ID: 1042223307

View in Genome Browser
Species Human (GRCh38)
Location 8:66494459-66494481
Sequence CTAAGCCTGAGTCATGGAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 194
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 183}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042223307_1042223315 16 Left 1042223307 8:66494459-66494481 CCACCTCCATGACTCAGGCTTAG 0: 1
1: 0
2: 0
3: 10
4: 183
Right 1042223315 8:66494498-66494520 CAGCCTTGAATGAAGTAGGCTGG No data
1042223307_1042223314 12 Left 1042223307 8:66494459-66494481 CCACCTCCATGACTCAGGCTTAG 0: 1
1: 0
2: 0
3: 10
4: 183
Right 1042223314 8:66494494-66494516 TTGTCAGCCTTGAATGAAGTAGG No data
1042223307_1042223316 17 Left 1042223307 8:66494459-66494481 CCACCTCCATGACTCAGGCTTAG 0: 1
1: 0
2: 0
3: 10
4: 183
Right 1042223316 8:66494499-66494521 AGCCTTGAATGAAGTAGGCTGGG No data
1042223307_1042223318 27 Left 1042223307 8:66494459-66494481 CCACCTCCATGACTCAGGCTTAG 0: 1
1: 0
2: 0
3: 10
4: 183
Right 1042223318 8:66494509-66494531 GAAGTAGGCTGGGTGTTTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042223307 Original CRISPR CTAAGCCTGAGTCATGGAGG TGG (reversed) Intronic
900806328 1:4770326-4770348 CCAAGCCTGAGTGAGGGACGTGG - Intronic
900839539 1:5037063-5037085 TTAAGGATGAGACATGGAGGTGG - Intergenic
902093678 1:13924841-13924863 CTGAGGCTGTGTCATGGATGCGG + Intergenic
904655814 1:32046243-32046265 CCAAGCCTGGGTAATGGAGCAGG - Intronic
904904555 1:33885332-33885354 CTTAGCCTGGCTTATGGAGGAGG + Intronic
905496347 1:38391106-38391128 GTAATCCTCAGTGATGGAGGTGG - Intergenic
905687983 1:39922441-39922463 CTAGGCCTGTGGCTTGGAGGAGG + Intergenic
907919545 1:58899688-58899710 CAAAGCAAGACTCATGGAGGAGG - Intergenic
908509098 1:64836935-64836957 GGAAGCTTGAGTCATGGAGCTGG - Intronic
913112038 1:115665574-115665596 CCAAGCCAGAGGAATGGAGGAGG - Intronic
915551780 1:156639530-156639552 CTAAGCCCGAGTCATGGGCCAGG + Intergenic
918073682 1:181152926-181152948 CAAAGCCTGAGGCCTGGGGGAGG - Intergenic
918699250 1:187586901-187586923 CAAAGCCTCAGTTATGCAGGAGG - Intergenic
919367129 1:196675805-196675827 CTAAGACAGAGTGAAGGAGGAGG + Intronic
919517056 1:198538814-198538836 TTGAGCCTGAGAGATGGAGGTGG + Intronic
921000303 1:211037207-211037229 CTCACCCTGAGTCATGCAAGGGG + Intronic
1062966358 10:1610514-1610536 GTAAACCTGAGTCATTGATGTGG + Intronic
1065896448 10:30167005-30167027 TTAAGTGTGAGTCATGCAGGGGG - Intergenic
1066031108 10:31426317-31426339 GTCAACCTGAGTCATGGGGGTGG - Intronic
1068983070 10:63081850-63081872 CTAGGCCAGGGTCATGGAGCTGG + Intergenic
1070599727 10:77857254-77857276 CTAAGCCTGGCACATGGAGCAGG + Intronic
1070771278 10:79083790-79083812 CTCAGCCTGTTTCACGGAGGTGG - Intronic
1073181584 10:101586934-101586956 ACAAGCCTGGGTAATGGAGGGGG + Intronic
1073853722 10:107651145-107651167 CTCAGCCTGACTCACTGAGGAGG + Intergenic
1079820565 11:25122308-25122330 CTAACTCTGTGTCTTGGAGGCGG - Intergenic
1080340943 11:31263324-31263346 CTTAGCCAGAGTAATGGAAGAGG + Intronic
1083897782 11:65628796-65628818 CTGAGCCACAGTCAAGGAGGCGG - Intronic
1084157494 11:67322319-67322341 TCAAGCCAGAGCCATGGAGGCGG + Intronic
1086151244 11:83613094-83613116 CTAAGCCTAAGTCAGGGGAGTGG + Intronic
1086739740 11:90352493-90352515 CTAAGACTTATTTATGGAGGAGG + Intergenic
1087462121 11:98458732-98458754 GTAATCCTCAGTCTTGGAGGAGG + Intergenic
1087974005 11:104521706-104521728 CTCAGCCTGAGAGATGGAGGTGG + Intergenic
1089602237 11:119623264-119623286 CTGAGCCTGGGAGATGGAGGAGG + Intergenic
1090406580 11:126479343-126479365 CTCAGCTTGTGACATGGAGGAGG - Intronic
1091783077 12:3226012-3226034 CTGAGCCTGACTCAGGGAGAGGG + Intronic
1093239570 12:16653346-16653368 GTAAGCTTGTGTCATGGTGGTGG + Intergenic
1095226614 12:39685561-39685583 ATAATCCTGAGTGTTGGAGGTGG - Intronic
1096815719 12:54200615-54200637 CAAAGACTGAGTCATGCGGGTGG - Intergenic
1099165165 12:79297037-79297059 CTAAGCCTGGCTGATGGACGTGG - Intronic
1100686345 12:96990467-96990489 GCAAGCCGGAGTCATGGAAGGGG + Intergenic
1102551557 12:113695506-113695528 CAAAGCCTGGGACATGGATGGGG + Intergenic
1102633476 12:114302195-114302217 CTGAGTCTGAGACAAGGAGGAGG - Intergenic
1103067149 12:117909032-117909054 CTAAGTTTGAGTCTTGGTGGTGG - Intronic
1103258048 12:119560133-119560155 CCAAGCTTGAGCCAGGGAGGTGG + Intergenic
1103969308 12:124660103-124660125 TTCAGCCTGAGGCATAGAGGAGG - Intergenic
1104920876 12:132290132-132290154 CAAGCCCTGAGTCAGGGAGGTGG - Intronic
1106507394 13:30383084-30383106 TTAAGCCAGAGTCAGGCAGGCGG + Intergenic
1107016282 13:35710123-35710145 CTCAGCCAAGGTCATGGAGGCGG - Intergenic
1107327401 13:39259524-39259546 CTAAGCATGAGGCAGTGAGGAGG + Intergenic
1107723780 13:43277008-43277030 CCATGCCTGAGGCAGGGAGGGGG - Intronic
1109551244 13:63903080-63903102 ATAAGCCTCAGTGTTGGAGGTGG - Intergenic
1111635470 13:90897987-90898009 CTAGGCCTGAGTCATAAAAGAGG - Intergenic
1113618360 13:111696635-111696657 CTAAGTCAGAGCCTTGGAGGTGG + Intergenic
1113623890 13:111781896-111781918 CTAAGTCAGAGCCTTGGAGGTGG + Intergenic
1115382471 14:32756338-32756360 TGGAGTCTGAGTCATGGAGGTGG + Intronic
1115657647 14:35459203-35459225 CAAAGCCTCAGGGATGGAGGGGG + Intergenic
1116093877 14:40342583-40342605 CTCAGCCTGAGTAATGATGGTGG - Intergenic
1116907341 14:50416825-50416847 CAAAGCCTGAGTCAAGAACGTGG - Intergenic
1121614917 14:95307294-95307316 CTAAGCCTGGGTCACAGGGGTGG + Intronic
1121798904 14:96757127-96757149 CAAAGCCTGAGTCATCAATGAGG - Intergenic
1123032205 14:105457228-105457250 CTGAGCCTGACTCCTGGGGGAGG - Intronic
1125729767 15:41886560-41886582 CTCACCCTCAGTCATGGAGAGGG - Intronic
1126575573 15:50193130-50193152 CTAAGCCTGAGTCTGGGCAGTGG - Intronic
1128096583 15:64960922-64960944 TTCAGCCTGAGACATGGGGGTGG + Intergenic
1128229612 15:66025377-66025399 GTCAGCCTGAGGCAGGGAGGAGG + Intronic
1128340983 15:66822360-66822382 ATAGGCCTGAGTGATGGTGGGGG + Intergenic
1129166155 15:73779268-73779290 CCAAATCTGAGTCCTGGAGGAGG + Intergenic
1129194729 15:73956960-73956982 CCCAGACTGAGTCATGCAGGCGG + Intergenic
1129717800 15:77862226-77862248 CCAGGCCTGAGGCAGGGAGGTGG + Intergenic
1129811090 15:78510534-78510556 CTAGGACTGAGGCAGGGAGGGGG + Intronic
1130460969 15:84158035-84158057 CCAGGCCTGAGGCAGGGAGGTGG - Intergenic
1131529032 15:93176629-93176651 CTTGGCCGTAGTCATGGAGGTGG - Intergenic
1131541612 15:93279640-93279662 CTCAGCCTCAGTCATGGGTGGGG + Intergenic
1133068637 16:3229952-3229974 CTGAGCCCCAGTGATGGAGGTGG + Intronic
1134094792 16:11412218-11412240 CCAAGGCTGAGACATGGAGGTGG - Intronic
1134170543 16:11965099-11965121 CTAAGTTTGAGTCTTGGATGGGG - Exonic
1134295994 16:12946420-12946442 CAAAGCCTGAGTCAAGGATTTGG + Intronic
1138184554 16:54966428-54966450 GTAAGCCTGTGTCATGAATGTGG + Intergenic
1141714533 16:85719160-85719182 CTGAGCCTGGGCCAGGGAGGTGG + Intronic
1144207159 17:12987442-12987464 CTAAGCCTGAGGGAGGGCGGAGG - Intronic
1145361518 17:22216257-22216279 CGAAGGCTGAGGCAGGGAGGCGG - Intergenic
1147254612 17:39174489-39174511 CAAAGGCTGAGGCATGGAGGTGG + Exonic
1147932978 17:43994648-43994670 CTCAGGCTGAGCCACGGAGGAGG - Intronic
1151416767 17:73971554-73971576 ATAAGCCTGAGACAAGGATGGGG - Intergenic
1152683944 17:81684427-81684449 CAAGGCCTGAGTCATGAAAGTGG + Intronic
1153311526 18:3681671-3681693 CTAAGCATGAGATTTGGAGGGGG - Intronic
1156718090 18:40036532-40036554 CAAAGCCTGGCTCTTGGAGGAGG - Intergenic
1161980140 19:7626074-7626096 CTCAGGCTCAGTCATGGAGGGGG + Intronic
1162498204 19:11035200-11035222 CCAGGCCTGAGTCCTGGCGGTGG - Intronic
1164817473 19:31216263-31216285 CTCAGCTTGAGACATGGTGGGGG - Intergenic
1166790159 19:45394568-45394590 CTCAGCTTGAGCCAAGGAGGCGG - Intronic
1166995547 19:46718037-46718059 CAAAGCCTGAGTGCTGGAGGTGG - Intergenic
1167924219 19:52810158-52810180 CGAAGCTGGAGTCAGGGAGGTGG + Intronic
926456766 2:13076139-13076161 CTAAGCCTCAGTTTTGGAGCTGG + Intergenic
932502266 2:72193666-72193688 CTAAGCCTGAGCCAGGTAGGTGG + Intronic
936811015 2:116402012-116402034 GGGAGCCTCAGTCATGGAGGTGG - Intergenic
938638481 2:133254208-133254230 CTAAGGCTTAGTCCTGGAGCTGG - Intronic
939244038 2:139599746-139599768 GAAAGCCTCAGTCATGGTGGTGG - Intergenic
939957854 2:148541542-148541564 TTAAGCATGAGACTTGGAGGAGG + Intergenic
940549118 2:155129711-155129733 GTAATCCTCAGTCTTGGAGGTGG + Intergenic
942045465 2:172097029-172097051 CAAAGCCTGGCTCCTGGAGGCGG - Intergenic
942243230 2:173983237-173983259 CTCAGCATGAGGGATGGAGGAGG + Intergenic
943440049 2:187916821-187916843 ATAAGCCTGAGTCACCTAGGTGG - Intergenic
945007276 2:205422277-205422299 ATAAGCCAGAGTCACAGAGGAGG + Intronic
1169427822 20:5510124-5510146 CTAAGCCTGAGCAAGGGTGGGGG - Intergenic
1170575296 20:17658182-17658204 CTGAGCCTGAGTCAAGGGGCAGG - Intronic
1173121553 20:40294485-40294507 CTAAGCCAGAGTCCTGGAAGTGG + Intergenic
1173864034 20:46302941-46302963 CTGGGTCTGAGGCATGGAGGGGG - Intronic
1178850507 21:36208808-36208830 CGAAGACTGAGGCAGGGAGGCGG - Exonic
1179889334 21:44327741-44327763 CTAGGGCTGAGTCCTGCAGGCGG + Intergenic
1181314426 22:21962373-21962395 CGAAGCCTGAGTACTGGAGACGG + Intronic
1182039209 22:27223399-27223421 CTAAGCCAGAGCCATGCAGATGG - Intergenic
1184550778 22:45203201-45203223 GGCAGCCTGAGTCAGGGAGGTGG + Intronic
1184602021 22:45549338-45549360 CAGAAGCTGAGTCATGGAGGTGG + Intronic
949692534 3:6656186-6656208 CTGATCCTGAGTGTTGGAGGTGG - Intergenic
950823903 3:15794458-15794480 GTACCCCTGAGTTATGGAGGGGG - Intronic
953809303 3:46097952-46097974 TCAAGTCTGAGTCATAGAGGAGG - Intergenic
954660413 3:52224066-52224088 CAAAGTCAGAATCATGGAGGTGG + Exonic
962843909 3:139258874-139258896 CTTGGCTGGAGTCATGGAGGAGG + Intronic
966483792 3:180445103-180445125 GAAAGCCTGAGTGAGGGAGGAGG - Intergenic
967329509 3:188276529-188276551 CTAATCCTCAGTGCTGGAGGTGG + Intronic
968089504 3:195891661-195891683 CTGAGGCTGAGCCCTGGAGGGGG - Intronic
968124463 3:196148344-196148366 CTAATCCTCAGTGTTGGAGGTGG + Intergenic
969309812 4:6346719-6346741 CTGAGCCTGAGTCCTGGGGCTGG + Intronic
969872758 4:10115209-10115231 CTCAGCCTGAGTGATGGAATTGG - Intronic
977613741 4:99064332-99064354 ATTAGCCTGGGTCATGGCGGGGG - Intergenic
978248249 4:106601630-106601652 CTAAGCCTAAGAGATGGATGGGG + Intergenic
980001016 4:127488239-127488261 CTGAGGCTGAGGCAAGGAGGTGG - Intergenic
981319851 4:143379089-143379111 CAAAGCCTCATTCATTGAGGTGG + Intronic
981583385 4:146273287-146273309 CTCAGCCTGAGTGATGGAGCAGG - Intronic
983468776 4:168129615-168129637 CTTCGCCAGAGTCATGGAGATGG - Intronic
985044471 4:185926337-185926359 TTTAGGCTGAGTCCTGGAGGCGG + Intronic
986990448 5:13546489-13546511 CTAAGCTTGAGTCATGTGGGAGG + Intergenic
988506561 5:31828738-31828760 CTAAGGCTGAGGCATGAAGATGG - Intronic
993490722 5:88544328-88544350 CTAAGCTTGGGTCAGGGAAGAGG - Intergenic
996770255 5:127078246-127078268 CTAAGGCTAGGTCATGGAGGAGG + Intergenic
996851941 5:127962811-127962833 CTAAGCTTGGGGCATGGAAGGGG + Intergenic
997356949 5:133268616-133268638 CTCATCCTGAGACAGGGAGGAGG + Intronic
997595809 5:135106810-135106832 CTGAGGCTGCCTCATGGAGGTGG + Intronic
998528851 5:142866936-142866958 TCAAGCCTGAGACATGGAGTGGG - Intronic
999750783 5:154626990-154627012 CTAAGGGTGAGGCATGGAGTGGG - Intergenic
1001261007 5:170228481-170228503 CTAAAGCTGAGTCTTTGAGGTGG + Intergenic
1002307667 5:178293366-178293388 CTAGGCATGTGCCATGGAGGTGG + Intronic
1004081169 6:12394535-12394557 CTAAGGCTCTGTCAGGGAGGAGG + Intergenic
1005813110 6:29531075-29531097 CTAGGCCTGGGCCCTGGAGGAGG + Intergenic
1006840179 6:37023356-37023378 CCCTGCCTGAGTTATGGAGGAGG - Intronic
1006979468 6:38135410-38135432 CTAACCCTGAATTATGGATGGGG - Intronic
1008660966 6:53667343-53667365 CTTTACCTGAGTCAAGGAGGTGG - Intergenic
1012296654 6:97532798-97532820 GTGAGCCTGAATCATGGAAGTGG - Intergenic
1016918667 6:149268938-149268960 CTAAGCATGAGTCTGGGAGCTGG + Intronic
1017406495 6:154125394-154125416 CTAAACCTGTGTAATGGAAGAGG - Intronic
1018219329 6:161562605-161562627 CTATGCCTGAAGCATGGAGAAGG - Intronic
1018856718 6:167680240-167680262 ATAACCCTGAGACATGGTGGAGG - Intergenic
1020074503 7:5248793-5248815 CTAAGCCTGTGGCCTGGAAGGGG - Intergenic
1022803934 7:33802950-33802972 CTAAGCCTGAGGCACTGAGAAGG - Intergenic
1023608821 7:41954389-41954411 CCAAGCCTGACTCCTGGAGAGGG + Intergenic
1026622911 7:71966369-71966391 GTAATCCTCAGTGATGGAGGTGG + Intronic
1026742241 7:72986129-72986151 CTAAGCAGGAGCCATGGAGAAGG - Intergenic
1026802089 7:73406549-73406571 CTAAGCAGGAGCCATGGAGAAGG - Intergenic
1026858681 7:73770767-73770789 CTCAGCCTGAGTCCGGGCGGTGG + Intergenic
1027028365 7:74870868-74870890 CTAAGCAGGAGCCATGGAGAAGG - Intergenic
1027101494 7:75378949-75378971 CTAAGCAGGAGCCATGGAGAAGG + Intergenic
1031809388 7:126346955-126346977 CGATGCCTGAGCCATGGAGAGGG + Intergenic
1032821642 7:135529485-135529507 CAAAGCCTTAGTCATTGAAGAGG + Intergenic
1034418004 7:150975216-150975238 CTCAGCCTCGGGCATGGAGGAGG - Intronic
1035281012 7:157778202-157778224 GTCAGCCTGAGCCATGCAGGCGG - Intronic
1036792807 8:11733815-11733837 CCAAGCCTGTGTCATCGGGGTGG - Intronic
1039956353 8:42209980-42210002 GAATGCATGAGTCATGGAGGTGG + Intergenic
1042223307 8:66494459-66494481 CTAAGCCTGAGTCATGGAGGTGG - Intronic
1043334329 8:79155515-79155537 ATAATCCTGAGTGTTGGAGGTGG + Intergenic
1043888190 8:85626664-85626686 GTAAGCCCGACACATGGAGGGGG + Intergenic
1045013606 8:97980089-97980111 CTGTGGCTGAGTCTTGGAGGTGG + Intronic
1047672367 8:127162288-127162310 CTAAACGTGGGTCATGGTGGAGG - Intergenic
1047688365 8:127323920-127323942 CTAATCCTCAGTTTTGGAGGTGG + Intergenic
1047691445 8:127358847-127358869 CTAAGTCTGCCTCAAGGAGGGGG - Intergenic
1049612220 8:143560985-143561007 CTCACCCTGAGGCATGGAGATGG - Exonic
1054768756 9:69065452-69065474 CTCAGCCTGAGCCCAGGAGGTGG + Intronic
1054841500 9:69746093-69746115 CTGAGCCTGAGTCCTGAATGAGG - Intronic
1059651840 9:116322502-116322524 CAAAGCCTGGTTTATGGAGGAGG + Intronic
1060734907 9:126060619-126060641 CTAGGGCTGAGCCAGGGAGGTGG + Intergenic
1061032552 9:128094619-128094641 CTCAGCCTGAGTCATTGCAGAGG + Intronic
1186317057 X:8382309-8382331 CTGATCCTCAGTCAAGGAGGGGG + Intergenic
1186321180 X:8426960-8426982 CTAACCCTCAGTCCTTGAGGAGG + Intergenic
1187489373 X:19736636-19736658 CTAATCATGAGTTAGGGAGGTGG + Intronic
1189181049 X:39004737-39004759 ATGAGCCTGAGTCATGAAGAGGG - Intergenic
1189401183 X:40670119-40670141 CTAAGTGTGAGACATGGTGGGGG + Intronic
1190028625 X:46950227-46950249 CTAAAACTGAGTTATGGAGATGG - Intronic
1190041908 X:47078578-47078600 CAAAGCCTGCGCCAGGGAGGAGG + Exonic
1192429697 X:71103616-71103638 CAAAGGCAGAGACATGGAGGAGG + Intergenic
1199393337 X:147306901-147306923 CTAATCCTCAGTGTTGGAGGTGG - Intergenic
1199581521 X:149365312-149365334 ATATTCCTGAGTAATGGAGGTGG - Intergenic
1200216045 X:154368701-154368723 CCAAGCTTGAGTCTTCGAGGTGG - Intronic
1202378284 Y:24257145-24257167 CCAGGCCTGAGGCAGGGAGGTGG + Intergenic
1202492498 Y:25412976-25412998 CCAGGCCTGAGGCAGGGAGGTGG - Intergenic