ID: 1042226106

View in Genome Browser
Species Human (GRCh38)
Location 8:66515625-66515647
Sequence CTGTCCCCCTGCTCTGGGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 415
Summary {0: 1, 1: 0, 2: 3, 3: 52, 4: 359}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042226106_1042226111 16 Left 1042226106 8:66515625-66515647 CCAGACCCAGAGCAGGGGGACAG 0: 1
1: 0
2: 3
3: 52
4: 359
Right 1042226111 8:66515664-66515686 CCCATGAACCAGTGTGTTCAGGG 0: 1
1: 0
2: 0
3: 10
4: 158
1042226106_1042226109 15 Left 1042226106 8:66515625-66515647 CCAGACCCAGAGCAGGGGGACAG 0: 1
1: 0
2: 3
3: 52
4: 359
Right 1042226109 8:66515663-66515685 TCCCATGAACCAGTGTGTTCAGG 0: 1
1: 0
2: 1
3: 13
4: 185

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042226106 Original CRISPR CTGTCCCCCTGCTCTGGGTC TGG (reversed) Intronic
900374386 1:2346863-2346885 CTGTCCTCCTAGTCTGGGTGGGG + Intronic
900400652 1:2471645-2471667 TCCTCCCCCTGCTCTGGGGCCGG + Intronic
901215675 1:7553912-7553934 CTGCCCCCCTGCTCTGTCTCTGG + Intronic
901766088 1:11501099-11501121 CTGTCCCCCTGCCCCAGGTTGGG - Exonic
901789872 1:11648541-11648563 CTCTCTCCCTGCTCAGGGGCTGG + Exonic
902625118 1:17671866-17671888 CTGAGCACCTGCTCTGCGTCAGG - Intronic
902707684 1:18217015-18217037 CCCTCCCCCTGCTGTGGGTCTGG - Intronic
902851711 1:19163452-19163474 CTGTCTCCCTGCTCAGGCTTTGG - Intronic
903536039 1:24066975-24066997 AGGTCCCCCTGCACTGGGCCTGG + Intronic
903793998 1:25914496-25914518 CTATACTCCTGCCCTGGGTCTGG + Intergenic
904263005 1:29301175-29301197 CCCTCCTCCTGCTCTGGGTGAGG - Intronic
904466218 1:30709088-30709110 CTGAGCACCTGCTCTGTGTCAGG - Intergenic
904476664 1:30769404-30769426 CTGTCCTTCTGCTCTGCCTCAGG + Intergenic
904822450 1:33255088-33255110 TTGTGCCCCTGCTCTGTGCCAGG + Intergenic
904993116 1:34609926-34609948 CTGTCCCCCTGCCCTCTGCCTGG - Intergenic
905498790 1:38419345-38419367 CTGGCCGCATGCTCTGGGCCTGG - Intergenic
905930604 1:41784162-41784184 CTGTAGCCCTGCTCTAGGGCAGG - Intronic
906180552 1:43814802-43814824 CTGTCCCTGTGGTCTAGGTCTGG + Intronic
906202848 1:43971173-43971195 CTGTGCCCATGCCCTGGGTAAGG + Exonic
910210624 1:84789058-84789080 ATCTCCCCCTCCTCAGGGTCAGG - Intergenic
913053008 1:115133462-115133484 CTGATCCCCTGTTCTAGGTCTGG - Intergenic
913221908 1:116667122-116667144 CTGTTGCCCTGCTCTGGGCAGGG - Intronic
915931437 1:160062886-160062908 ATCTCCACCTGCTCTGGTTCTGG + Intronic
916083691 1:161252964-161252986 CAGTCCCCATGATCTGAGTCGGG - Intergenic
916996542 1:170307652-170307674 ATGTTCCCCAGCTCTGAGTCAGG - Intergenic
919755578 1:201064167-201064189 CTGGCCCCCTGCCCAGGGCCTGG - Intronic
919789897 1:201284224-201284246 CTGTCCCTGAGCCCTGGGTCTGG + Intronic
920966247 1:210703865-210703887 ATGCCCTCCTGCTCTGGGGCTGG - Intronic
921148999 1:212385244-212385266 CTGTCTGCCTGAGCTGGGTCTGG - Intronic
921300991 1:213751397-213751419 CTGTCAGCGTGCTCTGGCTCAGG - Intergenic
922543093 1:226433766-226433788 CTGACCCCATGCTCAGCGTCAGG + Intergenic
923010492 1:230084163-230084185 CTGTCTCCCTGCTGTGGGAGGGG - Intronic
1063286465 10:4694064-4694086 CTGTCCCCCTGCACTATGTGAGG + Intergenic
1065413522 10:25458588-25458610 CTGAGCCCCTGCTCTGTGCCAGG + Intronic
1067165606 10:43864290-43864312 CTGTGCCCTTGCTCAGGGGCTGG + Intergenic
1067801612 10:49362975-49362997 GTGTCTCCCTCCCCTGGGTCCGG - Intergenic
1069137317 10:64782270-64782292 CAGTCCCCATGATCTGAGTCGGG + Intergenic
1069782061 10:70963084-70963106 CTGTCTCCCTGGGCTGGGTGTGG - Intergenic
1069784118 10:70977167-70977189 GTGTCCCCCTGCTCTGGAAAAGG - Intergenic
1070703638 10:78621467-78621489 CTGTCCTCCTGCTCTGTTTTAGG - Intergenic
1070782055 10:79143364-79143386 CTATCCCTCTGCTCTGGCTGAGG + Intronic
1071570093 10:86692037-86692059 CTGTCCCCGTCATCTGGGCCAGG - Exonic
1072549890 10:96469480-96469502 CTGTGCCTCTGCTCTGCCTCTGG + Intronic
1072881625 10:99234314-99234336 TTGTCCCCCTGGCCCGGGTCGGG - Intronic
1073145170 10:101275907-101275929 CCTTCTCCCTGCTCTGGGGCTGG + Intergenic
1073176721 10:101561420-101561442 CTCTCCCCCAGCTTTGGGGCTGG + Intergenic
1074415364 10:113262707-113262729 CTCTTCCCCTCCTCTGGTTCTGG - Intergenic
1074599757 10:114901632-114901654 CTGTCCCCATGCCTTGGTTCAGG + Intergenic
1075236736 10:120737276-120737298 CTGTCCCTCTGCTCTGGCACAGG - Intergenic
1075724698 10:124605295-124605317 CTGGGTGCCTGCTCTGGGTCAGG + Intronic
1075808695 10:125208838-125208860 CTGTGCCTCTGCTCTGAGGCAGG + Intergenic
1075908895 10:126106431-126106453 CACTTCCCCTGCCCTGGGTCAGG + Intronic
1077088669 11:767704-767726 CTGTGCCCCTGCCCTGTGACCGG - Exonic
1077176830 11:1194940-1194962 CTGTCCCCCAGCTGGGGGTGGGG + Intronic
1077192368 11:1260798-1260820 CTGGCAGCCTGCTCTGGGTCAGG + Intronic
1077261888 11:1626496-1626518 CTGTCCCTCAGCTCATGGTCAGG + Intergenic
1077503384 11:2919285-2919307 CTGTTCCCCTGCCCCGGCTCAGG + Exonic
1078110674 11:8389276-8389298 GTGCCTCCCTGCTCTGGGCCAGG - Intergenic
1078141640 11:8697465-8697487 GGCTCCCTCTGCTCTGGGTCAGG - Intronic
1079401902 11:20112613-20112635 GCGTCTCCCTGCTCTGGGTCTGG + Intronic
1080715415 11:34795588-34795610 CTTTCCCACTGCCCTGGTTCAGG - Intergenic
1081146025 11:39563218-39563240 CAGTCCCCATGATCTGAGTCTGG - Intergenic
1082074166 11:47963359-47963381 CTGTGTCCCTGCCCTGGGTACGG + Intergenic
1082740876 11:56909621-56909643 CTGTCCCCCCATTCTGGGTGGGG + Intergenic
1082791798 11:57350700-57350722 CTGACTCCCTGCTCTGGGCCAGG - Intronic
1083000560 11:59287349-59287371 CTCTGCCCCTGCTCTTCGTCAGG + Intergenic
1083293258 11:61701390-61701412 CTCTCCCTCTGCTCTAGGTAGGG + Intronic
1083333243 11:61908882-61908904 CTGTCCCCCTGGACTTGGTGGGG + Intronic
1083555184 11:63620486-63620508 CTGTCCACCTGCTCTGTGCGGGG - Intergenic
1084231530 11:67757120-67757142 CTGTGCCCCACCTCTGGGCCTGG - Intergenic
1084490542 11:69476091-69476113 CGATCCCCATGTTCTGGGTCAGG - Intergenic
1084665709 11:70575100-70575122 CTTGCTCCCTGCTCTGGGTGGGG + Intronic
1084955040 11:72686671-72686693 CTCTGGCCCTGCTCTGGCTCAGG + Intronic
1085324263 11:75594749-75594771 CTGAGACCCTGCTCTGTGTCAGG + Intronic
1086317418 11:85609034-85609056 CAGTCCCCATGATCTGAGTCAGG - Intronic
1087059363 11:93962926-93962948 CAGTTCCCCTGCTCAGGGTCTGG + Intergenic
1087820176 11:102702804-102702826 CTTTCCTCCTGGTCCGGGTCTGG - Exonic
1089323417 11:117641649-117641671 CTGTCTCCCTCTTCTGAGTCGGG - Intronic
1089556923 11:119320169-119320191 CCTTCCTCCTGCCCTGGGTCAGG - Intronic
1089784167 11:120896072-120896094 TTGTGCCCTTGCTCTGGGCCTGG - Intronic
1089784690 11:120899519-120899541 CTGTCCCCCTGCCATGTGCCAGG + Intronic
1089956282 11:122574367-122574389 CCATCCTCCTGCTCTGGGGCAGG + Intergenic
1090239822 11:125174154-125174176 CTGTCTCCCTGCCCTGGACCTGG - Intronic
1090334035 11:125950958-125950980 CTGTGACCCTGCTCTGTGCCTGG + Intergenic
1091803019 12:3336692-3336714 CTGTTTCCCTGCCCTGGGCCTGG + Intergenic
1094426357 12:30320906-30320928 CTGTCCCTTTTCTCTGGGACTGG - Intergenic
1097798739 12:63890128-63890150 TTTTTCCCCTGCTCTGGGCCAGG - Intronic
1097998154 12:65912957-65912979 CTGTGCCCCTGCTCTGAGGCAGG + Intronic
1098039287 12:66337787-66337809 CTAGCACCCAGCTCTGGGTCTGG - Intronic
1099223068 12:79936397-79936419 CTATGCACCTGTTCTGGGTCAGG + Intergenic
1100934449 12:99647639-99647661 CGGTGCCCCTGCTCTGAGGCAGG + Intronic
1103322355 12:120099617-120099639 CTGTGCCCCTCCCCTGGGGCAGG + Intronic
1103470295 12:121174944-121174966 CTGTCCCCTGGCTCTGTGACAGG - Intronic
1103480783 12:121248567-121248589 CTGGGTCCCTGCTCTGGGTCAGG + Intronic
1104299967 12:127555781-127555803 ATGTTCCCATGCTCTGGGGCAGG + Intergenic
1104520439 12:129469585-129469607 CTGAGCCCCTGCTCTGTCTCAGG + Intronic
1104947349 12:132422032-132422054 CTGTCCTCCTGCTATGGGGCTGG - Intergenic
1105589368 13:21776783-21776805 CTGGCCCTCTGCTCTGTGACAGG + Intergenic
1105948558 13:25210029-25210051 CTGTCCCTCAGGTCTGGGTCTGG + Intergenic
1106054939 13:26229113-26229135 CTGTCCCCCTGCTTTGAGGGGGG - Intergenic
1106157223 13:27170955-27170977 CTTTCCCCCAGCGCGGGGTCGGG + Intronic
1106392487 13:29348114-29348136 CTCTCCCCTTCCTCTGGGGCTGG - Intronic
1108497573 13:51040594-51040616 CTGGCCCCCTGCTGTGGCCCTGG - Intergenic
1111404279 13:87782052-87782074 CTGTCCACCTCTTCTGGTTCTGG + Intergenic
1113176974 13:107576070-107576092 TTATCCCTCTGCTCTGGATCAGG - Intronic
1113890241 13:113731713-113731735 TTGTCCCACTGCCCAGGGTCTGG - Intronic
1114449407 14:22815101-22815123 CTGTCTCCCTGCCTTGGCTCGGG - Intronic
1114615571 14:24066401-24066423 CTGCCCTCCTGGTCTGGGCCTGG - Exonic
1118046149 14:61973895-61973917 CTGTCCTCCTTCTCAGGGTCTGG - Intergenic
1118310147 14:64686026-64686048 CTGTACCCGAGCTCTGGGCCTGG + Intergenic
1119391720 14:74295469-74295491 TTGTCCCCCTCCTTTGGGCCAGG - Intronic
1119747074 14:77052230-77052252 ATCCCCCCCTGGTCTGGGTCAGG - Intergenic
1120717024 14:87851191-87851213 GTGTTCTCCTGCTCTGGGACTGG - Intronic
1121015749 14:90547974-90547996 CTGTGGCCCAGCTCTGGGTGGGG + Intronic
1121224963 14:92314988-92315010 CTCTATCCCTGCTCTGGGCCGGG - Intergenic
1121236520 14:92395208-92395230 CTGAGCCCCTACTGTGGGTCAGG - Intronic
1121245120 14:92456587-92456609 CTGTCCCCCTTCTCCGTGCCGGG + Exonic
1121348970 14:93157523-93157545 CTGTCCACTTGCTCTGGGGCTGG - Intergenic
1122504785 14:102225574-102225596 CTGTCACCCTTCGCTGGTTCTGG + Intronic
1122886182 14:104711420-104711442 CTGTCCCCCAGATCAGGGACAGG - Intronic
1123000445 14:105291182-105291204 CTCTGGCCCTGCTCTGGCTCTGG - Intronic
1123032120 14:105456865-105456887 CTGACCCCGTCCTCTGAGTCTGG + Intronic
1123133342 14:106006144-106006166 CTGTGCACCTGCTCTGGGGCTGG + Intergenic
1123150599 14:106177983-106178005 CTGTGCACCAGCTCTGGGGCTGG + Intergenic
1123171654 14:106378342-106378364 CTGTGCACCTGCTCTGGGGCGGG + Intergenic
1123195367 14:106610841-106610863 CTGTGCACCTGCTCTGGGGCGGG + Intergenic
1123202717 14:106681704-106681726 CTGTGCACCAGCTCTGGGGCTGG + Intergenic
1123583368 15:21736589-21736611 CTGTGCACCTGCTCTGGGGCTGG + Intergenic
1123585191 15:21753892-21753914 CTGTGCACCTGCTCTGGGGCTGG + Intergenic
1123620018 15:22179186-22179208 CTGTGCACCTGCTCTGGGGCTGG + Intergenic
1123621838 15:22196499-22196521 CTGTGCACCTGCTCTGGGGCTGG + Intergenic
1123697229 15:22887617-22887639 CTGGCCCCCTGCCCAGTGTCCGG + Intronic
1128145965 15:65332718-65332740 CTGTCCCCATGCACTGGGCTTGG - Intronic
1128248684 15:66150173-66150195 CTGGCTCCCTGCTCGGGGGCTGG - Intronic
1128613498 15:69091775-69091797 CTTTCTCCCTTCTCTGGGCCTGG - Intergenic
1128772436 15:70292301-70292323 CTTTCCCCCTTCACTGGGCCTGG - Intergenic
1129607578 15:77032363-77032385 CTGTGCCCGTGCTCTTGGCCTGG - Exonic
1129704260 15:77785515-77785537 CTGTCCCCCTGCCCTTAGTCAGG + Intronic
1129749576 15:78052069-78052091 CTCTCCCCCAGCTCTGGCTCTGG + Intronic
1129876574 15:78979368-78979390 CTGGCCCCATCCTCAGGGTCTGG + Intronic
1130097663 15:80867899-80867921 CTGTCCTCCTCTCCTGGGTCAGG - Intronic
1130113518 15:80986667-80986689 CTGGCCCCCCGCTCTGCCTCAGG - Intronic
1130117294 15:81016140-81016162 CTGGCAACCTGCTCTGGGGCAGG + Intronic
1131176173 15:90211139-90211161 CAGTCCCTCTGCTCAGGGGCTGG - Intronic
1131844968 15:96481202-96481224 CTCTCCGCCTACTCTGGCTCAGG - Intergenic
1132205517 15:99983673-99983695 CTGTCTCCCCGCACTGGGTCTGG + Intronic
1132649158 16:1012760-1012782 CTGCCCCTCTGCCCAGGGTCCGG + Intergenic
1132650811 16:1020743-1020765 CTTTCCCCCTGCCATGGGTGGGG - Intergenic
1132716043 16:1290259-1290281 TGGTCTCCCTCCTCTGGGTCAGG + Intergenic
1133976789 16:10604921-10604943 CTGTCCCCAATCTATGGGTCAGG + Intergenic
1134195691 16:12157269-12157291 CTGGTCCCCTTCTCTGGCTCTGG + Intronic
1135307581 16:21380221-21380243 CTGGCGCCCTGATCTGGGCCAGG - Intergenic
1135495590 16:22948571-22948593 CTGCACCCCTGCTTTGGGCCAGG + Intergenic
1136304325 16:29359341-29359363 CTGGCGCCCTGGTCTGGGCCAGG - Intergenic
1136428486 16:30184187-30184209 CTGTCCCCCACCTCTGGTCCGGG + Intronic
1136682497 16:31976341-31976363 CTGGCCAGCTGCTCTGGGGCAGG + Intergenic
1136782757 16:32917509-32917531 CTGGCCAGCTGCTCTGGGGCAGG + Intergenic
1136887040 16:33936341-33936363 CTGGCCAGCTGCTCTGGGGCAGG - Intergenic
1138251587 16:55505847-55505869 CTGTCCCACTGCCCTGTGCCAGG - Exonic
1138529294 16:57626465-57626487 CAGGCCCCCAGCTCTGAGTCTGG - Intronic
1139332428 16:66203775-66203797 ACGTGTCCCTGCTCTGGGTCTGG - Intergenic
1139778054 16:69329637-69329659 CTAGCCCCCTGGGCTGGGTCAGG + Intronic
1142205300 16:88780026-88780048 CTCACCCCCTTCTCTGGGTCTGG - Intronic
1203085408 16_KI270728v1_random:1181493-1181515 CTGGCCAGCTGCTCTGGGGCAGG + Intergenic
1142496572 17:309473-309495 CAGCCCCCCTGCTGGGGGTCCGG + Intronic
1142496597 17:309533-309555 CAGCCCCCCTGCTGGGGGTCCGG + Intronic
1142863051 17:2775184-2775206 TTGTGATCCTGCTCTGGGTCAGG + Intergenic
1143189718 17:5032764-5032786 CTGTCCCCTGGCTCTGGGCCTGG + Exonic
1143890313 17:10097711-10097733 CTCTGCCCTCGCTCTGGGTCAGG + Intronic
1144442472 17:15295743-15295765 CTGTCTCCCTGCTCTCGGGCTGG - Intergenic
1145012700 17:19378717-19378739 CGGGCCCCCGGCTCTGGGCCCGG + Intronic
1146578180 17:34012981-34013003 CAGCCCCCCTGCTTTGAGTCAGG + Intronic
1146683441 17:34824710-34824732 CTCTCACCCTCCTCTGGGCCAGG - Intergenic
1146902933 17:36600079-36600101 CTGCTCCCCTCCTCTGGGGCTGG - Intronic
1148611867 17:48970006-48970028 CTGTCTTCCTGCTCAGGGGCAGG + Intergenic
1149517979 17:57294858-57294880 TTGATCCCCTGCTCTGGGTTGGG + Intronic
1149621276 17:58047038-58047060 CGCTCCCTCTGCTCTGGGCCGGG + Intergenic
1151518543 17:74612840-74612862 CTCTCCCCATGCTCTGACTCTGG + Intronic
1151687999 17:75660913-75660935 CTGCCCTCCTGGTCTGGGCCTGG - Intronic
1151711053 17:75806899-75806921 CATTCCCACTGCCCTGGGTCAGG - Intronic
1151757720 17:76084063-76084085 CTGTCCCTCTGCTCTGTGTCTGG + Exonic
1152419674 17:80185663-80185685 CTTTCCCCCAGCCCAGGGTCGGG + Intronic
1152521632 17:80859925-80859947 CTGGGCCCCTGCGCCGGGTCTGG + Intronic
1152572416 17:81126648-81126670 CTGTCCCTCAGCTGTGGGTAGGG - Intronic
1155476094 18:26237093-26237115 CAGTCCCCATGATCTGAGTCTGG + Intronic
1155932147 18:31719300-31719322 CTTGCCCCCTGCTCTGGGAATGG - Intergenic
1156201581 18:34838723-34838745 CTTTCCCCCTGCCCTGTTTCAGG + Intronic
1159741493 18:72176753-72176775 TTCTCCCCGTGCTTTGGGTCAGG - Intergenic
1160488939 18:79320480-79320502 CTGTCCCCCTGGCCTGGCCCTGG - Intronic
1160865299 19:1253465-1253487 CAAGCCCCCTGCTCTGGGTATGG - Intronic
1161030435 19:2055676-2055698 CTCTCTCCCTGCTCAGGGTGTGG - Intergenic
1161298665 19:3532406-3532428 CTGTCCCCCAGCTGCTGGTCTGG + Exonic
1161327113 19:3669282-3669304 CTGCCTCCCTGCTCTGGGCTGGG + Intronic
1161331166 19:3688394-3688416 CTGGCCCCCTGCTGTGGGCGGGG + Intronic
1161723720 19:5916913-5916935 CTGTCCCCCACCTGTGGTTCTGG - Exonic
1162340986 19:10091498-10091520 CCGTCCCCCTGCTACGGGTGCGG + Exonic
1162536895 19:11268001-11268023 CTATCTCCCTGCTGTGGGACTGG - Intergenic
1163653439 19:18532053-18532075 CTGGCCCCCTCCTCCGGGTTAGG - Exonic
1165378200 19:35458983-35459005 CTGTCATCCTGCTTTGGGGCAGG - Intergenic
1165408727 19:35645378-35645400 CTGTGTCCCTGCCCTGTGTCGGG + Intergenic
1165901230 19:39170196-39170218 CTGGACCCCTGGTCTGTGTCAGG - Intronic
1166383644 19:42368741-42368763 CTGAGCCCCACCTCTGGGTCTGG - Intronic
1166728876 19:45046471-45046493 CTGACCCCCAAGTCTGGGTCAGG + Intronic
1166807541 19:45496476-45496498 CTGTCCCCTGGCTCTGGTGCTGG - Intronic
1167269280 19:48498691-48498713 CTGTCCCCCGGCTTGGGGCCCGG + Exonic
925027324 2:620276-620298 CTGCCCCCCTCCTCATGGTCAGG - Intergenic
925190088 2:1875618-1875640 CTGTCCCCAAGCACTGGGCCAGG + Intronic
925351174 2:3201522-3201544 CTGTGCCCCCGCTCTGTGTCTGG - Intronic
925420398 2:3705667-3705689 CTTTCCCCTTGCTGTGGGGCTGG + Intronic
926098758 2:10099951-10099973 CAGTCCTGCTTCTCTGGGTCTGG - Intergenic
926759127 2:16261913-16261935 CTGTCCTCCTGCCCTGGGTTTGG + Intergenic
927177681 2:20421976-20421998 CTGTCACCCTCCACTGGGCCTGG - Intergenic
927216416 2:20670094-20670116 CTGGCCCGCGGCTCTGGGTCAGG + Intronic
927666571 2:25036858-25036880 ATGTCCCCCTTCACTGGGTTTGG - Intergenic
927677219 2:25114858-25114880 CGCTCCCCCTACTCTGGGGCAGG - Intronic
932211779 2:69937436-69937458 CTGAACCCCTGCTCTGGGGTTGG - Intronic
932571064 2:72938623-72938645 CTGTCCACCTGCTCTGTCCCTGG - Intergenic
933342171 2:81037785-81037807 CAGTCCCCATGATCTGAGTCGGG - Intergenic
935669116 2:105540264-105540286 CTGTCACCCTGCTCAAGTTCTGG + Intergenic
935939438 2:108222682-108222704 CTGCCCCCCTTCTCTGGTCCTGG + Intergenic
936245887 2:110827134-110827156 CTGAGCTCCTGCTGTGGGTCTGG + Intronic
937352597 2:121175665-121175687 CTGCTCCGCTGCTCTGGGGCTGG - Intergenic
937834841 2:126461529-126461551 ATGTCCCACAGCTCTGTGTCTGG + Intergenic
937839464 2:126511124-126511146 CTCTCGCCCTGCTCTGGTGCAGG + Intergenic
937864036 2:126734710-126734732 CTGTCCCCCTCCGCTGGGACTGG - Intergenic
937886269 2:126901747-126901769 CTTGCCCTCTGCTCTGGGTTGGG + Intronic
938080967 2:128369952-128369974 CTCTCCTCCTTCTCAGGGTCAGG - Intergenic
938096688 2:128468506-128468528 CTTTTCCCCTGCTCTGTCTCTGG + Intergenic
939962973 2:148582274-148582296 CTGTGCCCCTACTCTGTGCCAGG - Intergenic
942514633 2:176738864-176738886 CTCTGACACTGCTCTGGGTCTGG + Intergenic
943578061 2:189653708-189653730 CTGTCCCCCACCTCTTGGACGGG - Intergenic
946025844 2:216671247-216671269 CTGTCTCCCTGCTCTGCTCCTGG + Intergenic
946234985 2:218318647-218318669 CTGAACACCTGCTCTGGGCCAGG + Intronic
947740531 2:232482821-232482843 CTGACCCCCAGCTCTGGGCCAGG + Intronic
947808236 2:232983058-232983080 CTGTCACCCTGCCCTGGGGATGG + Intronic
948361551 2:237424500-237424522 CTATCCTCTTGCTCTGGGCCTGG - Intronic
948782197 2:240328773-240328795 CTGTCAAGCTGCTCTTGGTCGGG + Intergenic
948785957 2:240353111-240353133 CTGGCCTCCAGCTCTGGGTCTGG + Intergenic
1169109404 20:3022266-3022288 CTGTTCCCCTGCTCTGGCCATGG - Intronic
1169224454 20:3847287-3847309 CTGCCGCCCTCCGCTGGGTCTGG + Intronic
1169268178 20:4180370-4180392 CTGTCCCCCAGCCCTGGGCTAGG - Intronic
1170601708 20:17846364-17846386 GTGTCTCCCTGCTCTGCTTCTGG - Intergenic
1171432448 20:25091555-25091577 CTGTCCCCATGCTCAAGGCCTGG + Intergenic
1172032584 20:31992263-31992285 CTGACCACCTGCTCTGTGCCAGG - Intronic
1172118848 20:32585912-32585934 CTGCCCCACTGCTCTGGGACAGG + Intronic
1172243294 20:33427855-33427877 CTGAGCCCCTGCTCTGTGCCAGG - Intronic
1172276138 20:33680356-33680378 CTGGCCCACTGCTCTCGGCCAGG + Exonic
1172446925 20:34998071-34998093 CTGACCCACTGCCCTGGGACTGG + Intronic
1172488833 20:35317712-35317734 CTTAGCCCCTGCTCTGGGTTAGG - Intronic
1172620714 20:36316592-36316614 CTGTGCCCCTGCTGTGTGCCAGG - Intronic
1172885720 20:38229592-38229614 CTGGGCCCCTGCTCTGGGCTTGG - Intronic
1173155109 20:40602030-40602052 CTCTCACCCTGGTCTGTGTCTGG - Intergenic
1173219975 20:41124642-41124664 CTGTCCTGCTGCTGTGGGTGTGG + Intergenic
1173237999 20:41265937-41265959 TTGTCCCCCTCCACTGGTTCTGG - Intronic
1173291117 20:41716159-41716181 CTGGCTCCCTGACCTGGGTCTGG + Intergenic
1173522319 20:43709360-43709382 CTGCCCCCCTGCTCTAGGGCAGG + Intronic
1175405357 20:58722551-58722573 TTGTGCTCCTGCTCTGTGTCAGG + Intergenic
1175407889 20:58746558-58746580 CAACCCCCCTGCTCTGGGGCTGG + Intergenic
1176213691 20:63938613-63938635 CAGCCCCGCTGCTCAGGGTCGGG + Intergenic
1177773169 21:25539520-25539542 CTGTCACCCTGCTCTGGCCCAGG - Intergenic
1178422447 21:32453131-32453153 CTGTGCCCCACCTCTGGGCCTGG + Intronic
1179166347 21:38938101-38938123 CTCTCTCCCTGCTCTGAGCCTGG - Intergenic
1179265172 21:39796633-39796655 CTGGGCCCCAGCTCTGGGCCTGG - Intronic
1179529413 21:42009164-42009186 CTTTCCCCGTCCTCTCGGTCAGG + Intronic
1179904467 21:44415186-44415208 GTGTCCACCTCCTCTGGGCCTGG + Intronic
1181499098 22:23305711-23305733 CTCTCCCCCTGGACTGGGTAAGG - Intronic
1182300067 22:29332174-29332196 CTGTTCCTCTCCTCTGGGCCAGG + Intronic
1182575652 22:31271204-31271226 ATGTCCCACTGCTCTGGGCCTGG + Intronic
1183196823 22:36359259-36359281 CTGAGCACCTGCTCTGGGCCAGG - Intronic
1183300130 22:37054821-37054843 CTGACCTCCTGCTCTGTGTTTGG + Intronic
1183590647 22:38777525-38777547 CTGTCCCACTGCTCTTGGACCGG + Intronic
1183902965 22:41020274-41020296 CTGTCCCCCAGCTCTGGGGAGGG - Intergenic
1183985182 22:41565876-41565898 CTGTCCCCCGGCCCTGAGTTTGG - Intronic
1184479734 22:44739299-44739321 CAGTCCTCCTGCCCTGGGGCAGG + Intronic
1185280674 22:49968616-49968638 CTGTCCCACTGCTCAGGGCCTGG - Intergenic
950206962 3:11088329-11088351 TTGTCACCTTGCTCTGGGGCTGG + Intergenic
950263837 3:11560746-11560768 CTGTCCCGCTGCTAAGTGTCGGG - Intronic
950498556 3:13349269-13349291 CTCACCCCCAGCTCTCGGTCAGG + Intronic
950550801 3:13664802-13664824 CTGTCCCACTGCTCTGAAGCTGG + Intergenic
951709097 3:25571547-25571569 CTGTGTCCCTGCTCTGGGATGGG - Intronic
953119353 3:40024752-40024774 CTTTCCACCTGCTCAAGGTCAGG + Intronic
953913475 3:46904343-46904365 CTGGGTCCCTGCTCTGGCTCAGG + Intergenic
954433905 3:50485894-50485916 CTGTCCCCGTGCCCCTGGTCTGG - Intronic
954627111 3:52028622-52028644 CTGTCCCTCTGCTGGGGGCCTGG + Intergenic
955380667 3:58435317-58435339 CTGTCCCCCTCCTCTCCATCTGG - Intergenic
955436677 3:58907408-58907430 CTGCTTCCCTGCTCAGGGTCTGG - Intronic
957048072 3:75391969-75391991 CTGTGCCCCACCTCTGGGCCTGG - Intergenic
961005933 3:123405412-123405434 CTGTGCCGGTGTTCTGGGTCTGG - Intronic
961531691 3:127544131-127544153 CTGTCCCTGTGCTCTGGGCAGGG - Intergenic
961658774 3:128457417-128457439 CTCTCCCTCTGCACTGGGCCTGG - Intergenic
961745916 3:129063321-129063343 CTGGCCCCCACCTCTGGGTTTGG - Intergenic
961823885 3:129588773-129588795 CAGTTTCCCTGCTCTGGGGCAGG - Intronic
962482443 3:135809407-135809429 CTGTGCCCCTTCTCTGGGTCTGG + Intergenic
963163565 3:142177778-142177800 CTGTCTCCCTTCTATGGGCCTGG - Intronic
963380893 3:144528892-144528914 CTCTCCCCCTGCTCTTGCCCAGG + Intergenic
965241675 3:166208440-166208462 CTGTCTCCTTGCACTGGATCAGG + Intergenic
967298246 3:187986609-187986631 CTGTCTCCCCGCACTGTGTCAGG - Intergenic
967942138 3:194774305-194774327 CAGTTCCTCTGCTCTGGGCCAGG - Intergenic
968291280 3:197541708-197541730 CTGTGCCTCACCTCTGGGTCAGG - Intronic
968323501 3:197791706-197791728 CTCTCCCCAGGCTCTGGGTCTGG - Intronic
968591359 4:1461251-1461273 GTGTCCACCTACTCTGGGTTGGG + Intergenic
968704676 4:2072358-2072380 CTGTCCCCCTGCTTGGGGTCTGG - Intronic
968757702 4:2425563-2425585 CTGACCCACTGCTCTGGGCCAGG - Intronic
968816329 4:2823655-2823677 CTGGCACCCAGCTCTGGTTCTGG + Intronic
968959808 4:3737736-3737758 CTGTCCCTGGGCTCTGAGTCCGG + Intergenic
968992531 4:3924426-3924448 CTGTGCCCCACCTCTGGGCCTGG - Intergenic
969196877 4:5570050-5570072 CTGACCCCATCTTCTGGGTCAGG + Intronic
969822823 4:9733196-9733218 CTGTGCCCCACCTCTGGGCCTGG + Intergenic
971252513 4:24985292-24985314 CTTTCCCCCTTTTCTGGGTTAGG - Intergenic
973808131 4:54545216-54545238 CTGTCCTCCTCCTCTGCTTCCGG - Intergenic
973954480 4:56049323-56049345 CTGTCCCCATTGTCTGGCTCCGG - Intergenic
974693736 4:65337505-65337527 ATCTGCCCCTGCACTGGGTCAGG - Intronic
974713259 4:65631056-65631078 TTGTACCCCTGCTCTTGGTGAGG + Intronic
976127844 4:81853231-81853253 ATTTCCCCCTGCTGTGGGTAGGG - Intronic
976442029 4:85087040-85087062 CTCTGCCACTGCTCTAGGTCAGG + Intergenic
978634531 4:110788804-110788826 CTGACTGCCTGCTCTGTGTCAGG + Intergenic
980619119 4:135274512-135274534 CAGTCCCCTTGCTTTGGTTCAGG + Intergenic
981646063 4:147000151-147000173 TTGGCCCCCTACTCTGGTTCAGG + Intergenic
982701134 4:158660520-158660542 CAGTCCCCATGATCTGAGTCAGG - Intergenic
983352019 4:166602209-166602231 CTGGCCCACGGCTCTGGGGCTGG - Intergenic
984167613 4:176320638-176320660 CTGCCGCCGCGCTCTGGGTCGGG + Intronic
984834745 4:184009516-184009538 CTGTCCCCCTTCTCTGTGCCAGG + Exonic
985649590 5:1101196-1101218 CTGCCCACCTGCACTGGGACAGG + Intronic
989099239 5:37808922-37808944 CTGCTCACCTGCTCCGGGTCTGG - Intergenic
994424974 5:99573903-99573925 CCGGCCACCTGCTCTGGCTCTGG + Intergenic
997256190 5:132430052-132430074 CTCTCTACCTGCTCTGGGTTGGG + Intronic
999279511 5:150355750-150355772 CAGTCCCCCTGCTCTCCCTCCGG + Intergenic
999314468 5:150575137-150575159 CAGACCCCCTGCTCTCTGTCTGG + Intergenic
999452136 5:151686428-151686450 CTGTCCTCCAGATCTCGGTCAGG - Intronic
999777648 5:154823724-154823746 CTGCCACCCAGCTCTGGGCCTGG + Intronic
1001370592 5:171196619-171196641 CCATCCCCCTGCTCAGTGTCTGG - Intronic
1001434847 5:171692279-171692301 CTGAGCACCTGCTCTGGGTCAGG - Intergenic
1002456087 5:179345864-179345886 CTGTCTCTGTGCTCTGGGGCAGG + Intergenic
1003441301 6:6145168-6145190 CAGTCCCCTTTCTCGGGGTCAGG - Exonic
1004156693 6:13175466-13175488 CTCTCCCTGTGCTCTGAGTCAGG + Intronic
1005517538 6:26569235-26569257 CTTTCCCCCGGCTGTGGATCCGG - Intergenic
1006183913 6:32169663-32169685 CAGCCCCCCTCCTCTGGGTTTGG + Intronic
1006375760 6:33670933-33670955 CGGTCCCCCTGCACTGGCTGGGG - Intronic
1006951243 6:37822575-37822597 CTGGCCCCATACTCTGGGGCAGG + Intronic
1007109244 6:39303600-39303622 CTGTCCCACTTCTCTGGGGCTGG - Intronic
1008530960 6:52458250-52458272 TTTTCCCCCTGCTCTGAGACAGG - Intronic
1010897052 6:81377686-81377708 CTGTGCACCTGCTCTGGGGCTGG + Intergenic
1011743265 6:90384869-90384891 CTGTGCCCCTGCTCAGCCTCTGG - Intergenic
1013342500 6:109229164-109229186 CTGTCTCTCTGTTCTGGGTTTGG + Intergenic
1016717272 6:147248989-147249011 CTGTCTCCCTGCTGTCTGTCAGG - Intronic
1017002324 6:150005081-150005103 CTGTCCGGCTGGTCCGGGTCAGG - Intergenic
1017007353 6:150037782-150037804 CTGTCCCCGAGCTCTGGACCCGG + Intergenic
1019217558 6:170453604-170453626 CTGTCTTCCTGCTCTGGATTTGG - Intergenic
1019401365 7:855905-855927 CTGTCTGCCTGCCCTGGGCCGGG + Intronic
1019433445 7:1010252-1010274 CTGTCCCCAAGCACTGGGTCTGG + Intronic
1019474097 7:1235815-1235837 CTATCCGGCTGCTCTAGGTCTGG + Exonic
1019737240 7:2656625-2656647 CTGTCCCTCACCTCTGGGACTGG - Intronic
1020040445 7:4997137-4997159 CTGTCCACCTGGTCAGGGTTGGG - Intronic
1020315182 7:6900782-6900804 CTGTGCCCCACCTCTGGGCCTGG - Intergenic
1021841285 7:24723716-24723738 CTGTCTCCCTCTTCTGGGTGAGG + Intronic
1022691179 7:32656778-32656800 CTGTCCCCCAGGTCTGGGTAGGG + Intergenic
1023343907 7:39251800-39251822 CTGTGCCCATGCTGGGGGTCTGG - Intronic
1025093922 7:56083466-56083488 CTCTTCCTCTGCTCAGGGTCAGG + Intronic
1026584071 7:71642047-71642069 CTGTCCCCCCACTATGGGACAGG + Intronic
1027746565 7:82082135-82082157 CTGGCCCACGGCTCTGGGGCTGG + Intronic
1029112104 7:98217757-98217779 CTGTCCCCCGGCTCAGGCTGTGG + Exonic
1029162776 7:98564313-98564335 CTGTTCCCCAGCTCTGAATCTGG - Intergenic
1031929224 7:127667534-127667556 CTGTCCCCCATCCCTGGATCAGG + Intronic
1033328350 7:140398097-140398119 CTGTCCTCCGGCCGTGGGTCTGG - Intronic
1034273322 7:149813619-149813641 CTGTCCCCCAGCACTGCGTGTGG + Intergenic
1035399345 7:158554779-158554801 CTGTGCTCCTGCGCTGGATCGGG - Intronic
1036926960 8:12916275-12916297 CTGTGGCCCTTCTCTGGGACAGG + Intergenic
1039577022 8:38631937-38631959 ATCTCCCGCTGCTCTGGGCCCGG + Intergenic
1042226106 8:66515625-66515647 CTGTCCCCCTGCTCTGGGTCTGG - Intronic
1043649943 8:82578782-82578804 CTGCCCCTCTGCTTGGGGTCAGG - Intergenic
1045003165 8:97895721-97895743 CTGAGCCCCTGCTGTGGGTTGGG + Intronic
1046606421 8:116376007-116376029 ATGTTCCCCTTCTCTGGATCTGG + Intergenic
1046669997 8:117046454-117046476 CTGACCACCTACTCTGTGTCAGG - Intronic
1047482051 8:125293069-125293091 CTGTGCCCCAGCTCTGTTTCAGG + Intronic
1048442697 8:134471590-134471612 GTGAGCACCTGCTCTGGGTCAGG + Intergenic
1049251041 8:141589087-141589109 CTGACCCCATCCTCTGGGGCTGG - Intergenic
1049497996 8:142945709-142945731 CTGTGGCCCTGCGCTGGCTCAGG + Intergenic
1049584292 8:143425809-143425831 CTGCCTGCCTGCTCTGGTTCTGG + Intronic
1049650996 8:143769646-143769668 CTGACCCTTTGCTCTGGGCCAGG + Intergenic
1050647795 9:7740377-7740399 CTGTTCCCCTGCTCTGGAAAGGG + Intergenic
1050756463 9:9010385-9010407 TTATCCCCCTGCTCTGTGTCTGG + Intronic
1055452119 9:76440537-76440559 GTGTCCCCCTGCCCTGTGTGGGG + Intronic
1056771172 9:89479266-89479288 CTGTCCCCTTGCTGTGGATCTGG - Intronic
1057308440 9:93926033-93926055 CTGACCACCTGCTCTTTGTCAGG + Intergenic
1057444280 9:95103124-95103146 CAGTCCTCCCGCTCAGGGTCTGG - Intronic
1057521444 9:95763695-95763717 CTGGACACCTGCTCTGGGTCTGG + Intergenic
1057700570 9:97360701-97360723 CTCACCTCCTGGTCTGGGTCGGG + Intronic
1059320984 9:113469292-113469314 CAGTCCCACTGCTCTGAGCCTGG + Intronic
1060018156 9:120105032-120105054 CTGTTCGACTGCTCTGGGGCAGG + Intergenic
1060100139 9:120833263-120833285 TTGACCACCTGCTCTGGGCCAGG - Intronic
1060758632 9:126230362-126230384 CTGTCCCCCTGCCCTCGCTGTGG + Intergenic
1060791300 9:126487375-126487397 CTGTCCCGCTGCTCTGTTGCTGG + Intronic
1060803036 9:126556787-126556809 CTCTCCCCCTGGTGTGGGCCGGG + Intergenic
1060997917 9:127885539-127885561 CTGTCCCCTGGCTCTGTATCAGG - Exonic
1061223700 9:129267592-129267614 CTGTGCACCTGCTCTGTGCCAGG + Intergenic
1061293916 9:129666890-129666912 CTGTCCCCTAGCTCTGGGGATGG + Intronic
1061631935 9:131877677-131877699 CCGTCACCCTCCTCTGAGTCAGG - Intronic
1061777606 9:132976020-132976042 CTGGGTCCCTGGTCTGGGTCTGG + Intronic
1061781510 9:132999161-132999183 CTCTTCCTCTGGTCTGGGTCAGG + Intergenic
1061798259 9:133100933-133100955 CTGTACCCCAGCCCTGGGTCAGG - Intronic
1061920572 9:133780210-133780232 CTGACCACCTGCTCTGAGCCTGG + Intronic
1185544059 X:927279-927301 CTGACTCCCAGCTCTGGGCCTGG + Intergenic
1185778522 X:2825634-2825656 CTGTGCTCTTGCTCTGGGTAAGG - Intergenic
1186837971 X:13456973-13456995 CTGTCGCCCTGCTCTTGCCCTGG + Intergenic
1187510150 X:19910395-19910417 CTGTGCATCTGCTCTGGGCCAGG - Intergenic
1187675187 X:21709501-21709523 CTGGACCCCTGCTATGTGTCAGG - Intronic
1190305138 X:49077729-49077751 CTGCCCACCTGCTCGTGGTCTGG + Exonic
1191797465 X:65035593-65035615 CTTTCCCCTCGCTCTGGCTCTGG + Intergenic
1192233941 X:69284494-69284516 CTGTTCCCCAGCTCTTGTTCTGG - Intergenic
1192234166 X:69285571-69285593 CTTTCCCTCTGCCCTGGCTCGGG - Intergenic
1192554683 X:72080240-72080262 CTGTCACCCTCTTCTGGATCCGG + Intergenic
1192583052 X:72300597-72300619 CTGAGCACCTGCTCTGGGCCAGG - Intronic
1194384364 X:93235814-93235836 CTGGCCCGCTGCTCTGAGTGTGG - Intergenic
1195998627 X:110757927-110757949 TTTGCCCCATGCTCTGGGTCTGG + Intronic
1197758662 X:130013381-130013403 CTGTCCCCCTGCTCCCGGTTCGG + Exonic