ID: 1042223309

View in Genome Browser
Species Human (GRCh38)
Location 8:66494465-66494487
Sequence CAGGGGCTAAGCCTGAGTCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 246
Summary {0: 1, 1: 0, 2: 3, 3: 23, 4: 219}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042223309_1042223318 21 Left 1042223309 8:66494465-66494487 CCATGACTCAGGCTTAGCCCCTG 0: 1
1: 0
2: 3
3: 23
4: 219
Right 1042223318 8:66494509-66494531 GAAGTAGGCTGGGTGTTTGCTGG No data
1042223309_1042223314 6 Left 1042223309 8:66494465-66494487 CCATGACTCAGGCTTAGCCCCTG 0: 1
1: 0
2: 3
3: 23
4: 219
Right 1042223314 8:66494494-66494516 TTGTCAGCCTTGAATGAAGTAGG No data
1042223309_1042223316 11 Left 1042223309 8:66494465-66494487 CCATGACTCAGGCTTAGCCCCTG 0: 1
1: 0
2: 3
3: 23
4: 219
Right 1042223316 8:66494499-66494521 AGCCTTGAATGAAGTAGGCTGGG No data
1042223309_1042223315 10 Left 1042223309 8:66494465-66494487 CCATGACTCAGGCTTAGCCCCTG 0: 1
1: 0
2: 3
3: 23
4: 219
Right 1042223315 8:66494498-66494520 CAGCCTTGAATGAAGTAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042223309 Original CRISPR CAGGGGCTAAGCCTGAGTCA TGG (reversed) Intronic
900503531 1:3018091-3018113 CAGGGGCAAGGCCTGGCTCAGGG - Intergenic
901233785 1:7656586-7656608 CACAGGCTAAGCCTGAGCCACGG - Intronic
902301876 1:15507711-15507733 CAGGCGCTGGGCCGGAGTCAGGG + Intronic
902494273 1:16859060-16859082 CCGGGGCTGATCCTGAATCAGGG - Intronic
902944122 1:19822009-19822031 CAGGGGTTAGGGCTGGGTCAGGG - Intergenic
903004015 1:20286553-20286575 CAGGAATTAAGCCTGAGGCAGGG + Intergenic
904047323 1:27616420-27616442 CAGGGGCCAAGGCAGAGTGAGGG - Intronic
904464857 1:30701722-30701744 CAGGGGCTAAGCATGGGCCGAGG - Intergenic
904609080 1:31715296-31715318 CAGGGCCTAGGGCGGAGTCAGGG - Intergenic
904825403 1:33271009-33271031 CAGGGGCTGCGCCTGGGCCAGGG - Intronic
911056140 1:93710220-93710242 CAGGGGCAAAGCCAGAAACAAGG - Intronic
911862065 1:102964471-102964493 CAGAGGTTAACCCTGAGGCAAGG - Intronic
913071918 1:115307005-115307027 CTGGGGCTAAGCCCAGGTCAGGG + Intronic
913968287 1:143394702-143394724 CAGGGGCTAAGCTTGAGTGTGGG + Intergenic
914062666 1:144220298-144220320 CAGGGGCTAAGCTTGAGTGTGGG + Intergenic
914116484 1:144746056-144746078 CAGGGGCTAAGCTTGAGTGTGGG - Intergenic
916786283 1:168089471-168089493 CTGCGCCTAAGCCTGTGTCATGG - Intronic
916811134 1:168306757-168306779 CAGGCTCTACTCCTGAGTCAGGG + Intronic
918202332 1:182279182-182279204 CAGGGGACAGGTCTGAGTCAAGG + Intergenic
918478118 1:184947728-184947750 CAGGAGCTAAGTGTGAGCCAAGG + Intronic
922336312 1:224621311-224621333 CAGAGGCTGAGCCTGTGACAAGG - Intronic
922595745 1:226811374-226811396 TAGGGCCTAGGCCTGGGTCAGGG - Intergenic
922691485 1:227695543-227695565 CAGAGGCAAAGGCAGAGTCATGG - Intergenic
923568056 1:235091470-235091492 CTGGGGACAAGCCTGAGTCTCGG - Intergenic
924707041 1:246509982-246510004 CCGGGGCTAAGCCTGCCCCATGG + Intergenic
1064086223 10:12348772-12348794 AAGGGGCCAAGCGTGAGCCAGGG + Intergenic
1066632166 10:37468280-37468302 CTGGGGCTGAGCCTGAGTCCAGG - Intergenic
1069722629 10:70559540-70559562 CAGGGGCTGTCGCTGAGTCAAGG + Intronic
1071390802 10:85173639-85173661 GAGGGGCTAATTCTTAGTCAAGG - Intergenic
1074992829 10:118725976-118725998 CAGGGCGTCAGCCTCAGTCAAGG - Intronic
1076061864 10:127419329-127419351 CAGGGGCTAGGCAGGAGGCATGG + Intronic
1076247975 10:128962253-128962275 CGGGGAATGAGCCTGAGTCAAGG + Intergenic
1078386717 11:10899100-10899122 CAGGGTCTGGGCCTGAATCATGG + Intergenic
1078496117 11:11818828-11818850 CAGGGAGAAAGCCTGAGGCAAGG - Intergenic
1079106126 11:17573465-17573487 CAGGTGTTATGCCTGAGTGATGG - Intronic
1083698850 11:64461021-64461043 CAGGGGTTGATCCTGAGACAAGG + Intergenic
1084276026 11:68051377-68051399 CAGGGGCTGAGCCTGACTCCAGG + Intergenic
1084380212 11:68807083-68807105 CAGAAGCTAAGTCTGAGTCACGG + Intronic
1084747829 11:71184429-71184451 CAGGGGCAAACTCTGAATCAAGG - Intronic
1085410803 11:76289204-76289226 CAGGGGTGAAGCCTGGGGCAGGG + Intergenic
1086151242 11:83613088-83613110 GATAGGCTAAGCCTAAGTCAGGG + Intronic
1087496564 11:98897943-98897965 CAGAAGCAAAGCCTGAGCCAGGG + Intergenic
1089343447 11:117775245-117775267 CAGGGTCTGAGGCTGAGTCCAGG - Intronic
1093356323 12:18172839-18172861 CAGGTGCTCAGAATGAGTCAGGG - Intronic
1096630733 12:52925334-52925356 CAGGGGCTCAGGCTGAGTCAGGG + Intronic
1099115439 12:78618581-78618603 CTGGGGATAAGCCAGAGTGATGG - Intergenic
1100774844 12:97962689-97962711 CACTGGCTAAGCTTAAGTCACGG - Intergenic
1101601709 12:106215417-106215439 CAGGGGCTAAGGCTGGGGCTGGG + Intergenic
1101759787 12:107649116-107649138 CAGGAACTAAGCCTGAGTTGGGG + Intronic
1101825448 12:108216870-108216892 CAGGCCCTAAGGCAGAGTCATGG + Intronic
1104221850 12:126792512-126792534 CAGAGGCTCAGCCAGAGCCATGG - Intergenic
1104428937 12:128700882-128700904 CAGAAGCTGAGCCTGAGACAAGG + Intronic
1104801130 12:131555915-131555937 CAGGGCCTCAGCCTGACCCAGGG + Intergenic
1104973990 12:132543931-132543953 CAGAGGCCAGGCGTGAGTCAGGG - Intronic
1105447478 13:20470235-20470257 CCGGGGCCAGGCCTGAGTCGCGG - Intronic
1105984357 13:25550619-25550641 CAGGTGCTAAGCCTGTGATAAGG + Intronic
1107204948 13:37773071-37773093 CAGGGGCAAAGATTCAGTCAGGG + Intronic
1107249757 13:38345603-38345625 CAGGGGCTAAGCAGGAGGGAGGG + Intergenic
1108209731 13:48125924-48125946 CAGGGACTAAGCAGGAGTCCTGG + Intergenic
1109086658 13:57981935-57981957 CATGGGCTAAGCCTGATTTCAGG - Intergenic
1114516642 14:23303887-23303909 CAGGGGCTTTGTCTGATTCATGG + Intronic
1117417264 14:55508609-55508631 CAGGGGCTAGGGATGAGTGAAGG - Intergenic
1118506976 14:66424048-66424070 CAGGGGCTAGGCATGGGTCTAGG - Intergenic
1118571246 14:67197616-67197638 CAAGAGCTAAGCCTCAGTTATGG + Intronic
1121832644 14:97065472-97065494 CAGAGGCTATGCCTGATACATGG + Intergenic
1122869908 14:104633771-104633793 CAGGGCCTCAGGCTAAGTCAGGG - Intergenic
1122948001 14:105021990-105022012 CTGGGGCAAAGCCCGAGGCAGGG + Intergenic
1124637451 15:31374085-31374107 CAGTGGCTAGGCCTGGGTCCTGG - Exonic
1126556022 15:49988513-49988535 CAGGGTTTGAGCCAGAGTCAGGG + Intronic
1126859850 15:52872976-52872998 CAGGAGCTCAGCCTGGGGCAGGG - Intergenic
1128335024 15:66780259-66780281 AGGAGGCTAAGGCTGAGTCAGGG + Intronic
1128731253 15:70022962-70022984 CATGGGCTAAGCCCCAGTCTGGG - Intergenic
1129461225 15:75700955-75700977 CAGGGCAGAAGCCTGGGTCAGGG + Intronic
1130766848 15:86879448-86879470 CTGGGGCTTGGCCTGAGTCCAGG + Intronic
1130931175 15:88429174-88429196 CAGGGGGAAAGCCAGAGTCCTGG + Intergenic
1132993618 16:2811145-2811167 CAGGGGCTCAGCGTAACTCAGGG + Intergenic
1132993625 16:2811195-2811217 CAGGGGCTCAGCGTAACTCACGG + Intergenic
1132993629 16:2811220-2811242 CAGGGGCTCAGCATAACTCACGG + Intergenic
1132993639 16:2811295-2811317 CAGGGGCTCAGCATAACTCACGG + Intergenic
1132993649 16:2811370-2811392 CAGGGGCTCAGCGTAACTCACGG + Intergenic
1132993654 16:2811395-2811417 CAGGGGCTCAGCGTAACTCAGGG + Intergenic
1132993669 16:2811495-2811517 CAGGGGCTCAGCGTAACTCACGG + Intergenic
1132993674 16:2811520-2811542 CAGGGGCTCAGCGTAACTCAGGG + Intergenic
1134295993 16:12946414-12946436 TAGAAGCAAAGCCTGAGTCAAGG + Intronic
1134762202 16:16724263-16724285 CAGGAGCAAAGCCTGAAACAGGG - Intergenic
1134983858 16:18634907-18634929 CAGGAGCAAAGCCTGAAACAGGG + Intergenic
1136369173 16:29825301-29825323 CAGGGGCCAAGCCTGAGGGCTGG + Intronic
1138505718 16:57477302-57477324 CAGGGGCCAAGCCAGGGTCAGGG - Intronic
1139641821 16:68297099-68297121 CAGGGGCAAAGCCTGATATAGGG + Intronic
1139911217 16:70398734-70398756 CAGGGGCCCCGCCTGACTCAGGG - Exonic
1140994940 16:80250072-80250094 CAGGGGCTGAAACTGAGGCAAGG + Intergenic
1141672889 16:85502110-85502132 CAGGCGCTGAGCCTGAGGGAAGG + Intergenic
1141869630 16:86775796-86775818 CAGGGGCTGAGCATTTGTCAGGG + Intergenic
1142039214 16:87881850-87881872 CTGGTGCTAATCCTGAGACACGG - Exonic
1142235992 16:88922781-88922803 CAGGGGCAAAGCCTGTGCCACGG - Intronic
1142699267 17:1649516-1649538 CAGGGCCGAAGCCTGAGACCCGG - Intronic
1143334143 17:6159745-6159767 CTGGGGCTCAGCCTGGGACAGGG - Intergenic
1143411627 17:6712916-6712938 CAGGGGCTGAGCCTAAGGCTGGG + Intronic
1144207161 17:12987448-12987470 CACGGTCTAAGCCTGAGGGAGGG - Intronic
1146372764 17:32275627-32275649 CAAGGGCTCAGCCTGAGTTCAGG + Intronic
1146791838 17:35755300-35755322 CAGGGGCAAGGACAGAGTCAGGG + Intronic
1148246829 17:46037510-46037532 CACAGGCTAAGCCTGGGTGAGGG - Intronic
1148495019 17:48048407-48048429 CAGGCCCTAAGCCCGAGTCCCGG - Exonic
1148519157 17:48253187-48253209 GAGAGGCTAAGGCTGAGGCAAGG + Intronic
1149380330 17:56087224-56087246 CAATGGCTAAGCCTTAGCCATGG + Intergenic
1151691986 17:75692204-75692226 AGGGGGCTAAGACTGAGTCTAGG + Intronic
1152070113 17:78130186-78130208 CAGGTGCTAGGCCTGGGTCTTGG + Intronic
1152077365 17:78168130-78168152 CTGGGGCTAAGCCTGGGGTAGGG - Intergenic
1152392244 17:80009841-80009863 CGGGGGCTTAGCCTTGGTCATGG + Intronic
1152784692 17:82241628-82241650 CAGGGGCTGAGCCTCACCCACGG + Intronic
1152808639 17:82371071-82371093 CAGGGGTTCAGCATGAGTGAAGG + Intergenic
1154175739 18:12086615-12086637 CAGGGCCACAGCCTGAGCCAGGG - Intergenic
1157753211 18:50195958-50195980 CAGGGGCCACCCCTGGGTCAGGG - Intergenic
1159055013 18:63454689-63454711 CTGTGAGTAAGCCTGAGTCAAGG - Intergenic
1159943314 18:74425635-74425657 GAGGGGCTAAGCCTGCAGCATGG + Intergenic
1161081974 19:2315801-2315823 GAGGGTGTAAGCCTGAATCATGG + Intronic
1161115694 19:2495418-2495440 CAGGGGCGGTGCCTGAGCCAGGG + Intergenic
1161457034 19:4374723-4374745 CAGGGGCCAGGCCAGAGCCAAGG - Intronic
1161722131 19:5908991-5909013 CAGGCGCTCAGCCTCAGCCAGGG - Exonic
1162004912 19:7771532-7771554 CAGGGACAAAGCCTGTGACAAGG - Intergenic
1162438698 19:10679661-10679683 TCAGGGCTAAGCCTGAGCCAGGG - Intronic
1162885459 19:13693821-13693843 CAGGAGCCAAGCCTGCGACAAGG + Intergenic
1162906749 19:13828601-13828623 AAGGGGGTTAGCCTGAGTCTTGG - Intronic
1165423654 19:35733974-35733996 CAGGGGCCAAGCCTGAGGCTCGG + Intronic
1166333354 19:42091254-42091276 CAGGGTCCAAACCTGAGTGAGGG - Exonic
1167983604 19:53297117-53297139 CCGGGGATAAGCATGGGTCATGG + Intergenic
1202702074 1_KI270712v1_random:172170-172192 CAGGGGCTAAGCTTGAGTGTGGG + Intergenic
926339248 2:11891143-11891165 CAAGGGCTGAGTCTGAGTCCTGG + Intergenic
930472358 2:51834304-51834326 CACTGGGTAAGCCTGAGACAAGG - Intergenic
933528072 2:83469013-83469035 AAGGGGGAAAGCCTGAGCCAGGG - Intergenic
933837049 2:86254381-86254403 CAGGGGCTAAGCATGACAAAAGG + Intronic
934172986 2:89555616-89555638 CAGGGGCTAAGCTTGAGTGCGGG + Intergenic
934283300 2:91629973-91629995 CAGGGGCTAAGCTTGAGTGCGGG + Intergenic
934512933 2:94962036-94962058 CTGGGGCTATGCCTGAGTCTGGG - Intergenic
935822298 2:106906398-106906420 CAGTGGCAAAGCCTGATGCAGGG + Intergenic
937021910 2:118665040-118665062 GAGGGGCAAAGCTTGAGGCAAGG - Intergenic
937206259 2:120238924-120238946 CTCTGACTAAGCCTGAGTCAGGG - Intergenic
937573454 2:123391607-123391629 GAGGGACTAAGCCTGAGGAATGG + Intergenic
943588061 2:189763645-189763667 CAGGGGAAAAGCCTGACTCTTGG - Intergenic
946060996 2:216941459-216941481 CAGGGGCTCAGCATGATTCCTGG + Intergenic
946340303 2:219062226-219062248 CTGGGGCTGGGCCAGAGTCATGG - Intergenic
946713277 2:222527724-222527746 CTGGGCCTAAGCCTGAGTCAGGG - Intronic
947912135 2:233808471-233808493 CAAGGGCAAAGCCTGAGGCATGG - Intronic
948675855 2:239596203-239596225 CAGGGGCTCAGCCTCACTCGGGG - Intergenic
1170454263 20:16517896-16517918 CTGGGGCTAAACCAAAGTCATGG + Intronic
1170460921 20:16575617-16575639 CAGAGGGGAAGCCTGAGACATGG + Intergenic
1174142762 20:48427934-48427956 CAGGGGCTGAGGCTGGGTGATGG + Intergenic
1174582934 20:51585512-51585534 CAGGCGCTTAGCCTCAGTCTTGG - Intergenic
1176021021 20:62962525-62962547 CAGGGGCTCAGCCTGCACCAGGG + Intronic
1176307677 21:5132676-5132698 CAGGGGCAGAGCCTGAGTTTGGG - Intronic
1176983479 21:15409428-15409450 CATGGGCCAAGACAGAGTCATGG - Intergenic
1178117158 21:29429039-29429061 GACGGGCTTAGCCTAAGTCAGGG - Intronic
1178893067 21:36536151-36536173 ATGAAGCTAAGCCTGAGTCAGGG - Intronic
1179442328 21:41403987-41404009 CAGGGGCTGTGTCTGAGTCCCGG + Intronic
1179715220 21:43282842-43282864 CAGTGGCTGAGGCTGAGTCCAGG + Intergenic
1179835315 21:44027922-44027944 GAGGGTGTAAGTCTGAGTCAAGG - Intronic
1179849383 21:44129354-44129376 CAGGGGCAGAGCCTGAGTTTGGG + Intronic
1180163275 21:46007360-46007382 CAGGGGCTGAGGCTGTGCCACGG - Intergenic
1180948006 22:19707501-19707523 CAGGGGCTCGGCCTGGGTGAGGG - Intergenic
1181176982 22:21043496-21043518 AAGGGGTTGAGGCTGAGTCATGG + Intergenic
1182246768 22:28964425-28964447 CAGAGGCTGAGCCTGGGCCAGGG + Intronic
1182473870 22:30565190-30565212 CAGGCTCTAAGGCTGAGTGAGGG + Intronic
1183407352 22:37636895-37636917 CAGGGGTTAAGGCAGAGCCAAGG + Intronic
1183590824 22:38778383-38778405 CTGGGGCTATGCCTGGGCCAGGG + Intronic
1184834007 22:47009925-47009947 CACTGGCTGAGTCTGAGTCAGGG + Intronic
1185053866 22:48567853-48567875 CATGGGCTGAGCCTCAGCCAGGG - Intronic
1185364722 22:50432229-50432251 CAGGGGGACAGCGTGAGTCAGGG - Intronic
949576107 3:5340519-5340541 CAGAGGCAGAGCCTGAGACAAGG - Intergenic
951634760 3:24761130-24761152 CAGGGCCTAACCCGTAGTCAAGG + Intergenic
954903279 3:54038640-54038662 AAGGGCCTCAGCCTGAGTCTGGG + Intergenic
956740223 3:72269894-72269916 CAGGGCCTAACCTTGAATCAAGG - Intergenic
960956407 3:123034508-123034530 CAGTGGCTAAACTTGAGTGATGG + Intergenic
961621760 3:128229892-128229914 CATGGGCTAGGCATAAGTCAAGG - Intronic
962704211 3:138027747-138027769 CAGGGGCTCTGTCTGTGTCAGGG + Intronic
966886250 3:184379667-184379689 CAGAGGCTAGGCCTGAGGCCTGG - Intronic
968607043 4:1540415-1540437 CCGAGCCTAAGCCTGAGCCAAGG - Intergenic
969230670 4:5828102-5828124 GAAGGGCTTAGCCAGAGTCACGG - Intronic
969671950 4:8594534-8594556 CAGTGGCTGTGCCTGGGTCAGGG - Intronic
969826841 4:9764476-9764498 CAGGGGCTAAGCTTGAGTGTGGG + Intergenic
970471619 4:16384909-16384931 CACCGCCTAAGCCTGTGTCAAGG - Intergenic
974324802 4:60399381-60399403 TAGGTGCTAACCCTGAGACAAGG - Intergenic
975854223 4:78606106-78606128 CAGGGGAAAAGACAGAGTCAGGG + Intronic
979448444 4:120840580-120840602 AAGGGGCTGGGCCTGGGTCACGG - Intronic
981268842 4:142820039-142820061 CAGGAGCAGAGCCTGAGACAAGG - Intronic
983268991 4:165539055-165539077 CTTGGACTAAGCCAGAGTCATGG + Intergenic
983356036 4:166658205-166658227 TAGAGGCAAAGCCTGAGACAGGG - Intergenic
983636546 4:169903148-169903170 CAGGGGCAAAGGCTGAGAGATGG - Intergenic
983809477 4:172041827-172041849 CACGGGCTAGACCAGAGTCAAGG - Intronic
985678390 5:1243857-1243879 AAGGGGCCAAGCCTGAGTTCAGG + Intronic
985784781 5:1887850-1887872 CAGGGGCAAAGCCTAGGTCCGGG + Intergenic
985808933 5:2069022-2069044 CAGGGGCCAAGCCCGAAGCAGGG - Intergenic
991025102 5:62020571-62020593 CAGTGGCCAAGCCAGAGTGAGGG - Intergenic
992260503 5:74965800-74965822 GATGGGCTAAGCCTGAGACATGG + Intergenic
993614664 5:90096874-90096896 CAGGGGCGGCTCCTGAGTCATGG - Intergenic
996450532 5:123617830-123617852 CAGTAGCTGAGCCTGAGTCATGG + Intergenic
996677419 5:126192578-126192600 CAGGGGCAAATCCTGAGTCAAGG - Intergenic
997385282 5:133467591-133467613 CAGAGGGTGGGCCTGAGTCAAGG + Intronic
998732981 5:145102412-145102434 CAGGGGATCCGCCTGAGTAATGG - Intergenic
999107695 5:149088156-149088178 AAGGGGCTAAGCTTGGGTTAGGG - Intergenic
999282151 5:150372913-150372935 CAGGGGCTCAGCAAGTGTCAAGG + Intronic
1001542657 5:172550368-172550390 GAGTGGCCAAGCCTGGGTCATGG - Intergenic
1002877607 6:1225519-1225541 CAGGGCCTAGGCCTGTGTCCTGG + Intergenic
1003105377 6:3211218-3211240 CAGGGCCTAGGCATGAGCCAAGG + Intergenic
1004175162 6:13333516-13333538 CAGGGGCTGTGCCTGAAGCATGG + Intergenic
1007179377 6:39917468-39917490 CGGGGGCAAGGCCTGAGTCCTGG + Intronic
1007570264 6:42884959-42884981 CATAGGCTAAGGCTGGGTCAAGG + Intronic
1018013673 6:159693563-159693585 CAGGGGCGGAGCCGGAGGCAGGG - Intronic
1018261902 6:161978760-161978782 CAGTGGTTATGCCTGAGGCAAGG + Intronic
1018346407 6:162903843-162903865 CAGGGGCCCACCCTGAGGCAGGG - Intronic
1018599485 6:165524661-165524683 CAGGAGATAAGACTGACTCAGGG - Intronic
1019423594 7:962992-963014 CAGGGGCTGAGCCAGAGCCTGGG - Intronic
1020754856 7:12189801-12189823 CAGGGGACAGGCCTGGGTCACGG + Intergenic
1023841997 7:44103334-44103356 CAGGGACTAGGCTTGAGTCACGG + Intergenic
1024288272 7:47779460-47779482 CAGGAGCTGAGCCTGAGTTATGG - Intronic
1025222936 7:57131958-57131980 CAGGGGAGAATCCTGACTCAGGG - Intronic
1025615457 7:63113413-63113435 CAGGAGCTAAAACGGAGTCAAGG + Intergenic
1025633732 7:63303622-63303644 CAGGGGAGAATCCTGACTCAGGG - Intergenic
1025648964 7:63444546-63444568 CAGGGGAGAATCCTGACTCAGGG + Intergenic
1026858679 7:73770761-73770783 CACAGGCTCAGCCTGAGTCCGGG + Intergenic
1027219766 7:76206483-76206505 CAGGTGCTAAGCCACAGTGAAGG - Intronic
1029159415 7:98541087-98541109 CAGGGGCTCAGCCACAGTCCAGG - Intergenic
1031278138 7:119758378-119758400 CAGGGGCTCAGTCTGACCCATGG + Intergenic
1031974070 7:128082866-128082888 CAGGGGCTTGTTCTGAGTCAAGG - Intronic
1034066670 7:148143722-148143744 CAGAGGATGAGCCTGGGTCATGG - Intronic
1035864409 8:3067063-3067085 CAGGTGCTAAGCCTGGGGCCTGG + Intronic
1038738955 8:30199625-30199647 TAAGGGCTAAGGTTGAGTCAAGG - Intergenic
1038883829 8:31640911-31640933 CAGTGGCAAAGCCTAAGACAAGG - Intronic
1042223309 8:66494465-66494487 CAGGGGCTAAGCCTGAGTCATGG - Intronic
1044202020 8:89449632-89449654 CAGGAGATAAGACTGACTCAGGG - Intergenic
1044716374 8:95103552-95103574 CAGGGGCTGACCCTGTGTCATGG + Intronic
1048810064 8:138277439-138277461 CCAGGGCCAAGTCTGAGTCAAGG - Intronic
1049117292 8:140700270-140700292 GAGAGGCTAAGACTGAGTCCAGG - Intronic
1049274977 8:141715766-141715788 CAGAGGCGAAGACTGAGCCAGGG - Intergenic
1052226712 9:26097727-26097749 CAGAGGCTAAGCAATAGTCAAGG - Intergenic
1055991134 9:82106864-82106886 CCTAGGCTAAGCCAGAGTCATGG - Intergenic
1057251554 9:93507497-93507519 GAGGAGCTAAGCTGGAGTCATGG + Intronic
1058937292 9:109780645-109780667 CAGGGGCTAAAACTCTGTCAGGG + Intronic
1187519347 X:20000144-20000166 CAGTGGCTTAGCCTGAGTCTCGG + Intergenic
1188994076 X:36860826-36860848 CAGAGGTAAAGCCTGAGGCAAGG - Intergenic
1189560470 X:42186726-42186748 CAGGGGTCAGGCCTGAGCCAGGG + Intergenic
1191006699 X:55717610-55717632 GAGGGGCGGAGCCTGAGCCAAGG + Intergenic
1192849837 X:74942952-74942974 CAGGGGCAACTCCTGAGTCCTGG - Intergenic
1193882336 X:86938214-86938236 CAGGGGCTGAGAATGAGACAGGG - Intergenic
1195002145 X:100652128-100652150 CAGTGGTTAAGTCTGAGTCAGGG + Intronic
1195574432 X:106434031-106434053 CAGAGGCTAAGAATGAGCCATGG + Intergenic
1199649280 X:149937929-149937951 CAGGGGCCAAGCGGGAGGCAGGG + Intronic