ID: 1042226638

View in Genome Browser
Species Human (GRCh38)
Location 8:66519755-66519777
Sequence ATCCCCCTTTGGGCTCCTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042226638_1042226645 0 Left 1042226638 8:66519755-66519777 CCCAGAGGAGCCCAAAGGGGGAT No data
Right 1042226645 8:66519778-66519800 AGGAGGGACCTCACTTTTCCAGG No data
1042226638_1042226648 10 Left 1042226638 8:66519755-66519777 CCCAGAGGAGCCCAAAGGGGGAT No data
Right 1042226648 8:66519788-66519810 TCACTTTTCCAGGAAGGACCAGG No data
1042226638_1042226651 27 Left 1042226638 8:66519755-66519777 CCCAGAGGAGCCCAAAGGGGGAT No data
Right 1042226651 8:66519805-66519827 ACCAGGATCTGGACCCTGCCTGG No data
1042226638_1042226649 16 Left 1042226638 8:66519755-66519777 CCCAGAGGAGCCCAAAGGGGGAT No data
Right 1042226649 8:66519794-66519816 TTCCAGGAAGGACCAGGATCTGG No data
1042226638_1042226646 4 Left 1042226638 8:66519755-66519777 CCCAGAGGAGCCCAAAGGGGGAT No data
Right 1042226646 8:66519782-66519804 GGGACCTCACTTTTCCAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042226638 Original CRISPR ATCCCCCTTTGGGCTCCTCT GGG (reversed) Intergenic