ID: 1042230955

View in Genome Browser
Species Human (GRCh38)
Location 8:66553996-66554018
Sequence CTTTATATACAAATGAAACT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042230951_1042230955 1 Left 1042230951 8:66553972-66553994 CCCTTTGTGCAATATCAACACCT No data
Right 1042230955 8:66553996-66554018 CTTTATATACAAATGAAACTAGG No data
1042230950_1042230955 13 Left 1042230950 8:66553960-66553982 CCTTCTTTCTGACCCTTTGTGCA No data
Right 1042230955 8:66553996-66554018 CTTTATATACAAATGAAACTAGG No data
1042230952_1042230955 0 Left 1042230952 8:66553973-66553995 CCTTTGTGCAATATCAACACCTC No data
Right 1042230955 8:66553996-66554018 CTTTATATACAAATGAAACTAGG No data
1042230949_1042230955 18 Left 1042230949 8:66553955-66553977 CCTGGCCTTCTTTCTGACCCTTT No data
Right 1042230955 8:66553996-66554018 CTTTATATACAAATGAAACTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042230955 Original CRISPR CTTTATATACAAATGAAACT AGG Intergenic
No off target data available for this crispr