ID: 1042223306

View in Genome Browser
Species Human (GRCh38)
Location 8:66494455-66494477
Sequence GCCTGAGTCATGGAGGTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 552
Summary {0: 1, 1: 0, 2: 6, 3: 56, 4: 489}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042223306_1042223314 16 Left 1042223306 8:66494455-66494477 CCATCCACCTCCATGACTCAGGC 0: 1
1: 0
2: 6
3: 56
4: 489
Right 1042223314 8:66494494-66494516 TTGTCAGCCTTGAATGAAGTAGG No data
1042223306_1042223315 20 Left 1042223306 8:66494455-66494477 CCATCCACCTCCATGACTCAGGC 0: 1
1: 0
2: 6
3: 56
4: 489
Right 1042223315 8:66494498-66494520 CAGCCTTGAATGAAGTAGGCTGG No data
1042223306_1042223316 21 Left 1042223306 8:66494455-66494477 CCATCCACCTCCATGACTCAGGC 0: 1
1: 0
2: 6
3: 56
4: 489
Right 1042223316 8:66494499-66494521 AGCCTTGAATGAAGTAGGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042223306 Original CRISPR GCCTGAGTCATGGAGGTGGA TGG (reversed) Intronic
900242118 1:1622080-1622102 GCCTGTGTCCTGGAGTTGGCAGG + Intronic
900640110 1:3684480-3684502 GTCTGAGGCATGGGGGTGGGCGG + Intronic
900766672 1:4510576-4510598 GCCTCCTTCATGGAGCTGGAAGG - Intergenic
901065121 1:6490705-6490727 GCCGGAGCCAGGGAGGTGGCTGG + Intronic
901355171 1:8640069-8640091 GCTTGAGCCTGGGAGGTGGAGGG + Intronic
901811940 1:11772345-11772367 GCTTGAGCCAGGGAGGTGGAGGG - Intronic
903118268 1:21195963-21195985 GCTTGAACCCTGGAGGTGGAGGG + Intergenic
903363815 1:22793686-22793708 GCCCGAGACAGGGAGGTGAAAGG + Intronic
903734826 1:25523441-25523463 GCCTGAGTTCTGGAGGAAGAAGG - Intergenic
903828161 1:26159742-26159764 CCCTGAGTCCTGGAGGCTGAGGG - Intronic
904214901 1:28911662-28911684 GCCTGAGGCACAGAGGTGGTAGG + Intronic
905172040 1:36115202-36115224 GCCTGAGGCCTGGGGGTGGCTGG - Intronic
905178285 1:36151526-36151548 GCTTGAGCCCAGGAGGTGGAGGG + Intronic
905340360 1:37273727-37273749 GCCTGAGCCTGGGAGCTGGAAGG - Intergenic
905694157 1:39962650-39962672 GCCGGGGTCATGGCCGTGGACGG + Intronic
906055921 1:42916988-42917010 GACTGAGGCATGCAGGTGCATGG - Intergenic
906287635 1:44598053-44598075 GCCTGACTCTTGGAGGGGGCGGG - Intronic
906342517 1:44993267-44993289 GCCTGAACCCGGGAGGTGGAGGG - Intergenic
906461330 1:46036909-46036931 GCCTCAGCACTGGAGGTGGATGG + Intergenic
906472851 1:46145635-46145657 GTTTGGGTCATGGAGGAGGATGG - Intronic
906480288 1:46194929-46194951 GGCTGTGTCCTTGAGGTGGAAGG + Exonic
906530304 1:46520087-46520109 GAATGAGTGATGGGGGTGGAGGG - Intergenic
907076918 1:51587413-51587435 GCCATGGTCATGGAGGTGGGTGG - Intronic
907341824 1:53740575-53740597 GCCTGTGTCAATGTGGTGGAGGG + Intergenic
909092573 1:71245012-71245034 GCCTGGGGGGTGGAGGTGGAAGG + Intergenic
910110399 1:83676442-83676464 GCCTGTAGCAAGGAGGTGGATGG + Intergenic
911165680 1:94722394-94722416 GCCTGAGTCAAGGAGTGGAAGGG - Intergenic
911639239 1:100269113-100269135 GCTTGAGCCTTGGAGGTGGAAGG + Intronic
912499779 1:110114189-110114211 TCCTGAGTGATGGGGATGGAGGG + Intergenic
912635408 1:111287505-111287527 GCTTGAGTCCAGGAGGTCGAGGG - Intergenic
912955073 1:114149718-114149740 GCTGGAGTGATGGAGGTGGAGGG + Intronic
914823960 1:151127794-151127816 GCTTGAGACCTGGAGGTCGAAGG - Intergenic
918120699 1:181537180-181537202 ACTTGAATCTTGGAGGTGGAGGG - Intronic
918378492 1:183932585-183932607 GACTGACTCACGGAGCTGGAGGG + Intronic
918867405 1:189920863-189920885 GCTTCAGTCGTAGAGGTGGAGGG + Intergenic
919259541 1:195174279-195174301 TCCTGAGTCATAGAGCTGCAAGG - Intergenic
919340606 1:196301820-196301842 GCTTGAATCCAGGAGGTGGAAGG - Intronic
919573342 1:199276199-199276221 GCTTGAGCCCAGGAGGTGGAGGG - Intergenic
919661974 1:200256302-200256324 GCTTGAATCCAGGAGGTGGAGGG - Intergenic
919764474 1:201117351-201117373 GCCTGAACCTGGGAGGTGGAGGG + Intronic
919829955 1:201533483-201533505 GCTTGAGCCTGGGAGGTGGAGGG - Intergenic
919956977 1:202427315-202427337 GCCAGAGGCAGGGTGGTGGAGGG - Intronic
920383566 1:205550365-205550387 ACCTGAGCCAGGGAGGTCGAGGG + Intergenic
920387604 1:205579845-205579867 GCCTCAGTCATGGCGCTGGCGGG + Exonic
920408663 1:205740220-205740242 GCTTGAGTCCTGGAGTTTGAGGG - Intronic
920620655 1:207543032-207543054 GCTTGAGTCAGGGAGGTGGAGGG - Intronic
920622437 1:207561589-207561611 GCTTGAGTCAGGGAGGTGGAGGG - Intronic
921131285 1:212222041-212222063 TGCAGAGTCATGGAGATGGAAGG + Intergenic
921556705 1:216607217-216607239 GCCAGGGTCATGGGGGTGTAGGG - Intronic
922101118 1:222477548-222477570 CCCTGAGCCATGGAGCTGTAAGG - Intergenic
922206952 1:223456359-223456381 GCCTGTGTGGTGGGGGTGGATGG - Intergenic
922506357 1:226128210-226128232 GCTTGAGTTTTGGAGCTGGAAGG + Intergenic
922780721 1:228250325-228250347 GCCCGAGACATGAAGGTGGAAGG - Intronic
923555932 1:235000307-235000329 GCTTGAATCCGGGAGGTGGACGG + Intergenic
923588940 1:235301630-235301652 GCTTGAGCCTGGGAGGTGGAGGG - Intronic
923635612 1:235692936-235692958 ACTTGAGTCTGGGAGGTGGAGGG + Intronic
924586548 1:245365748-245365770 AACGGAGTCATGGAGCTGGAAGG + Intronic
1062801117 10:381296-381318 GACTGAGTGATGGAGGGGCAGGG + Intronic
1062953834 10:1526797-1526819 GCGTGAGTCAGGGAGGTGCCAGG - Intronic
1063918510 10:10908868-10908890 GGCTGAATCTGGGAGGTGGAAGG - Intergenic
1064012131 10:11743212-11743234 GATGGAGTCATGAAGGTGGAGGG + Intronic
1064432102 10:15280002-15280024 GCTTGAACCTTGGAGGTGGAGGG + Intronic
1065305359 10:24363652-24363674 GCTTGAGCCCAGGAGGTGGAGGG - Intronic
1066061257 10:31725441-31725463 GCCTGTGTCACTGAGTTGGAGGG + Intergenic
1067426121 10:46213384-46213406 GCTTGAGCCCAGGAGGTGGAGGG + Intergenic
1067566905 10:47346129-47346151 GGCTGAGTTTTGGAGTTGGAGGG - Intergenic
1067764437 10:49074622-49074644 GCCTGGCTCCTGGAGGTGCATGG + Intronic
1067800984 10:49359670-49359692 GCCTGAGTGGTGGTGGTGGGGGG - Intergenic
1068235988 10:54232960-54232982 GCCTGAGTGATGGAGGAGATTGG - Intronic
1069470864 10:68688178-68688200 GCTTGAATCAAGGAGGTGGAGGG - Intronic
1069751172 10:70745878-70745900 GCTGGGGTCATGGAGGTGGCAGG + Intronic
1070645371 10:78198452-78198474 GCCAGAGTTAAGGAGGTGGCAGG + Intergenic
1072123116 10:92421114-92421136 GCCTGCGTGAAGGAGGTGGACGG - Intergenic
1072504181 10:96047553-96047575 GCTTGAGCCTGGGAGGTGGAGGG + Intronic
1072599484 10:96912012-96912034 GCTTGAACCAGGGAGGTGGAGGG - Intronic
1072614458 10:97040140-97040162 GCCCCTGTCAGGGAGGTGGACGG + Intronic
1072827816 10:98626195-98626217 GCGGTAGTCATGGAGGTGGGGGG + Intronic
1072908344 10:99476366-99476388 CCCTGAGCCTGGGAGGTGGAGGG + Intergenic
1073665037 10:105521904-105521926 GCGTCTGTCATGGAGGTGGGGGG - Intergenic
1074361079 10:112824546-112824568 GCCTGGGTGATAGAGCTGGAGGG + Intergenic
1074528466 10:114280608-114280630 GCCTAAATCAGGGAGGGGGAAGG + Intronic
1075096485 10:119474819-119474841 CCCTGAGCCCGGGAGGTGGAGGG + Intergenic
1075385402 10:122051837-122051859 GCCTGGGGCATGGAAGTGGGTGG + Intronic
1075735455 10:124662029-124662051 GCTAGAGTCATGGAGGTGAGGGG - Intronic
1076531347 10:131147396-131147418 GCCTGCGGCATGGAGGTGCACGG + Intronic
1076691540 10:132226083-132226105 GGCCGAGTCTTGGAGGGGGAGGG - Intronic
1076785931 10:132749946-132749968 AACTGAGTCCTGGAGGTGGCAGG - Intronic
1076869841 10:133187911-133187933 GCCAGGCTCATGGAGGTGGAGGG - Intronic
1077528735 11:3084932-3084954 GCTTGAATCTGGGAGGTGGAGGG + Intergenic
1078768482 11:14323373-14323395 GCTTGAGCCTGGGAGGTGGATGG + Intronic
1079106121 11:17573455-17573477 GCCTGAGTGATGGAGGGGATGGG - Intronic
1079932703 11:26585012-26585034 ACATGACTCATGGAGGTGAAAGG - Intronic
1081195945 11:40160908-40160930 GACTGAGGCATGGACGTGGCTGG - Intronic
1081616455 11:44594336-44594358 GCCTGGGTCATGGAGGTGAGGGG + Intronic
1082261495 11:50078951-50078973 CCCTGAGCCATGGAGATGTAAGG - Intergenic
1082960325 11:58913274-58913296 GCCTGAGGCTGGGAGCTGGAGGG + Intronic
1083164233 11:60873729-60873751 GCCTGAGTCCAGGAGGGCGAAGG - Exonic
1083319305 11:61835475-61835497 GCTTTAGCCAGGGAGGTGGAAGG - Intronic
1083800987 11:65046133-65046155 GGCTCAGTCATGGGGGTGCAGGG + Intronic
1083978075 11:66140446-66140468 GCCTGAGTCTGGGAGGTCCACGG - Intronic
1085043195 11:73338773-73338795 GCCTGGGCCCTGGAGGTGGCTGG + Intronic
1085514749 11:77105653-77105675 GCCTGAGTCTGGGAGGGGGTTGG - Intronic
1085651213 11:78270242-78270264 GCCTGAACCCGGGAGGTGGAGGG + Intronic
1086326190 11:85702402-85702424 GCTTGAGTCCAGGAGTTGGATGG - Intronic
1088317342 11:108520647-108520669 GCTTGAGCCAGGGAGGTGGATGG - Intronic
1088885130 11:114000234-114000256 GACTGAGTATTGGAGCTGGAAGG + Intergenic
1089450705 11:118594180-118594202 GCCTGGGCCTGGGAGGTGGAGGG - Intronic
1089911612 11:122106137-122106159 GCCTGATGCATGTGGGTGGAAGG + Intergenic
1090059980 11:123456086-123456108 GCTTGAACCAGGGAGGTGGAGGG + Intergenic
1091760790 12:3085821-3085843 GCCTCTGACCTGGAGGTGGATGG + Intronic
1092068237 12:5611051-5611073 GCTTGAACCCTGGAGGTGGAGGG - Intronic
1093032191 12:14298390-14298412 GCTTGAATCTGGGAGGTGGAGGG + Intergenic
1094055709 12:26267722-26267744 GCTTGAATCCAGGAGGTGGAGGG - Intronic
1094160674 12:27386710-27386732 GCTTGAGCCCGGGAGGTGGAGGG - Intronic
1094623857 12:32105171-32105193 GCTTGAATCCAGGAGGTGGAGGG - Intergenic
1094667491 12:32535516-32535538 GCCTGAGTGATGGAGGGAGCAGG - Intronic
1095854586 12:46845776-46845798 GCTTGAATCCAGGAGGTGGAGGG + Intergenic
1096069452 12:48766898-48766920 GCCAGAGTCAAGGAGGTTGCAGG + Exonic
1096553976 12:52391861-52391883 GCCTGAGTCCTGGAGGCCCACGG - Intergenic
1100190013 12:92180332-92180354 GAATGGGTCAGGGAGGTGGAAGG - Intergenic
1100258164 12:92905149-92905171 CCTTGAGTGATGGAGGTGAAAGG - Intronic
1100686347 12:96990471-96990493 GCCGGAGTCATGGAAGGGGGAGG + Intergenic
1100725160 12:97400635-97400657 TCCTGAATCCAGGAGGTGGAGGG + Intergenic
1102562451 12:113771908-113771930 GCCTGAGCCATGCAGATGGCAGG - Intergenic
1102628808 12:114258562-114258584 GCTTGAGTCCAGGAAGTGGAGGG + Intergenic
1103547965 12:121715007-121715029 GCCTTAGACAAGGAGGAGGAGGG + Intronic
1103604427 12:122076696-122076718 ACCTGAGCCCTGGAGGTTGAGGG + Intergenic
1103671330 12:122618749-122618771 GCTTGAATCTGGGAGGTGGAGGG - Intronic
1104753637 12:131255491-131255513 ACCTGGGTCAGGTAGGTGGAAGG - Intergenic
1104867540 12:131966989-131967011 GCTTGAGTCCTGGAGTTCGAGGG + Intronic
1104981330 12:132574253-132574275 GGCTGAGTCCTGGGGGTGCAGGG - Intronic
1105483565 13:20803432-20803454 GCCTGAGTCAGGCAGGTCCAGGG + Intronic
1105778756 13:23687823-23687845 GGATGAGTCGTGGAGGCGGAAGG + Intergenic
1105898909 13:24740554-24740576 TCCTGAGGCCTGGAGGAGGAAGG + Intergenic
1108227714 13:48305899-48305921 GCCTAAGTAATGTAGCTGGAAGG + Intronic
1109206405 13:59487652-59487674 ATCTGAGTCATGGGGGTAGATGG - Intergenic
1109521961 13:63525495-63525517 GCCTTAGACTGGGAGGTGGAGGG - Intergenic
1110517253 13:76428780-76428802 ACCTGAGTCAGAGAAGTGGAAGG - Intergenic
1110725038 13:78812710-78812732 GCTTGAGCCTGGGAGGTGGAGGG - Intergenic
1111913654 13:94338836-94338858 GACTGAGTCATGGTGGGAGATGG + Intronic
1112250461 13:97774548-97774570 GCCTGAGGCAGGGAGGCGGCAGG - Intergenic
1113407683 13:110056785-110056807 GACTGAGTCACGGAGCAGGAAGG + Intergenic
1113498654 13:110755334-110755356 GCTTGAGCCTGGGAGGTGGAGGG - Intergenic
1113890192 13:113731542-113731564 CCCTGAGGCCTGCAGGTGGAGGG + Intronic
1113911406 13:113843160-113843182 GCGGGGGTCAGGGAGGTGGACGG - Intronic
1114393018 14:22330599-22330621 GCATGAGCTATGGAGTTGGATGG - Intergenic
1114646317 14:24258471-24258493 ACCTGAGCTTTGGAGGTGGAGGG - Intronic
1114648053 14:24266631-24266653 GGCTGCGTGATGGAGGTGGAAGG + Intronic
1115233619 14:31187273-31187295 GCTTGAACCCTGGAGGTGGAAGG + Intronic
1116893640 14:50294052-50294074 TCCTGAGACATGGAGGCTGAGGG - Intronic
1117867031 14:60160658-60160680 GCCTGAGCCGTGGAGGTTGCAGG - Intronic
1118250402 14:64154708-64154730 ACCTGAGCCTGGGAGGTGGAAGG + Intronic
1118648210 14:67861082-67861104 GCTTGAGTGGTGGAGGTGGGAGG + Intronic
1118893586 14:69928244-69928266 GCCTGCTTCCTGGAGGAGGAGGG - Intronic
1119332844 14:73808218-73808240 GCTTGAACCAGGGAGGTGGAGGG - Intergenic
1120300637 14:82702100-82702122 GCCTGAATCCAGGAGGCGGAGGG - Intergenic
1121526717 14:94624327-94624349 GCCTGGGCCCTGGGGGTGGAAGG - Intronic
1121894798 14:97636938-97636960 CCTTGAGAGATGGAGGTGGACGG - Intergenic
1122701393 14:103591668-103591690 GCATGAACCAGGGAGGTGGAGGG + Exonic
1123007716 14:105332452-105332474 GCCTCAGTCCTGGAGGTGGTCGG - Intronic
1123807337 15:23888442-23888464 GCTTGAACCAGGGAGGTGGAGGG - Intergenic
1124030202 15:26003568-26003590 GCTTGAACCCTGGAGGTGGAGGG + Intergenic
1124886912 15:33695866-33695888 GCTTGAGCCTTGGAGGTTGAGGG - Intronic
1126394669 15:48201899-48201921 GTCTGAGTCAGGAATGTGGAGGG - Exonic
1127633788 15:60850306-60850328 GGTTGAGTCATGGATGAGGAGGG - Intronic
1127712454 15:61613384-61613406 GGCTGAGGCATGGGAGTGGAAGG - Intergenic
1127853963 15:62939870-62939892 GCTTGAGCCTGGGAGGTGGAGGG - Intergenic
1127988243 15:64091975-64091997 GCTTGAGCCCTGGAGGTGGATGG + Intronic
1128229614 15:66025381-66025403 GCCTGAGGCAGGGAGGAGGGAGG + Intronic
1128448302 15:67784481-67784503 GCCTGTGGCATCAAGGTGGAAGG - Intronic
1128606267 15:69038749-69038771 GCCTGTTTTATGGAGGAGGAGGG + Intronic
1128634344 15:69293639-69293661 GCCTGTTTCATTTAGGTGGAGGG - Intergenic
1129032049 15:72626340-72626362 GCCTGAACCCAGGAGGTGGAGGG - Intergenic
1129427840 15:75477510-75477532 GCTTGAGCCCTGGAAGTGGAAGG + Intronic
1129629322 15:77240536-77240558 GCTTGAGCCCTGGAGGTTGAGGG + Intronic
1129677844 15:77642115-77642137 CCCTGAGATATGGGGGTGGAAGG - Intronic
1131275892 15:90980600-90980622 GCTTGAGCCTGGGAGGTGGAGGG - Intronic
1132674924 16:1117576-1117598 GCCTGAGCCAGGGAGTTGGTCGG + Intergenic
1132862474 16:2078387-2078409 GCCTGAGGTGAGGAGGTGGATGG - Intronic
1132914979 16:2339240-2339262 GCCTGGCTCATGCAGATGGAAGG + Intronic
1133049870 16:3111530-3111552 GCTTGAGTCCAGGAGGTTGAGGG + Intergenic
1133317373 16:4893046-4893068 TCCCAAGTCATGGAGGTGGCAGG - Intronic
1133583079 16:7165510-7165532 GCTTGATTCCAGGAGGTGGAGGG - Intronic
1133682892 16:8137127-8137149 ACTTGAGTCCAGGAGGTGGAGGG + Intergenic
1134228187 16:12408372-12408394 GCCTGGCTCTTGGATGTGGAGGG - Intronic
1134666754 16:16024432-16024454 GCTTGAGCCCCGGAGGTGGAGGG - Intronic
1135779331 16:25286095-25286117 GCTTGAGCCCGGGAGGTGGAGGG - Intergenic
1135790252 16:25387773-25387795 GCTTGAGCCCGGGAGGTGGAAGG - Intergenic
1136074629 16:27808499-27808521 GCTTGAGCCTGGGAGGTGGAGGG - Intronic
1136104978 16:28023945-28023967 GCTTGAGCCAAGGAGTTGGAGGG + Intronic
1137753055 16:50880698-50880720 GCCTCAGGCAAGGAGGTGGAGGG + Intergenic
1137788091 16:51153040-51153062 GGCTGAGTAATGGGGGAGGAGGG + Intergenic
1138184556 16:54966432-54966454 GCCTGTGTCATGAATGTGGGAGG + Intergenic
1138595364 16:58026579-58026601 GGCTGGGACTTGGAGGTGGAGGG + Intronic
1139344057 16:66290596-66290618 GCATGCGTCCTGCAGGTGGATGG - Intergenic
1140342005 16:74173697-74173719 GGATGAGTCATGAGGGTGGATGG - Intergenic
1140466523 16:75187493-75187515 GCCTGAACCCAGGAGGTGGAGGG + Intergenic
1140600369 16:76468568-76468590 GCTTGAGCTAAGGAGGTGGAGGG - Intronic
1141084246 16:81080090-81080112 GCCTGAATCCGGGAGGTGGAGGG + Intergenic
1141623074 16:85247466-85247488 GCCTGAGCCAGAGAGGAGGACGG + Intergenic
1141774692 16:86115392-86115414 GCCTGGGACATGGAGGAGGATGG + Intergenic
1141939517 16:87265524-87265546 GCCTGTGTCCTGGAGTGGGAGGG + Intronic
1142354669 16:89596841-89596863 GCCTGAGCCAGGTGGGTGGAGGG + Exonic
1142677812 17:1525599-1525621 GCCTGAACCCGGGAGGTGGAGGG - Intronic
1143169862 17:4922556-4922578 GCTTGAACCAGGGAGGTGGAGGG - Intergenic
1143633106 17:8149970-8149992 GCCTGTGTCAAGCAGGTGCAGGG - Exonic
1143638320 17:8179830-8179852 ACCTGAGCCAGGGAGGTCGAGGG - Intergenic
1143824414 17:9592524-9592546 GCCTGGGGCTTGGAGGAGGAGGG - Intronic
1143917548 17:10305058-10305080 TCCTGGGTCCAGGAGGTGGAGGG - Intronic
1144283742 17:13752187-13752209 GCTTGAACCCTGGAGGTGGAGGG + Intergenic
1145906625 17:28519932-28519954 GCCTGAGTTATGGGGGTGGGGGG - Intronic
1145941708 17:28746197-28746219 GTCTGAGTCAGGTAGGTGGAAGG - Intronic
1146393877 17:32446139-32446161 GCTTGAGTCATGGTGGTTGACGG + Intronic
1146935956 17:36812900-36812922 GTGTGAGGCATGGGGGTGGAGGG - Intergenic
1146962882 17:36999884-36999906 GCCAGAGTCATGGGGGTCGGTGG + Intronic
1147254616 17:39174493-39174515 GGCTGAGGCATGGAGGTGGGGGG + Exonic
1148146839 17:45371472-45371494 GCCTGAGACCAGGAGTTGGAGGG - Intergenic
1148481627 17:47963353-47963375 GCGTGAGCCCGGGAGGTGGAGGG - Intergenic
1148504233 17:48114746-48114768 GCTTGAGCCTGGGAGGTGGAGGG - Intronic
1148610873 17:48963749-48963771 GCTTGAATCCAGGAGGTGGAGGG + Intronic
1148634127 17:49134016-49134038 GCCTTAGCCAAGGACGTGGATGG - Intronic
1149473593 17:56940181-56940203 GCTTGAGCCCAGGAGGTGGAAGG - Intronic
1149546246 17:57505949-57505971 GCCTGAGCAGTGGAGGTAGAAGG - Intronic
1149561744 17:57612369-57612391 GGCTGAGTCTCGGGGGTGGAGGG + Intronic
1149749859 17:59135397-59135419 GCCTGAACCCGGGAGGTGGAGGG - Intronic
1150667566 17:67156623-67156645 GCTTGAGTCATGGAAGCTGAGGG - Intronic
1150678265 17:67263527-67263549 GCTTGAGACTGGGAGGTGGAAGG - Intergenic
1150811456 17:68360338-68360360 GCCAGAGTCATGGAGGAGGAAGG - Intronic
1151125782 17:71843442-71843464 GCCTGAGTGATGGATGTGGCTGG - Intergenic
1151580512 17:74975231-74975253 GCTTGAGCCTTGGAGGTAGAGGG - Intergenic
1152285361 17:79409690-79409712 GCCTGAGACCTGGAGCTGGCAGG + Intronic
1152731897 17:81976717-81976739 GGCTGAGCCATGGAGGTGGGGGG + Intergenic
1152889004 17:82869435-82869457 GCTTGAGCCTGGGAGGTGGAAGG + Intronic
1153084584 18:1269703-1269725 ACCTGAGATATGGTGGTGGAGGG - Intergenic
1156162362 18:34374503-34374525 GCCTGTCCCATGGAGGTGGGAGG + Intergenic
1156248374 18:35325991-35326013 GCTTGGGTCAGGGAGGGGGAAGG - Intergenic
1156281419 18:35642995-35643017 GCCTGAGTCACAGACCTGGAAGG - Intronic
1156386545 18:36610184-36610206 GCCTGAGGAATGCAGGTGAAGGG - Intronic
1157475073 18:48018790-48018812 GCTTGAGCCCAGGAGGTGGAAGG - Intergenic
1157894489 18:51452121-51452143 ACCTGAGACCTGGGGGTGGAGGG + Intergenic
1158616734 18:58994955-58994977 GCCTGAGGCCAGGAGGTCGAGGG - Intergenic
1159718801 18:71859243-71859265 GCTTGAGTCATGGCTTTGGAGGG - Intergenic
1160742745 19:694982-695004 GCCTGAGTCAGGGACGAGGCGGG + Intronic
1161251236 19:3281427-3281449 CCCTGAGTCAGGGAGATGGAGGG - Intronic
1161990531 19:7681691-7681713 GCCAGAGTAAAGGGGGTGGAGGG - Intronic
1162065152 19:8121045-8121067 GCCTGAGACCTGGGGGTGGCCGG - Intronic
1162902429 19:13803217-13803239 GCCTGGGTCATGCAGGGAGATGG - Intronic
1163416424 19:17189547-17189569 GCTTGAGTCTGGGAGGTTGAAGG + Intronic
1163489514 19:17609038-17609060 GCTTGAGTCCGGGAGGCGGAGGG - Intronic
1163689544 19:18731060-18731082 GTTTGAGTCCAGGAGGTGGAGGG - Intronic
1165477850 19:36042056-36042078 GCCTGGGTGATGGAGGAGGAGGG + Intronic
1165697524 19:37912152-37912174 GCTTGAACCAGGGAGGTGGAGGG + Intronic
1166061318 19:40327537-40327559 GACTTTGTGATGGAGGTGGACGG + Intronic
1166179063 19:41094443-41094465 GTCTGAGTGGTGGTGGTGGAGGG - Intronic
1166373804 19:42316146-42316168 CCCTGGGTCCTGGAGGAGGAGGG + Intronic
1166381478 19:42357383-42357405 GCCTGAGGGATGGAGGGGCAAGG - Exonic
1166867721 19:45850866-45850888 GCCTGAGACATGGGGCTGCATGG + Intronic
1166947598 19:46406562-46406584 CCCTGAGACATGGGGGTGGAGGG - Intergenic
1167288603 19:48612747-48612769 ACCTGAGTCCTGGGGCTGGAAGG + Intronic
1167490648 19:49791053-49791075 GCCTGAGCCATGGGGCAGGAGGG - Intronic
1167553580 19:50178048-50178070 GCTTGAATCCGGGAGGTGGAGGG + Intergenic
1167656066 19:50765076-50765098 GCCTGATTCATCAAGGTGGCTGG + Intergenic
1167953044 19:53043248-53043270 GCTTGAGCCCAGGAGGTGGAGGG - Intergenic
1168032958 19:53695849-53695871 GCTTGAATCTGGGAGGTGGAGGG - Intergenic
1168327892 19:55547185-55547207 TCCTGAGTCCTGCAGGAGGAGGG - Intergenic
1168348895 19:55664547-55664569 GCCTGGGACATGGAGGAGGTGGG + Intronic
1168643507 19:58045294-58045316 GACTGAGTCTCGGATGTGGATGG - Intronic
925354204 2:3226090-3226112 GCCTTTGACATGGAGGTGCAGGG + Intronic
925612009 2:5709417-5709439 GCCTGAGTCTTGAAGGTGCGTGG + Intergenic
927563743 2:24093005-24093027 CCCTGAGCCATGGTGGTGGGTGG - Intronic
928023895 2:27724259-27724281 GCCTGGGTGCAGGAGGTGGAGGG - Intergenic
928116033 2:28545752-28545774 GACTGGGACATCGAGGTGGAAGG + Intronic
928445926 2:31333221-31333243 GCCAGGCTCACGGAGGTGGATGG - Intergenic
929516491 2:42607460-42607482 GCTTGAGCCCAGGAGGTGGAAGG - Intronic
929588968 2:43133047-43133069 GCCCAAGGCAAGGAGGTGGAAGG + Intergenic
929703464 2:44186449-44186471 GCTTGAGCCCAGGAGGTGGAGGG - Intronic
929785098 2:44983944-44983966 GCTTGAGTCCAGGAGGTTGAAGG + Intergenic
930619117 2:53625978-53626000 GCCTGAGCCTGGGAGGTCGAGGG - Intronic
930733892 2:54755741-54755763 GCTTGAGCCTGGGAGGTGGAGGG - Intronic
932537129 2:72610760-72610782 GCATGGGGCATGGTGGTGGAGGG - Intronic
932603874 2:73150638-73150660 GCTTGAGCCAGGGAGGTCGAGGG - Intronic
933656799 2:84895211-84895233 GGCAGAGTCATGGAGGTGGGGGG + Intronic
934064307 2:88326036-88326058 GCTTGAGCCTGGGAGGTGGAGGG + Intergenic
934896834 2:98126887-98126909 GACTGTGCCAAGGAGGTGGAAGG - Intronic
935283053 2:101535917-101535939 GCCTGAGCCTGGGAGGTCGAGGG - Intergenic
936078176 2:109415021-109415043 GCCAGAGTCAGGGAAGGGGATGG + Intronic
936371532 2:111905865-111905887 CCATGAGTCTTGGAGGTGGCAGG + Intronic
937894495 2:126968522-126968544 CACTCAGTCATGGTGGTGGATGG + Intergenic
938178922 2:129162434-129162456 GCCTGAGACATGGCCTTGGACGG + Intergenic
938269783 2:129959423-129959445 GCTTGAACCCTGGAGGTGGAGGG - Intergenic
939629543 2:144516499-144516521 GGCTGAGTCAGGAAGGAGGAAGG - Intronic
940303860 2:152204403-152204425 GCTTGAGCCCAGGAGGTGGAGGG + Intergenic
940339166 2:152561654-152561676 GCTTGAGCCTGGGAGGTGGAGGG - Intronic
941086229 2:161121500-161121522 GCCTGAGGGATGTAGGAGGAGGG + Intergenic
941693628 2:168527801-168527823 GCTTGAGCCTGGGAGGTGGAGGG - Intronic
942359738 2:175159234-175159256 GCTTGAGCCTGGGAGGTGGAGGG + Intronic
944148949 2:196537093-196537115 GCCTGAGATATGGAGGGAGAAGG - Intronic
944184139 2:196928719-196928741 GCTTGAACCAGGGAGGTGGAGGG - Intergenic
945078888 2:206068780-206068802 GCTTGAGCCCTGGAGGTTGAGGG - Intronic
945382708 2:209160805-209160827 GCATGTGCCATGGAGGTGGCAGG + Intergenic
946315858 2:218911596-218911618 CCTTGTGTCAGGGAGGTGGATGG - Intergenic
947017735 2:225640011-225640033 ACCCGAGTCATGGATGTGGCTGG - Intronic
947396360 2:229690569-229690591 CCCAGAGTGATGGAGCTGGAAGG - Intronic
947712446 2:232323846-232323868 GCCTGGGTCGGGGAGGGGGATGG - Intronic
947731405 2:232433526-232433548 GCCTGGGTCGGGGAGGGGGATGG - Intergenic
948699489 2:239751123-239751145 GCCTGAGTCCTGGAACAGGACGG - Intergenic
948953067 2:241267479-241267501 GCCTGGGTCAGGCAGGTGGCAGG - Intronic
1170060801 20:12256905-12256927 GCCTGAGTAGTGGTGGTGGGGGG - Intergenic
1171248945 20:23634339-23634361 GCCTGAGGGCTGGAGGTGGAAGG - Intronic
1171255441 20:23686306-23686328 GCCTGGGTGCTGGAGGTGGAAGG - Intronic
1171262783 20:23748228-23748250 GCCTGGGTGCTGGAGGTGGAAGG - Intronic
1171271917 20:23824432-23824454 GCCTGAGTGCTGGAGGTGGAAGG - Intronic
1171278277 20:23876607-23876629 GCCTGGGTGCTGGAGGTGGAAGG - Intronic
1171283361 20:23919175-23919197 GCCTGAGTGCTGGAGGTGGAAGG - Intergenic
1172217334 20:33245373-33245395 GCTTGAGCCATGGAGGTCAAGGG + Intergenic
1172613326 20:36267343-36267365 GCCTGATTCAGGGTGGAGGAAGG + Intronic
1172948282 20:38705167-38705189 ACCTGAGTCATAGAGGTCCAGGG + Intergenic
1172977826 20:38919853-38919875 ACATGACTGATGGAGGTGGAAGG - Exonic
1173437642 20:43047148-43047170 GCATCAGGCATGGAGGAGGATGG - Intronic
1173952957 20:47007696-47007718 GCTTGAGCCTGGGAGGTGGAGGG - Intronic
1174091603 20:48053169-48053191 ACCTGAGCCCTGGAGGTTGAGGG - Intergenic
1174454817 20:50641653-50641675 GCCTGTGGCCTGGAGGTGGCTGG - Intronic
1175093078 20:56520570-56520592 GCTTGGGTCCTGGAGGTGGACGG - Intronic
1176096412 20:63346459-63346481 GCCCGAGTCCTGCAGGTAGAAGG + Exonic
1176728572 21:10465966-10465988 GCCTGAGTGGTGGGGGTTGAGGG + Intergenic
1176988125 21:15461753-15461775 GCCTCTGTCATGAAGGTGGAGGG + Intergenic
1178540444 21:33445039-33445061 GCTTGAGCCTGGGAGGTGGAGGG + Intronic
1178794768 21:35733545-35733567 GCTTGAACCCTGGAGGTGGAGGG + Intronic
1178850506 21:36208804-36208826 GACTGAGGCAGGGAGGCGGATGG - Exonic
1179140707 21:38722615-38722637 GGCTGAGCCCTGGAGGTGGTGGG + Intergenic
1179886292 21:44315591-44315613 GGCTGGGTCATTGAAGTGGACGG + Intronic
1179900720 21:44392338-44392360 GCTTGAGCCTGGGAGGTGGAAGG - Intronic
1180627956 22:17207262-17207284 GCCAATGTCATGGAGGTGCAAGG + Exonic
1181411772 22:22727960-22727982 GCTTGAAGCAGGGAGGTGGAGGG + Intergenic
1181645086 22:24226577-24226599 TCCTGAGCCAGGGAGGAGGACGG + Intronic
1182049962 22:27305106-27305128 GCCTCTGTCAGGGGGGTGGAAGG - Intergenic
1183466984 22:37984755-37984777 GGCTTAGTCTGGGAGGTGGAGGG + Intronic
1184200995 22:42969519-42969541 GCCAGAGTTATTGAGGTGGGAGG - Intronic
950028540 3:9836742-9836764 GCTTGAGTCCAGGAGTTGGAGGG + Intronic
950580881 3:13861338-13861360 GGCTTGGTCAGGGAGGTGGAGGG - Intronic
950653272 3:14421092-14421114 CCCTGGGGCATGGAGATGGAGGG + Intronic
951091047 3:18574197-18574219 TCCTGAGTCAGTGAGGAGGAAGG + Intergenic
951163243 3:19452300-19452322 GCTTGAGTCCCAGAGGTGGAGGG + Intronic
951871629 3:27368770-27368792 GCCTGAGGCGAGGAAGTGGAAGG + Intronic
952798541 3:37265941-37265963 GCTTGAGTCCAGGAGGTGGAGGG + Intronic
952876827 3:37952314-37952336 GCCTGAGTCAGGTAGTTGGTGGG + Intronic
953775455 3:45812821-45812843 GCTTGAGCCAGGGAGGTGGGAGG - Intergenic
953891758 3:46756325-46756347 GCCTGGCTCAGGGAGGTTGAGGG - Exonic
954886447 3:53878739-53878761 GCTTGAGCCCAGGAGGTGGAAGG + Intronic
955090220 3:55743231-55743253 GCATGAGCCAGGGAGGTGGCTGG + Intronic
955387056 3:58488568-58488590 GCCTGAGCCATGCAGGTCGGAGG + Intergenic
956480887 3:69673168-69673190 GCTTGAGCCCAGGAGGTGGAGGG - Intergenic
957866057 3:86024959-86024981 GCTTGAGCCTGGGAGGTGGAAGG - Intronic
957970154 3:87373566-87373588 GCCTGAGCCCAGGAGGTTGAGGG + Intergenic
959555419 3:107711956-107711978 GCTTGAGCCTGGGAGGTGGATGG - Intronic
959946106 3:112126749-112126771 GCCTGAGGCCTGGAGGCTGAAGG - Intronic
960025408 3:113003257-113003279 GCTTGAGCCCAGGAGGTGGAGGG + Exonic
961163107 3:124746148-124746170 GCCTGCGTCCTGGAGATGGCAGG - Intergenic
961298473 3:125905830-125905852 GTTTGAGTCCGGGAGGTGGAGGG - Intergenic
963072153 3:141313112-141313134 GCCTGAGTTCTGTAGGTGGCCGG + Intergenic
964472416 3:157069261-157069283 GCCTGAGCCCAGGAGGTCGAGGG + Intergenic
964957185 3:162374507-162374529 GCTTGAGCCCAGGAGGTGGAGGG + Intergenic
965095959 3:164226184-164226206 GCTTGAACCCTGGAGGTGGAGGG + Intergenic
965792246 3:172402177-172402199 GCAAGAGTGATGGAGGTGGGTGG - Intergenic
965835157 3:172843092-172843114 AACTGAGACATGGCGGTGGAAGG - Intergenic
966332097 3:178825803-178825825 GCCTAAGTGATGGGGGAGGATGG - Intronic
966797199 3:183726882-183726904 GCTTGAACCCTGGAGGTGGAGGG - Intronic
966837490 3:184060111-184060133 GGCTCAGTCATGGAGTGGGAAGG - Intronic
966951918 3:184828220-184828242 GCTTGAGCCTGGGAGGTGGAGGG - Intronic
968188753 3:196652206-196652228 GCCTGAGTAATGTGGCTGGAAGG - Intronic
968560930 4:1281606-1281628 GCCTGAACCCAGGAGGTGGAGGG + Intergenic
968908714 4:3466072-3466094 GCCCGAGTCCTGGAGCTGGCAGG + Intronic
969664552 4:8549605-8549627 GCCGGGGTCAGGGAGGTGCATGG + Intergenic
969755280 4:9145551-9145573 GTTTGAGTCCGGGAGGTGGAGGG - Intergenic
969872756 4:10115205-10115227 GCCTGAGTGATGGAATTGGTGGG - Intronic
970076751 4:12230922-12230944 GCTTGAATCAGGGAGGAGGATGG - Intergenic
971505808 4:27365373-27365395 GCTTGAATCCAGGAGGTGGAGGG + Intergenic
972580675 4:40393302-40393324 GCTTGAGCCCAGGAGGTGGAGGG + Intergenic
973550376 4:52029149-52029171 GCATGAGTCATGGAGGAACATGG + Intronic
973666379 4:53163645-53163667 GCTTGAATCCAGGAGGTGGAGGG + Intronic
974018971 4:56676213-56676235 GCTTGAGCCTGGGAGGTGGAGGG + Intronic
974365307 4:60940522-60940544 TCCTGTGTCCTGGAGTTGGAAGG + Intergenic
974412239 4:61556435-61556457 AGCAGAGTCATGGAGGTGGGAGG + Intronic
977156581 4:93581237-93581259 TCCTGAGTGATAGAGGTGAAAGG + Intronic
977323268 4:95546942-95546964 GACTGAGCCATGGGGGTGGGTGG - Intronic
977935000 4:102791707-102791729 GCTTGAGTCCAGGAGGTCGAGGG + Intergenic
979258674 4:118630023-118630045 CCCTGAGCCATGGAGCTGTAAGG + Intergenic
979368830 4:119858592-119858614 AACTGAGTCATGGGGGTGCATGG + Intergenic
980886037 4:138763726-138763748 AACTGAGTTATGGAGATGGATGG + Intergenic
982700403 4:158654849-158654871 ACCTGAACCCTGGAGGTGGAGGG - Intergenic
983756909 4:171350002-171350024 GCTTGAGTCTGGGAGGTGGAGGG + Intergenic
984020520 4:174479219-174479241 GCTTGAGCCTTGGAGGTTGATGG + Intergenic
984102985 4:175509235-175509257 GTTTGAGTTACGGAGGTGGAGGG - Intergenic
984344438 4:178504511-178504533 GCCTGAGAACTGGAGGTGGTGGG + Intergenic
984408590 4:179366507-179366529 GCTTGAGCCAGGGAGGTGGTGGG + Intergenic
985243105 4:187951613-187951635 GCTTGAGCCCGGGAGGTGGAGGG - Intergenic
985689572 5:1299625-1299647 AGCTGAGGCCTGGAGGTGGAGGG + Intergenic
987681734 5:21144792-21144814 GACTGAGTCTTGGAGGAGGATGG + Intergenic
988394845 5:30683566-30683588 GCTTGAGCCAAGGAGGTCGAGGG + Intergenic
988540883 5:32108324-32108346 GCCTGGGTGACGCAGGTGGAAGG - Exonic
989151226 5:38301689-38301711 GCTTGGGTCATGGAGCTTGAAGG + Intronic
989815549 5:45733118-45733140 GCCTGAACCCAGGAGGTGGAAGG - Intergenic
991229853 5:64320314-64320336 GCCTGGTTCTTGGAGCTGGAGGG + Intronic
993179376 5:84531410-84531432 GGATGGGTCATGGGGGTGGAGGG + Intergenic
993549961 5:89261224-89261246 CCCTGAGGCTTGGATGTGGAAGG + Intergenic
994443817 5:99845718-99845740 GGCTGAGTAATGGAGGAGGCTGG + Intergenic
995224675 5:109689668-109689690 GCCTGGGTCCGGGAGGGGGAAGG + Exonic
995792211 5:115901635-115901657 GCCTGAGCCCGGGAAGTGGAGGG - Intronic
996132006 5:119793074-119793096 GGGGGAGTTATGGAGGTGGAGGG + Intergenic
997117357 5:131139446-131139468 GCCTGAGCCCCAGAGGTGGAGGG + Intergenic
997741725 5:136260753-136260775 GACTGAGTCATGGGGGTGGGAGG + Intronic
998528849 5:142866932-142866954 GCCTGAGACATGGAGTGGGAGGG - Intronic
999361285 5:150988701-150988723 TCCTGTATCAAGGAGGTGGAGGG + Intergenic
999858015 5:155616415-155616437 GCCAGAGTCTAGGAAGTGGAGGG - Intergenic
1000020488 5:157314446-157314468 GCCCACGTCATGGAGGTGGTAGG + Exonic
1000298620 5:159934724-159934746 GCCTGAACCCAGGAGGTGGAGGG + Intronic
1001291798 5:170468792-170468814 ACCTGAGCCCAGGAGGTGGAGGG + Intronic
1001317921 5:170657430-170657452 GCCTGAGCCAAGGCGGTGGTGGG - Intronic
1001392191 5:171388148-171388170 GCCTGAGCCCTGGACCTGGAGGG + Intronic
1002033437 5:176447691-176447713 GCCGCAGTCACGGCGGTGGACGG + Intronic
1004308570 6:14523480-14523502 GCCAGAGTCATCGAGTTTGAGGG + Intergenic
1005081236 6:21958678-21958700 GACAGAGTCATGGATATGGATGG + Intergenic
1006117450 6:31782675-31782697 GCCCGGGTCAGGGAGATGGAGGG - Intronic
1006830391 6:36964600-36964622 TCCTGAGTCCTGGGGGTGGGAGG + Exonic
1006865831 6:37208299-37208321 GCCTGGGCCAGGGAGGTGGCAGG + Intergenic
1007342160 6:41198182-41198204 GCCTGAGTCCTGGAGCTTGAGGG + Exonic
1007348287 6:41249555-41249577 GCCTGAGTCCTGGAGCTTGAGGG - Intergenic
1007529706 6:42530960-42530982 GCCTGATTAAAGGAAGTGGAAGG - Intergenic
1007743152 6:44025045-44025067 CCCTGAGACATGGAGGTGGCAGG - Intergenic
1008103876 6:47422064-47422086 GCTTGAGCCTGGGAGGTGGAAGG - Intergenic
1008352442 6:50507900-50507922 TCCTGAGCCTGGGAGGTGGAGGG - Intergenic
1008602884 6:53112822-53112844 TCCTGGGTCATGGTGGTGGTGGG - Intergenic
1009640500 6:66329203-66329225 GCCTGAACCTGGGAGGTGGAGGG + Intergenic
1010128634 6:72465226-72465248 GCATGAGTCATGGTGGTTCAAGG - Intergenic
1011585130 6:88916388-88916410 GCTTGAGTCCAGGAGGTGGAGGG + Intronic
1012467439 6:99531111-99531133 TCCTGAGTGATGGGGGTGGGGGG - Intergenic
1014173400 6:118304796-118304818 GCCTGAGGCTTGGAGATGTAGGG + Intronic
1014555227 6:122837310-122837332 GCTTGAGCCTGGGAGGTGGATGG - Intergenic
1016032207 6:139349629-139349651 GCATGATTGATGGAGGTGGTTGG + Intergenic
1017527937 6:155259131-155259153 CCCTGATTCATGGGGGAGGAGGG - Intronic
1017725281 6:157272716-157272738 GCCCGAGGCATGGAGTTGGTGGG + Intergenic
1017786882 6:157763599-157763621 GGGTGACTCATGGAGGAGGAGGG - Intronic
1017796760 6:157851670-157851692 GCTTGAACCCTGGAGGTGGAGGG - Intronic
1019556427 7:1633774-1633796 TCCTGAGTCAGTGTGGTGGAGGG - Intergenic
1019783424 7:2958367-2958389 ACTTGAGCCAAGGAGGTGGAGGG + Intronic
1021403470 7:20237174-20237196 ACCTGAGGCAGGGAGGTGGTGGG + Intergenic
1022564423 7:31383718-31383740 GCCTGAACCCGGGAGGTGGAGGG - Intergenic
1022592205 7:31675081-31675103 GCCTGAGTGGTGGAGGGGGCAGG + Intergenic
1022619852 7:31971886-31971908 TCCTTAGTCCTGGAGGTGCAAGG - Intronic
1025183003 7:56833379-56833401 CCCTGAGCCATGGAGCTGTAAGG - Intergenic
1025688925 7:63743595-63743617 CCCTGAGCCATGGAGCTGTAAGG + Intergenic
1025912138 7:65837775-65837797 CCCTGAGCCATGGAGCTGTAAGG + Intergenic
1025999845 7:66552156-66552178 GGCTGAGGCAGGGAGGTGGGTGG + Intergenic
1026477635 7:70750481-70750503 ACCTGAGCCTGGGAGGTGGAGGG - Intronic
1027154701 7:75758401-75758423 GCTTGAGCCCAGGAGGTGGAGGG - Intergenic
1027381444 7:77613972-77613994 GCTTGAGTCCGGGAGGTTGAGGG - Intronic
1028026529 7:85849038-85849060 GCTTGAGCCAGGGAGGTTGAGGG - Intergenic
1028472563 7:91220970-91220992 GCTTGAGCCCGGGAGGTGGAGGG - Intergenic
1028927485 7:96374883-96374905 GCTTGAGCCCAGGAGGTGGAGGG - Intergenic
1029291953 7:99508889-99508911 GCTTGAGCCTGGGAGGTGGAGGG - Intronic
1029487764 7:100853642-100853664 GCTTGAGTCCTGGAGGCGTAGGG - Intronic
1029692121 7:102189476-102189498 GCCTGAGCCCGGGAGTTGGAGGG - Intronic
1029693904 7:102200938-102200960 GCTTGAGCCAGGGAGGTGGAGGG + Intronic
1029933124 7:104394781-104394803 GCTTGAACCAAGGAGGTGGAGGG - Intronic
1030081394 7:105781920-105781942 GCTTGAGCCTGGGAGGTGGAGGG - Intronic
1030101299 7:105947841-105947863 GCCTGAGGAGTGGAGGTGGATGG - Intronic
1030110843 7:106025278-106025300 GCCTGAGTTTTGGAGTTAGATGG + Intronic
1030150952 7:106404391-106404413 GCCCGAGTCATGTGGCTGGATGG + Intergenic
1033013229 7:137644489-137644511 GCCTGAGATATGGTTGTGGAGGG - Intronic
1033236328 7:139640730-139640752 GCTTGAGCCCAGGAGGTGGAAGG - Intronic
1033284739 7:140031288-140031310 GCTTGAGCCCGGGAGGTGGAAGG + Intronic
1034601520 7:152261995-152262017 GCCTGAGTGGTGGGGGTTGAGGG - Intronic
1035655823 8:1303872-1303894 GCCAGAGCCTGGGAGGTGGAGGG + Intergenic
1035789376 8:2289813-2289835 TCGTGAGTCATGGATGTGGATGG - Intergenic
1035803429 8:2431892-2431914 TCGTGAGTCATGGATGTGGATGG + Intergenic
1036189380 8:6656355-6656377 GGCAGAGTTATGGAAGTGGAAGG - Intergenic
1036296772 8:7543689-7543711 GGGTGAGTCCTGGAGGTGGAAGG - Intergenic
1036325795 8:7777330-7777352 GGGTGAGTCCTGGAGGTGGAAGG + Intergenic
1036967792 8:13319903-13319925 GCTTGAATCTGGGAGGTGGAGGG - Intronic
1037080214 8:14775908-14775930 GCCTGTGACTGGGAGGTGGAAGG + Intronic
1037278169 8:17203888-17203910 GCTTGAATCCGGGAGGTGGAGGG - Intronic
1037931933 8:22886462-22886484 GCCTGTCTCATGGAGGTGTAAGG + Intronic
1038003115 8:23407197-23407219 ACCTGAGTGGTGGAGGTGGCAGG - Intronic
1038103104 8:24401671-24401693 GCCTAAGTCACAGAGCTGGAAGG - Intronic
1038615636 8:29091400-29091422 GGCGGAGTCATGTAGGTTGAAGG - Intronic
1039220800 8:35328101-35328123 AACTGAGTTTTGGAGGTGGAGGG - Intronic
1039956355 8:42209984-42210006 GCATGAGTCATGGAGGTGGCGGG + Intergenic
1041745906 8:61209200-61209222 GACTGAATCATGGATGTGTAAGG + Intronic
1042064292 8:64857301-64857323 GCCTGATTCATGGAGATATATGG + Intergenic
1042223306 8:66494455-66494477 GCCTGAGTCATGGAGGTGGATGG - Intronic
1042319569 8:67461011-67461033 GCGTGAGGAATGGTGGTGGAAGG + Intronic
1044834104 8:96279051-96279073 GCTTGAGCCCGGGAGGTGGAGGG - Intronic
1045118815 8:99013304-99013326 GCCAGGGACTTGGAGGTGGAGGG + Exonic
1045136762 8:99229281-99229303 GCCTGAATAATGGTGGTAGAAGG - Intronic
1045809818 8:106208293-106208315 GCTTGAGCCCAGGAGGTGGAGGG + Intergenic
1046431502 8:114134621-114134643 GCCCTAGTCATAGAGGTGGTGGG + Intergenic
1046447436 8:114341374-114341396 GCTTGAGCCATGGAGGTTGCAGG - Intergenic
1047606490 8:126479883-126479905 GCCTGGGTCATGGAGTGAGATGG - Intergenic
1048064041 8:130949709-130949731 ACCTGGGGCAAGGAGGTGGAGGG - Intronic
1048787358 8:138064165-138064187 GGCTGGGTTATGGAGGGGGAAGG - Intergenic
1049069762 8:140347271-140347293 GCCTGAGGCAGGCAGGTGGCTGG - Intronic
1049802980 8:144526845-144526867 GCGTGGGTCCTGGAGGGGGATGG - Exonic
1049813294 8:144585918-144585940 GGCTGAGCCATGGGGGTGCAGGG - Intronic
1050183270 9:2943147-2943169 CCCTGAGTCAAAGAAGTGGATGG + Intergenic
1051293746 9:15573074-15573096 GCTTGAGCCCTGGAGCTGGAAGG + Intronic
1052471310 9:28899997-28900019 GCCTGAGTCCTGGAGCTGCGGGG - Intergenic
1053111573 9:35465018-35465040 GCCTGAATCCTGAAGGTGTAGGG - Intergenic
1053120887 9:35546910-35546932 GCCAGTGCCATGCAGGTGGAAGG - Exonic
1054708316 9:68485260-68485282 GTCAGAGTTATGGAGGGGGAGGG - Intronic
1054773176 9:69101770-69101792 GCTTGAATCTGGGAGGTGGAGGG + Intergenic
1055321004 9:75083479-75083501 GACTGAATCGTGAAGGTGGAAGG - Intronic
1056520019 9:87392263-87392285 GGCTGAGGCATGGGGGTGGCAGG + Intergenic
1056628494 9:88273737-88273759 GCCTCTGTCATGGTGGGGGACGG - Intergenic
1057364790 9:94409220-94409242 GCCTGAGTCCAGGAAGTTGAGGG - Intronic
1057658542 9:96978865-96978887 GCCTGAGTCCAGGAAGTTGAGGG + Intronic
1057752021 9:97800487-97800509 GCCTGAAGTAGGGAGGTGGAAGG + Intergenic
1058017572 9:100052998-100053020 GCTTGAGCCCTGGAGGTGGAGGG - Intronic
1058324005 9:103672451-103672473 GCTTGAACCAGGGAGGTGGAGGG + Intergenic
1058552346 9:106128280-106128302 GCCTGTGTCAAGGAGATTGATGG + Intergenic
1059955938 9:119516086-119516108 GCTTGAACCAAGGAGGTGGAAGG - Intronic
1060216679 9:121742664-121742686 GCCTGAGTCCTGGGCTTGGAAGG + Intronic
1060599120 9:124866319-124866341 ACCTGAACCCTGGAGGTGGAGGG + Intronic
1060734909 9:126060623-126060645 GGCTGAGCCAGGGAGGTGGGAGG + Intergenic
1060885065 9:127145579-127145601 GCCTGAGTCAGAAAGATGGAGGG - Intronic
1060939322 9:127534597-127534619 GCCTCAGTGATGGGGGTGGAGGG + Intronic
1061032554 9:128094623-128094645 GCCTGAGTCATTGCAGAGGAGGG + Intronic
1061195292 9:129103903-129103925 GCCTCAGGTATGGAGGAGGATGG + Intronic
1061426490 9:130501681-130501703 GCCTAAATCATGAAGGAGGAGGG + Intergenic
1061537615 9:131259537-131259559 GCCACAGTGATGGAGGTGGAAGG - Exonic
1061676224 9:132217321-132217343 GCCTGAGGCAGGGAGGGGAAGGG + Intronic
1061681777 9:132246042-132246064 GCTGGAGGCATGGAGGTGGGGGG - Intergenic
1061928293 9:133818499-133818521 GCCTGAGTCCTGGTGTGGGATGG - Intronic
1062249483 9:135587134-135587156 GCCTGAGGGGTGGAGGTGGGGGG + Intergenic
1062273936 9:135721877-135721899 GCCTGAGTCAGGGTGGGGGAAGG + Intronic
1062662030 9:137641920-137641942 GCTTGAACCATGGAGTTGGAGGG - Intronic
1062708816 9:137960424-137960446 GCCTGAGAGACGGAGGGGGAGGG + Intronic
1186962701 X:14754017-14754039 GCTTGGGTCATGGAGGGGGAGGG - Intergenic
1187275049 X:17809848-17809870 GCTTGAGTCTTGGAGGTTGAGGG - Intronic
1187407546 X:19017237-19017259 TCCTGAGTGATGGATGTGCACGG + Intronic
1187486359 X:19707881-19707903 GCCCAAGCCAGGGAGGTGGATGG + Intronic
1187531625 X:20102469-20102491 GCCAGAGAGATGGGGGTGGAGGG + Intronic
1187732299 X:22268012-22268034 GCTTGAGCTAGGGAGGTGGAGGG + Intergenic
1189181047 X:39004733-39004755 GCCTGAGTCATGAAGAGGGTGGG - Intergenic
1191216935 X:57942291-57942313 GCCTGCGTGAAGGAGGAGGATGG - Intergenic
1194012793 X:88583158-88583180 GCCTGGGTCATGGGGGAAGAGGG + Intergenic
1195705053 X:107732459-107732481 GCCTGGGTGATGGAGGAGGCTGG - Intronic
1195892700 X:109712881-109712903 GCTTGAGCCTGGGAGGTGGAGGG + Intronic
1198086407 X:133286748-133286770 GCCTGAAGAAGGGAGGTGGATGG + Intergenic
1198093745 X:133357299-133357321 GCCTGAGCCTGGGAGGTGGAGGG + Intronic
1199257293 X:145731371-145731393 GTCTGAGTCATGAAAGTGGATGG + Intergenic
1201250564 Y:12053398-12053420 ACCAGAGACTTGGAGGTGGAGGG + Intergenic
1202576890 Y:26337224-26337246 GCCAGAGGCAGGGTGGTGGAGGG + Intergenic