCTGAGACCTGGAGGTGGTGAGG - Intronic
1165477852 19:36042057-36042079 CCTGGGTGATGGAGGAGGAGGGG + Intronic
1166102973 19:40582297-40582319 CCTGCCTCATGGAGGAGGAGAGG - Intronic
1166867723 19:45850867-45850889 CCTGAGACATGGGGCTGCATGGG + Intronic
1166947596 19:46406561-46406583 CCTGAGACATGGGGGTGGAGGGG - Intergenic
1167431887 19:49459871-49459893 GCTGAGTCATGTGGGAGGATAGG - Intronic
1167656068 19:50765077-50765099 CCTGATTCATCAAGGTGGCTGGG + Intergenic
1168327890 19:55547184-55547206 CCTGAGTCCTGCAGGAGGAGGGG - Intergenic
925343292 2:3151398-3151420 GCTGAGTCATGGAGGTTGTCAGG - Intergenic
926657999 2:15430746-15430768 CCTGATGCATGGAGGGGGAATGG - Intronic
933881066 2:86670551-86670573 GCTGAATCTTGGAGGTGGGTAGG + Intronic
935156188 2:100485549-100485571 CATGAGTCATGGGTCTGGATGGG + Intergenic
936462920 2:112725159-112725181 CCTGAGTCCTGGAGGGGCAGAGG - Exonic
937724454 2:125145447-125145469 CATAAGTCAAGTAGGTGGATGGG - Intergenic
937767635 2:125680242-125680264 GCTGAGTCATGTAGGTTGTTAGG + Intergenic
938094392 2:128452099-128452121 GCTGAGTAATGGAGGCTGATGGG - Intergenic
939387204 2:141516120-141516142 CCTGAGAAATGGATGTGGTTTGG - Intronic
939628649 2:144509354-144509376 CTTGGGTCATGGGGGTGGATAGG + Intronic
939969779 2:148645491-148645513 CCTGAGAGAGGGAGGTGGAAAGG - Intronic
941572699 2:167191450-167191472 CCGGAGTCATGGGGGTGGGCTGG - Intronic
943758221 2:191580784-191580806 AATGAGTCATGGAGGTTAATTGG + Intergenic
944528893 2:200648838-200648860 GCTGAGTCATGCAGGTTGTTAGG + Intronic
945825629 2:214717080-214717102 CCTGAGTCATGCAGGTTGTCCGG - Intergenic
946651374 2:221895498-221895520 CCTGAGTCAGGGAGCAGGAATGG + Intergenic
947140582 2:227016321-227016343 CCTGGGTCATGGAGGGTGTTTGG - Intronic
947396358 2:229690568-229690590 CCAGAGTGATGGAGCTGGAAGGG - Intronic
947712444 2:232323845-232323867 CCTGGGTCGGGGAGGGGGATGGG - Intronic
947731403 2:232433525-232433547 CCTGGGTCGGGGAGGGGGATGGG - Intergenic
1168972162 20:1938173-1938195 CATGAGTCCTGGAGGAGGAGAGG + Exonic
1169757249 20:9055942-9055964 CCTGGATTATGTAGGTGGATTGG + Intergenic
1170175162 20:13460778-13460800 CCAGGGTAATGGAGGTAGATGGG - Intronic
1171476771 20:25415975-25415997 CCTGAATCATGGAAGAGAATGGG + Intronic
1171956544 20:31468231-31468253 CCTGAGGCAGGGTGATGGATGGG - Intronic
1172977825 20:38919852-38919874 CATGACTGATGGAGGTGGAAGGG - Exonic
1173437641 20:43047147-43047169 CATCAGGCATGGAGGAGGATGGG - Intronic
1174454815 20:50641652-50641674 CCTGTGGCCTGGAGGTGGCTGGG - Intronic
1174471982 20:50768076-50768098 CCTGTGGCCTGGAGGTGGCTAGG + Intergenic
1174749435 20:53097142-53097164 CCTGGGACAAGGAGGGGGATGGG + Intronic
1176006258 20:62864782-62864804 GCAGAGTCATGCAGGAGGATTGG - Intergenic
1177099738 21:16885488-16885510 CTTGAGTGATGGAGGTGATTTGG + Intergenic
1177459295 21:21389353-21389375 CATGTGTCATGGAAGGGGATTGG - Intronic
1178075016 21:29007190-29007212 CCAGATCCATGGAAGTGGATGGG + Intronic
1182015219 22:27033416-27033438 CCTGAGGCATTTAGGTGCATTGG - Intergenic
1182470405 22:30544647-30544669 CATGAGTCCTGGAGGAGGAGAGG + Intronic
1182868764 22:33627733-33627755 AATGGGTCATGGATGTGGATTGG - Intronic
1183360032 22:37378680-37378702 TCTGAGTCACGGGGGTGGGTCGG - Intronic
1185095958 22:48806269-48806291 CTGGAGTCAGGGAGGTGGCTTGG - Intronic
950026806 3:9825742-9825764 CCTGGGACATGCAGGTGGAGAGG - Intronic
950653274 3:14421093-14421115 CCTGGGGCATGGAGATGGAGGGG + Intronic
952299409 3:32090962-32090984 CCTGAGAAATGGAGTTGGGTAGG + Intergenic
953662125 3:44899023-44899045 CCAGAGTCATGGAGCTTGAAAGG - Intronic
954327252 3:49870180-49870202 CCTGAGTCCTGGAGCTGCATAGG + Exonic
954441160 3:50522874-50522896 GCTGAGTCAGGGTTGTGGATTGG + Intergenic
956529391 3:70201106-70201128 CTTGTGTCATGGAGGTTTATTGG + Intergenic
959756983 3:109910919-109910941 GCTGAGTCATGAAGGTTGTTAGG + Intergenic
959827295 3:110813726-110813748 GCTGAGTCATGGGGGAGGTTTGG + Intergenic
961626312 3:128266318-128266340 CCTGAGTGAGGGAAGTGGAGAGG + Intronic
964421518 3:156509051-156509073 TCTGATTCATGGTGGTGGAGTGG + Intronic
965792245 3:172402176-172402198 CAAGAGTGATGGAGGTGGGTGGG - Intergenic
967167657 3:186797059-186797081 CCTGAGGCAAGGAGCTGGACTGG + Intronic
968223081 3:196952947-196952969 CTTGATTCAGGGAGGTGGGTTGG - Intronic
968391851 4:199307-199329 CCAGAGTCATGGTGGGGAATGGG - Intergenic
970520601 4:16880113-16880135 CATGTGTCATGGAGGAGGCTGGG - Intronic
971901012 4:32658256-32658278 GCTGAGTCATGCAGGTTGACAGG + Intergenic
974887170 4:67833935-67833957 CATCAGTCTTGGAGGTGGACTGG - Intronic
976516150 4:85969551-85969573 TCTGAGTCATGATGGTAGATTGG + Intronic
978427382 4:108596545-108596567 CCTGAGTCATGAGCGTGGGTGGG - Intergenic
979267090 4:118716381-118716403 CCTGAGTAAGGGGGGTGGACAGG + Intergenic
979368831 4:119858593-119858615 ACTGAGTCATGGGGGTGCATGGG + Intergenic
980175815 4:129342738-129342760 ACTGAGTTATGGAGTTGCATGGG - Intergenic
983266269 4:165511466-165511488 GCTGAGTCTTGGGAGTGGATCGG - Intergenic
990409808 5:55530864-55530886 CCTCAGCCATGGCGGGGGATGGG + Intronic
990712850 5:58604555-58604577 GCTGAGTCATGGAGGTTGTCAGG + Intronic
990977586 5:61573053-61573075 CCTGTTTCCTGGAGGTGGAAAGG - Intergenic
997286986 5:132687158-132687180 CCTGTGTCCCGGAGGTGGAAAGG - Intergenic
997741726 5:136260754-136260776 ACTGAGTCATGGGGGTGGGAGGG + Intronic
998528847 5:142866931-142866953 CCTGAGACATGGAGTGGGAGGGG - Intronic
999361287 5:150988702-150988724 CCTGTATCAAGGAGGTGGAGGGG + Intergenic
1002076557 5:176711974-176711996 CCTGCCTAATGGAGGTGGTTGGG + Intergenic
1002637777 5:180616627-180616649 GATGAGTCCTGGAGATGGATGGG - Intronic
1003581935 6:7347810-7347832 GCTGAGTCATGCAGGTTGTTCGG - Intronic
1005081237 6:21958679-21958701 ACAGAGTCATGGATATGGATGGG + Intergenic
1005807784 6:29491186-29491208 CCTGAGACAGGAAGGTGGACAGG - Intergenic
1011518851 6:88182382-88182404 CCTGGGACATGGTGGGGGATGGG - Intergenic
1011585131 6:88916389-88916411 CTTGAGTCCAGGAGGTGGAGGGG + Intronic
1012467437 6:99531110-99531132 CCTGAGTGATGGGGGTGGGGGGG - Intergenic
1013171625 6:107641493-107641515 CCAGAGTCAGAGAGGTGGACAGG + Intronic
1014101922 6:117520478-117520500 CCTGAGCTAGGGAGGAGGATGGG - Intronic
1014603886 6:123448476-123448498 GCTGAGTCATGCAGGTTGACAGG - Intronic
1017046593 6:150352489-150352511 CATGAGTCATGGGTCTGGATGGG - Intergenic
1019723220 7:2586349-2586371 CCTGTGTCTTGGAGATGGTTGGG - Exonic
1021095490 7:16530728-16530750 TCTGAGTCCTGGAGGTAGAATGG + Intronic
1021403472 7:20237175-20237197 CCTGAGGCAGGGAGGTGGTGGGG + Intergenic
1023881647 7:44324641-44324663 TCAGGGTCATCGAGGTGGATGGG - Intronic
1025809667 7:64867812-64867834 CCAGAGCCCTGGAGGGGGATGGG - Intergenic
1026116205 7:67497726-67497748 CCTGTGTCTTGGAGGTGACTGGG + Intergenic
1026622915 7:71966374-71966396 CCTCAGTGATGGAGGTGGGGTGG + Intronic
1027246841 7:76373422-76373444 GCTGAGTCATGGAGGAGGATAGG + Intergenic
1027745855 7:82073049-82073071 CCTGCATCAGGGAGGTGGAATGG - Intronic
1028343971 7:89757771-89757793 CTTGATTCTTGGAGGTGGTTGGG - Intergenic
1029130000 7:98322657-98322679 CGTGAGTGCTGGGGGTGGATGGG - Intronic
1030110845 7:106025279-106025301 CCTGAGTTTTGGAGTTAGATGGG + Intronic
1030325195 7:108211624-108211646 GCTGAGTCATGCAGGTTGTTGGG - Intronic
1030723305 7:112894847-112894869 CCTGAGTCAAGCAAGTCGATTGG - Intronic
1031110909 7:117607303-117607325 CCTGAGTGATAGATGTGAATAGG + Intronic
1031879215 7:127177239-127177261 CCTGAGTCATGCAGGTTGTCAGG - Intronic
1032501607 7:132404097-132404119 CCTGTGTTATGGAGGTGCTTGGG - Intronic
1035472178 7:159117507-159117529 CCTGAGTCATGGACACAGATGGG + Intronic
1035789375 8:2289812-2289834 CGTGAGTCATGGATGTGGATGGG - Intergenic
1035803430 8:2431893-2431915 CGTGAGTCATGGATGTGGATGGG + Intergenic
1037486066 8:19347868-19347890 CCTGTGTGGTGGAGGTGGAGAGG - Intronic
1037931935 8:22886463-22886485 CCTGTCTCATGGAGGTGTAAGGG + Intronic
1038003113 8:23407196-23407218 CCTGAGTGGTGGAGGTGGCAGGG - Intronic
1038851912 8:31287235-31287257 CCAGAGTCATGGAAGTAGGTAGG + Intergenic
1039220799 8:35328100-35328122 ACTGAGTTTTGGAGGTGGAGGGG - Intronic
1039270005 8:35869823-35869845 CCTGAGTCATGGGAGTGCCTCGG + Intergenic
1039956356 8:42209985-42210007 CATGAGTCATGGAGGTGGCGGGG + Intergenic
1040635689 8:49270541-49270563 GCTGAGTCATGCAGGTGGTCAGG + Intergenic
1042122886 8:65507480-65507502 GCTGAGTCATGCAGGTTGACAGG + Intergenic
1042223304 8:66494454-66494476 CCTGAGTCATGGAGGTGGATGGG - Intronic
1045090211 8:98734144-98734166 ATTGGATCATGGAGGTGGATTGG - Intronic
1047606488 8:126479882-126479904 CCTGGGTCATGGAGTGAGATGGG - Intergenic
1048334463 8:133492278-133492300 CATGAGTCCTGGAGATGGCTGGG + Intronic
1048828655 8:138454602-138454624 CCTGAGTGATGGAGGAAGAAAGG - Intronic
1049069760 8:140347270-140347292 CCTGAGGCAGGCAGGTGGCTGGG - Intronic
1049802979 8:144526844-144526866 CGTGGGTCCTGGAGGGGGATGGG - Exonic
1050216467 9:3330960-3330982 CTTTAGTCATGGAGGTTTATTGG - Intronic
1052731475 9:32291310-32291332 TCTGAGTCATGCAGGTGGTCAGG + Intergenic
1055037625 9:71835465-71835487 CATGAGTCATGGATCTAGATGGG - Intergenic
1055107637 9:72528775-72528797 CCTGAGTTTTTGAGGTGGTTGGG + Intronic
1058085051 9:100739819-100739841 GCTGAGTCATGCAGGTTGTTAGG + Intergenic
1059324805 9:113497692-113497714 CCTGAGACATGGAGCTGGGAAGG - Intronic
1061195294 9:129103904-129103926 CCTCAGGTATGGAGGAGGATGGG + Intronic
1061266655 9:129509649-129509671 CATGACTCATGGGGGTGGCTTGG + Intergenic
1061862283 9:133474133-133474155 GCTGGGTCCTGGAGGGGGATGGG - Intronic
1061928291 9:133818498-133818520 CCTGAGTCCTGGTGTGGGATGGG - Intronic
1185484722 X:473685-473707 TCAGAGTCATGGAGATGGAGAGG - Intergenic
1186962700 X:14754016-14754038 CTTGGGTCATGGAGGGGGAGGGG - Intergenic
1187486361 X:19707882-19707904 CCCAAGCCAGGGAGGTGGATGGG + Intronic
1190061459 X:47214494-47214516 GCAGGGTCATGGAGGTGGACAGG - Intronic
1190843820 X:54172284-54172306 CCTATGACATGGAGGTTGATTGG - Intronic
1191216933 X:57942290-57942312 CCTGCGTGAAGGAGGAGGATGGG - Intergenic
1191954117 X:66625406-66625428 GCTGAGTCATGCAGGTGGTCAGG - Intronic
1192268511 X:69556698-69556720 CCTGAGTCATAGAGCTAGAAAGG + Intergenic
1192979059 X:76319200-76319222 GCTGAGTCATGGAGGTTGTCAGG + Intergenic
1196936722 X:120737644-120737666 ACCCAGTCATGGAGGTGAATGGG - Intergenic
1198363207 X:135915962-135915984 CTTGAGACATGGAGGTGGTGTGG + Intergenic
1201342120 Y:12945743-12945765 CTTGAGTCCTGGAGGTGGAGTGG - Intergenic
1201785956 Y:17779407-17779429 CCTGAGGCAGGCAGATGGATTGG - Intergenic
1201815597 Y:18126581-18126603 CCTGAGGCAGGCAGATGGATTGG + Intergenic