ID: 1042227575

View in Genome Browser
Species Human (GRCh38)
Location 8:66525920-66525942
Sequence ATGTACTAGAAGAAGTGAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042227570_1042227575 19 Left 1042227570 8:66525878-66525900 CCTAAGTTGGACTTATGGGGCAG No data
Right 1042227575 8:66525920-66525942 ATGTACTAGAAGAAGTGAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042227575 Original CRISPR ATGTACTAGAAGAAGTGAGC TGG Intergenic
No off target data available for this crispr