ID: 1042227575 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 8:66525920-66525942 |
Sequence | ATGTACTAGAAGAAGTGAGC TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1042227570_1042227575 | 19 | Left | 1042227570 | 8:66525878-66525900 | CCTAAGTTGGACTTATGGGGCAG | No data | ||
Right | 1042227575 | 8:66525920-66525942 | ATGTACTAGAAGAAGTGAGCTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1042227575 | Original CRISPR | ATGTACTAGAAGAAGTGAGC TGG | Intergenic | ||
No off target data available for this crispr |