ID: 1042223308

View in Genome Browser
Species Human (GRCh38)
Location 8:66494462-66494484
Sequence GGGCTAAGCCTGAGTCATGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 191
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 175}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042223308_1042223318 24 Left 1042223308 8:66494462-66494484 CCTCCATGACTCAGGCTTAGCCC 0: 1
1: 0
2: 2
3: 13
4: 175
Right 1042223318 8:66494509-66494531 GAAGTAGGCTGGGTGTTTGCTGG No data
1042223308_1042223316 14 Left 1042223308 8:66494462-66494484 CCTCCATGACTCAGGCTTAGCCC 0: 1
1: 0
2: 2
3: 13
4: 175
Right 1042223316 8:66494499-66494521 AGCCTTGAATGAAGTAGGCTGGG No data
1042223308_1042223314 9 Left 1042223308 8:66494462-66494484 CCTCCATGACTCAGGCTTAGCCC 0: 1
1: 0
2: 2
3: 13
4: 175
Right 1042223314 8:66494494-66494516 TTGTCAGCCTTGAATGAAGTAGG No data
1042223308_1042223315 13 Left 1042223308 8:66494462-66494484 CCTCCATGACTCAGGCTTAGCCC 0: 1
1: 0
2: 2
3: 13
4: 175
Right 1042223315 8:66494498-66494520 CAGCCTTGAATGAAGTAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042223308 Original CRISPR GGGCTAAGCCTGAGTCATGG AGG (reversed) Intronic
900722036 1:4183060-4183082 GGGCTCAGCCTAAGTGGTGGGGG + Intergenic
902286648 1:15411666-15411688 GGCCTGAGGCTGAGTCTTGGGGG + Intronic
902448819 1:16484187-16484209 GGGCTCAGCCAGAGGCCTGGAGG - Intergenic
905344418 1:37301756-37301778 GGGCAAACCTTGAGTCCTGGGGG + Intergenic
905344788 1:37303883-37303905 GGGCAAACCTTGAGTCCTGGGGG + Intergenic
909288965 1:73858151-73858173 GGGGTAAGTCTGAATCTTGGTGG - Intergenic
912586676 1:110772911-110772933 GAGGTAAGCTTGTGTCATGGGGG + Intergenic
913968288 1:143394705-143394727 GGGCTAAGCTTGAGTGTGGGTGG + Intergenic
914062667 1:144220301-144220323 GGGCTAAGCTTGAGTGTGGGTGG + Intergenic
914116483 1:144746053-144746075 GGGCTAAGCTTGAGTGTGGGTGG - Intergenic
914438544 1:147681443-147681465 GCTCAAAGCCTGAGGCATGGGGG - Intergenic
915380223 1:155433468-155433490 GGGCGAAGCAGGAGTCAGGGTGG + Intronic
916210159 1:162353805-162353827 GTGCTTAGCCTGAGAGATGGAGG - Intronic
916816898 1:168362870-168362892 GGGCTAAGCGAGTGTCTTGGAGG - Intergenic
919809105 1:201398136-201398158 AGGCTAAGCCTGAGACAATGAGG + Intronic
919927571 1:202200204-202200226 GGGCTAAGCCTGCCGCCTGGTGG + Intronic
920057312 1:203202031-203202053 GGGCTATGACTGAGTCTGGGAGG + Intergenic
920310299 1:205044441-205044463 GGGTTGAGCCTGTGTCCTGGGGG + Intronic
921951521 1:220934996-220935018 TGGCTAATACTGAGTCATGGTGG - Intergenic
922691484 1:227695540-227695562 AGGCAAAGGCAGAGTCATGGAGG - Intergenic
1064544946 10:16440726-16440748 GGTCTCAGCCTGGGTCATAGAGG + Intronic
1069075881 10:64037955-64037977 GGGCTATGACTGAGTCTCGGGGG - Intergenic
1069954271 10:72040288-72040310 GTGCTCACCCTGAGTCAGGGCGG - Intergenic
1071380214 10:85051982-85052004 TGGGTAAACCTGTGTCATGGGGG - Intergenic
1073976629 10:109109219-109109241 GGGCTCAGCCTGACTTATTGAGG + Intergenic
1077544130 11:3161669-3161691 GGGCCAAGCCAGGTTCATGGTGG - Intronic
1079106125 11:17573462-17573484 GTGTTATGCCTGAGTGATGGAGG - Intronic
1079395340 11:20057453-20057475 GGGAGAAGCCTGAGTCACTGAGG + Intronic
1081851776 11:46278994-46279016 GGGCTGAGCCTGAGAGAGGGAGG - Intronic
1083852283 11:65375436-65375458 GGGCTCAGCCTGGGTCTCGGAGG + Exonic
1085215809 11:74829946-74829968 TAGCTAAACCTGTGTCATGGTGG - Intronic
1088469367 11:110176989-110177011 GGGCAAAGCTTCAGTCACGGTGG - Intronic
1088470287 11:110182515-110182537 GGTTTAAGCCTGAGAGATGGAGG + Intronic
1088670061 11:112132020-112132042 GGGTTAAGCCTGAGTCAAGCAGG + Intronic
1089574758 11:119433642-119433664 GGGCTAAGGCTGTGTCAGTGAGG - Intergenic
1092526810 12:9314532-9314554 GGGCAAAGGCTGAGTGAGGGAGG + Intergenic
1092540461 12:9417247-9417269 GGGCAAAGGCTGAGTGAGGGAGG - Intergenic
1092796632 12:12116639-12116661 GGGCAAACCCTAAGTGATGGTGG + Exonic
1092840898 12:12540203-12540225 AGGCTAAGCCTGGGAGATGGAGG + Intronic
1094484742 12:30915533-30915555 GGGCTATGCATGATTCTTGGAGG + Intergenic
1094826287 12:34271636-34271658 GGGCTCAGCCTAAGTGGTGGGGG - Intergenic
1096634553 12:52949925-52949947 TGGCTAAGGCTGAGTCATCTAGG + Intronic
1096815720 12:54200618-54200640 GGGCAAAGACTGAGTCATGCGGG - Intergenic
1101502567 12:105317658-105317680 GGGAGAAGTCTGATTCATGGTGG + Intronic
1108719517 13:53117069-53117091 GGGAGATGACTGAGTCATGGGGG - Intergenic
1113035902 13:106048406-106048428 GGGAGAAGCCTGAATCTTGGTGG + Intergenic
1114779545 14:25522660-25522682 AGGGTAAGCCTGAGACTTGGAGG + Intergenic
1117258303 14:54002824-54002846 GGGCTCAGTCTGAGGCATGAGGG - Intergenic
1118131518 14:62969681-62969703 GAGGTAAACCTGTGTCATGGTGG - Intronic
1120573633 14:86153101-86153123 GAGCAAAGCCTGAATCATGATGG + Intergenic
1122083355 14:99282507-99282529 GGGAGATGACTGAGTCATGGAGG - Intergenic
1122250682 14:100437267-100437289 GGGCTAAGGCTGGGCCGTGGGGG - Intronic
1122654716 14:103250340-103250362 GGGGTCATCCTGAGTCATGTGGG + Intergenic
1122977643 14:105177505-105177527 GGGGTCAGCCTGAGGCCTGGGGG - Intronic
1123032206 14:105457231-105457253 TGGCTGAGCCTGACTCCTGGGGG - Intronic
1129268186 15:74405800-74405822 GGGCTGAGCCTATATCATGGTGG - Intergenic
1131549689 15:93346693-93346715 GGGCTAAGCATGTTTCAGGGTGG + Intergenic
1133235225 16:4384533-4384555 GGGGTGAGCCTGAGTGCTGGGGG - Intronic
1134094794 16:11412221-11412243 GTGCCAAGGCTGAGACATGGAGG - Intronic
1135963185 16:27014717-27014739 GGGCTGTGCCTGAGTCAGGGAGG - Intergenic
1137724942 16:50650777-50650799 GGCCCCAGCCTGAGTCTTGGGGG + Intergenic
1139063991 16:63290665-63290687 GCCCAAAGCCTGAGGCATGGCGG - Intergenic
1141810543 16:86372703-86372725 TGCCTAAGCTTGGGTCATGGCGG + Intergenic
1143432523 17:6897676-6897698 GGAGGAAGCCTGATTCATGGGGG + Intronic
1144207160 17:12987445-12987467 GGTCTAAGCCTGAGGGAGGGCGG - Intronic
1146456670 17:33014446-33014468 TGGCTAAGCCTGGGGCAGGGAGG + Intronic
1147254611 17:39174486-39174508 AGGCAAAGGCTGAGGCATGGAGG + Exonic
1148735046 17:49860568-49860590 GGGCCAGGCCTGAGTCATGGGGG - Intergenic
1149567771 17:57652064-57652086 GAGAGGAGCCTGAGTCATGGAGG - Intronic
1151051421 17:70983426-70983448 GGGAGATGACTGAGTCATGGAGG - Intergenic
1154050741 18:10954634-10954656 GGGCTGAGCTAGAGTGATGGCGG + Intronic
1154405431 18:14086018-14086040 CAGCTAAGCATGAGTCTTGGTGG + Intronic
1155604536 18:27588898-27588920 GGGATATGTTTGAGTCATGGGGG + Intergenic
1156206064 18:34887275-34887297 GGGCTAAAATTGAGTCTTGGAGG - Intronic
1161487121 19:4542566-4542588 GAGCAGAGCCAGAGTCATGGGGG + Intergenic
1162091059 19:8280456-8280478 GGGGGAAGCCTCAGGCATGGGGG + Intronic
1162093293 19:8295294-8295316 GGGGGAAGCCTCAGGCATGGGGG + Intronic
1162322976 19:9980757-9980779 TGGCTGAGCCTGGGGCATGGGGG + Intronic
1163375351 19:16927022-16927044 GGGATGGGCCTGAGTCAGGGAGG - Intronic
1163477967 19:17538054-17538076 GAGCTCAGCCTGAGGGATGGGGG + Intronic
1164817476 19:31216266-31216288 GTGCTCAGCTTGAGACATGGTGG - Intergenic
1165283124 19:34814935-34814957 AGGCTAACCCTGGGTCCTGGGGG - Intergenic
1165461613 19:35947134-35947156 GGGACCAGCCTGAGTCCTGGGGG + Intergenic
1165991462 19:39817349-39817371 GAGCTAAGCCTGATTCCTGGAGG - Intergenic
1166381846 19:42358842-42358864 GGGAGCAGCCTGGGTCATGGGGG + Exonic
1166808688 19:45502058-45502080 GGGCTCAGCCTTGGACATGGAGG + Exonic
1167551387 19:50163177-50163199 GGTCAAAGCCAGAGGCATGGCGG + Exonic
1168270505 19:55247283-55247305 GCCTTAAGCCTGAGTGATGGAGG - Intronic
1168355666 19:55698228-55698250 TGGCTAAGCAAGAGTCATGGTGG + Intronic
1202702075 1_KI270712v1_random:172173-172195 GGGCTAAGCTTGAGTGTGGGTGG + Intergenic
926101433 2:10120724-10120746 GCGCTAAACCTGAGTCATCTCGG - Intergenic
926781274 2:16474288-16474310 GGGATAAGTCTGAGAGATGGGGG + Intergenic
926865568 2:17353856-17353878 GTGCTTATCCTGAGTCATGTAGG - Intergenic
927245086 2:20951144-20951166 GGGCTGAGGCTGAGGGATGGAGG + Intergenic
930500787 2:52214657-52214679 GGGAGATGCTTGAGTCATGGGGG - Intergenic
931735084 2:65186601-65186623 GTGCTGTGCATGAGTCATGGTGG + Intergenic
932360523 2:71101946-71101968 GGGCTATGACTGAGTCATGTTGG - Intergenic
932476645 2:72010746-72010768 GGGCTAAGGCAGAGGCAGGGAGG + Intergenic
933844182 2:86312047-86312069 GGGCTGAACCCGAGTCTTGGCGG - Intronic
934172987 2:89555619-89555641 GGGCTAAGCTTGAGTGCGGGTGG + Intergenic
934283301 2:91629976-91629998 GGGCTAAGCTTGAGTGCGGGTGG + Intergenic
935360132 2:102239576-102239598 GGGGTATCCCTGTGTCATGGTGG + Exonic
942711906 2:178846285-178846307 GGGCTCAGTTTTAGTCATGGAGG + Intronic
946176343 2:217924034-217924056 GGGCAGAGCCTGGGTCATGCAGG - Intronic
946225468 2:218261952-218261974 GGGCTCAGCCTCAGGCCTGGGGG + Intronic
1169427825 20:5510127-5510149 TGGCTAAGCCTGAGCAAGGGTGG - Intergenic
1170892898 20:20391227-20391249 GGATCAAGCCTGAGTGATGGTGG + Intronic
1175981782 20:62742373-62742395 GGGACACGCCTGACTCATGGTGG - Intronic
1176696127 21:9979335-9979357 GGGAGAAGACTGAATCATGGGGG + Intergenic
1176983478 21:15409425-15409447 GGGCCAAGACAGAGTCATGGAGG - Intergenic
1178492497 21:33061793-33061815 GGGCTAAGTTTGAGCCCTGGAGG + Intergenic
1178661286 21:34509809-34509831 GGGGTAAACTTGTGTCATGGGGG + Intergenic
1178983322 21:37283284-37283306 GGGGTAAGGCTCAGGCATGGCGG + Intergenic
1179883298 21:44302346-44302368 GGGCTGGGGCTGATTCATGGAGG + Intronic
1179889333 21:44327738-44327760 GGGCTAGGGCTGAGTCCTGCAGG + Intergenic
1182107215 22:27698135-27698157 AAGCTGAGCCTGAGTCACGGAGG + Intergenic
1183698051 22:39434286-39434308 GGGCTCAGCCTGGGCCCTGGTGG + Intronic
1184020571 22:41818578-41818600 GGGCTAGGCCTGAGTACTTGGGG + Intronic
1185203180 22:49521034-49521056 GTCCTAACCCTGAATCATGGAGG - Intronic
950541583 3:13616397-13616419 GAGCTGAGCCTGAATCCTGGAGG + Intronic
950834555 3:15906546-15906568 GAGCCATGCCTGAGTGATGGAGG + Intergenic
953905177 3:46865050-46865072 GGGCTAAGCCTGAGGCTGAGAGG + Intronic
954298166 3:49685554-49685576 GGGCTGAGGCAGGGTCATGGGGG + Intronic
954660412 3:52224063-52224085 GGGCAAAGTCAGAATCATGGAGG + Exonic
954670629 3:52289604-52289626 GGGCAAAGTCTGGCTCATGGTGG - Intronic
957532319 3:81456102-81456124 GGGTTAATTCTGTGTCATGGGGG - Intergenic
959216419 3:103455826-103455848 GGGATATGACTGAATCATGGGGG + Intergenic
961559289 3:127717689-127717711 GGGCTAAGCTTGAGGGATGGGGG - Intronic
965459074 3:168939410-168939432 GGGCTTTGTCTGAGTCCTGGTGG + Intergenic
969826842 4:9764479-9764501 GGGCTAAGCTTGAGTGTGGGCGG + Intergenic
973703476 4:53558981-53559003 GGGGTAAGCGAGAGTCCTGGGGG - Intronic
975468176 4:74733355-74733377 GGGGTAACCCTCAGCCATGGAGG + Intergenic
977042104 4:92028570-92028592 GGGCTCAGCCTAAGTGGTGGGGG - Intergenic
980001017 4:127488242-127488264 GGGCTGAGGCTGAGGCAAGGAGG - Intergenic
988782924 5:34539867-34539889 GGGATATGACTGAATCATGGAGG + Intergenic
989138712 5:38181333-38181355 GGGATGTGACTGAGTCATGGGGG + Intergenic
992517537 5:77510320-77510342 GGGAGATGACTGAGTCATGGGGG - Intronic
994211517 5:97092071-97092093 GGGCTATGTCTGAGTTATGTTGG + Exonic
997349778 5:133222326-133222348 GAGCTAAGACTGACTCTTGGCGG - Intronic
1000924748 5:167180004-167180026 GGGCCAAGGCTGAGTCCTGTTGG + Intergenic
1002567235 5:180118970-180118992 GGGCTCAGCCTGTCACATGGTGG + Intronic
1002573226 5:180155858-180155880 GGCTGAAGCCTGAGTCAGGGTGG + Intronic
1005555783 6:26981576-26981598 GTGCTCAGACTGAGTCATGTAGG + Intergenic
1006439935 6:34047653-34047675 GGGCCAAGGCTGAGTTGTGGGGG - Intronic
1012062477 6:94506075-94506097 GGGAGATGCTTGAGTCATGGGGG + Intergenic
1014068000 6:117149914-117149936 GGGAGATGACTGAGTCATGGGGG - Intergenic
1016204980 6:141458172-141458194 GGGCTCAGCCTAAGTGGTGGGGG - Intergenic
1016275407 6:142346149-142346171 GGTCTAAGCATCAGTCTTGGAGG + Intronic
1017998668 6:159558262-159558284 GGGCTAAGCCTCAATTTTGGGGG - Intergenic
1018746661 6:166767614-166767636 GGGCTAAGCCTGGAACATTGTGG - Intronic
1019921744 7:4167645-4167667 GGGCCAGGCCTCAGCCATGGCGG - Intronic
1023538586 7:41240320-41240342 GGGCAAAGGCTTAGGCATGGAGG - Intergenic
1023842000 7:44103337-44103359 GGACTAGGCTTGAGTCACGGGGG + Intergenic
1026224465 7:68428356-68428378 GGACTAAGCCACAGTGATGGGGG + Intergenic
1026858680 7:73770764-73770786 AGGCTCAGCCTGAGTCCGGGCGG + Intergenic
1027228080 7:76257321-76257343 GGGCTAAGCCTCCATCTTGGTGG + Intronic
1029683451 7:102128554-102128576 GGGCACAGCATGAGTCACGGTGG + Intronic
1030650591 7:112112154-112112176 GGGCTGGGCTTGGGTCATGGCGG + Intronic
1030980780 7:116182782-116182804 TTGCTAAGCCTGTATCATGGAGG - Intergenic
1034267054 7:149786148-149786170 GGGCTGAGCCTGCGTCGTGCTGG + Intergenic
1034405338 7:150899103-150899125 TGGCCAAGCCTTAGCCATGGAGG + Intergenic
1034531468 7:151698447-151698469 GGGAGAAGTCTGGGTCATGGGGG + Intronic
1036404346 8:8441606-8441628 GGGCAATGCTTGAGTCATGGAGG - Intergenic
1036790145 8:11711866-11711888 TAGCTGACCCTGAGTCATGGAGG + Intronic
1037741220 8:21610655-21610677 GGGCTACGACAGAGACATGGTGG + Intergenic
1039970938 8:42321161-42321183 GAGCTATGCCTGAGTCAGGGTGG - Intronic
1042223308 8:66494462-66494484 GGGCTAAGCCTGAGTCATGGAGG - Intronic
1042508290 8:69584368-69584390 GGGCCAAGCATGGTTCATGGAGG + Intronic
1043506725 8:80910030-80910052 GGACTGAGCCTGAGGCAGGGAGG + Intergenic
1047325160 8:123829071-123829093 GTCCTTAGCCTGAGTCATGATGG + Intergenic
1047513448 8:125532905-125532927 GGGAGATGCCTGAATCATGGGGG + Intergenic
1047672369 8:127162291-127162313 GGCCTAAACGTGGGTCATGGTGG - Intergenic
1047880293 8:129185694-129185716 GGACTTAGCCTGAGTCATGGAGG + Intergenic
1048057297 8:130879937-130879959 GGGCGATGACTGAATCATGGGGG + Intronic
1051365178 9:16316777-16316799 GGGCTACCCCTGCATCATGGAGG - Intergenic
1053434365 9:38065791-38065813 GGGCAGGGCCTGAGTCAGGGAGG - Intronic
1053633106 9:39965287-39965309 GGGAGAAGACTGAATCATGGGGG + Intergenic
1053772645 9:41498246-41498268 GGGAGAAGACTGAATCATGGGGG - Intergenic
1054210782 9:62285410-62285432 GGGAGAAGACTGAATCATGGGGG - Intergenic
1054314200 9:63563444-63563466 GGGAGAAGACTGAATCATGGGGG + Intergenic
1060939797 9:127536665-127536687 GTGGTAAGCCTGAGTGTTGGAGG - Intronic
1061717767 9:132531608-132531630 GGGCTTAGGCTAAGACATGGGGG + Intronic
1062191777 9:135251553-135251575 GGGCTAAACCTGTGTCATCCCGG + Intergenic
1186749204 X:12604260-12604282 GGGGCAAGCCTGAGTCTTGAGGG - Intronic
1189401180 X:40670116-40670138 TGGCTAAGTGTGAGACATGGTGG + Intronic
1191013615 X:55787145-55787167 GGGCAAAGCCTGATTCACTGTGG - Intergenic
1198075840 X:133191943-133191965 GTCCTAAGCCTGAGTCCTGGTGG - Intergenic
1198144654 X:133842861-133842883 GGGCCAAGCCTGATTCATTGTGG - Intronic
1201937640 Y:19425110-19425132 GGGCTCGGCCTGAGTGGTGGGGG - Intergenic
1202391794 Y:24378781-24378803 GTGCTAAGCCTGGGCCATGAGGG - Intergenic
1202478991 Y:25291336-25291358 GTGCTAAGCCTGGGCCATGAGGG + Intergenic