ID: 1042223314

View in Genome Browser
Species Human (GRCh38)
Location 8:66494494-66494516
Sequence TTGTCAGCCTTGAATGAAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042223308_1042223314 9 Left 1042223308 8:66494462-66494484 CCTCCATGACTCAGGCTTAGCCC 0: 1
1: 0
2: 2
3: 13
4: 175
Right 1042223314 8:66494494-66494516 TTGTCAGCCTTGAATGAAGTAGG No data
1042223307_1042223314 12 Left 1042223307 8:66494459-66494481 CCACCTCCATGACTCAGGCTTAG 0: 1
1: 0
2: 0
3: 10
4: 183
Right 1042223314 8:66494494-66494516 TTGTCAGCCTTGAATGAAGTAGG No data
1042223301_1042223314 22 Left 1042223301 8:66494449-66494471 CCCCTCCCATCCACCTCCATGAC 0: 1
1: 0
2: 9
3: 57
4: 515
Right 1042223314 8:66494494-66494516 TTGTCAGCCTTGAATGAAGTAGG No data
1042223300_1042223314 23 Left 1042223300 8:66494448-66494470 CCCCCTCCCATCCACCTCCATGA 0: 1
1: 0
2: 4
3: 76
4: 749
Right 1042223314 8:66494494-66494516 TTGTCAGCCTTGAATGAAGTAGG No data
1042223302_1042223314 21 Left 1042223302 8:66494450-66494472 CCCTCCCATCCACCTCCATGACT 0: 1
1: 0
2: 4
3: 61
4: 450
Right 1042223314 8:66494494-66494516 TTGTCAGCCTTGAATGAAGTAGG No data
1042223303_1042223314 20 Left 1042223303 8:66494451-66494473 CCTCCCATCCACCTCCATGACTC 0: 1
1: 0
2: 3
3: 56
4: 486
Right 1042223314 8:66494494-66494516 TTGTCAGCCTTGAATGAAGTAGG No data
1042223309_1042223314 6 Left 1042223309 8:66494465-66494487 CCATGACTCAGGCTTAGCCCCTG 0: 1
1: 0
2: 3
3: 23
4: 219
Right 1042223314 8:66494494-66494516 TTGTCAGCCTTGAATGAAGTAGG No data
1042223304_1042223314 17 Left 1042223304 8:66494454-66494476 CCCATCCACCTCCATGACTCAGG 0: 1
1: 0
2: 5
3: 13
4: 224
Right 1042223314 8:66494494-66494516 TTGTCAGCCTTGAATGAAGTAGG No data
1042223306_1042223314 16 Left 1042223306 8:66494455-66494477 CCATCCACCTCCATGACTCAGGC 0: 1
1: 0
2: 6
3: 56
4: 489
Right 1042223314 8:66494494-66494516 TTGTCAGCCTTGAATGAAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042223314 Original CRISPR TTGTCAGCCTTGAATGAAGT AGG Intronic
No off target data available for this crispr