ID: 1042233708

View in Genome Browser
Species Human (GRCh38)
Location 8:66586344-66586366
Sequence CCTATTTTAAGTCAGATTAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 207
Summary {0: 1, 1: 1, 2: 3, 3: 24, 4: 178}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042233708_1042233711 22 Left 1042233708 8:66586344-66586366 CCAATAATCTGACTTAAAATAGG 0: 1
1: 1
2: 3
3: 24
4: 178
Right 1042233711 8:66586389-66586411 CTCAAAAGAAAACATACAAATGG 0: 79
1: 1528
2: 4014
3: 5680
4: 9202
1042233708_1042233712 29 Left 1042233708 8:66586344-66586366 CCAATAATCTGACTTAAAATAGG 0: 1
1: 1
2: 3
3: 24
4: 178
Right 1042233712 8:66586396-66586418 GAAAACATACAAATGGACAATGG No data
1042233708_1042233713 30 Left 1042233708 8:66586344-66586366 CCAATAATCTGACTTAAAATAGG 0: 1
1: 1
2: 3
3: 24
4: 178
Right 1042233713 8:66586397-66586419 AAAACATACAAATGGACAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042233708 Original CRISPR CCTATTTTAAGTCAGATTAT TGG (reversed) Intronic
904465304 1:30704146-30704168 CCTATTTCAAGTCAGATTAAAGG - Intergenic
906020374 1:42623061-42623083 CCATTTTAAAATCAGATTATTGG + Intronic
906123685 1:43412805-43412827 CCATTTTAAAATCAGATTATTGG - Intronic
906502194 1:46349480-46349502 TCTATTTTAAGGCAGGATATCGG - Intronic
907265794 1:53260004-53260026 CATATAATAAGTCAGCTTATTGG - Intronic
908925560 1:69250093-69250115 CCTAATGTAACTCAGATTAGTGG + Intergenic
910644369 1:89497390-89497412 CCATTTTGAAATCAGATTATTGG - Intergenic
911107178 1:94142963-94142985 TCTATTTTCATTCAGATTAAAGG + Intergenic
916925432 1:169514792-169514814 ACTAATTTAAGTCAGATCACTGG - Intronic
918180017 1:182079295-182079317 ACTATTTTAAGACAGCTGATGGG + Intergenic
919548556 1:198954909-198954931 GCTATTTTAAATGAGATTAATGG - Intergenic
920562374 1:206947927-206947949 TCTTTTATCAGTCAGATTATGGG - Intergenic
920947143 1:210540235-210540257 CATCTTTTATGTCAGATTACAGG - Intronic
921768589 1:219005655-219005677 CCATTTTTAAATCAGATTGTTGG + Intergenic
921890861 1:220352650-220352672 CCTATTTTAAATCTTACTATGGG + Intergenic
922150140 1:222994610-222994632 TCTATTTTTGGTCAGACTATAGG - Intronic
924472275 1:244352979-244353001 CCTATATTAAATAAGATAATTGG + Intronic
924861505 1:247928339-247928361 CCTATTTTCAATTGGATTATGGG + Intergenic
1063265888 10:4450313-4450335 ACAATTTAAAGTCATATTATAGG - Intergenic
1068303201 10:55173014-55173036 CTTATTTTGATTCAGATTTTAGG + Intronic
1069305721 10:66966222-66966244 CCTATTTTTGGTCAGAATTTAGG + Intronic
1071899589 10:90106019-90106041 CCATTTTTTAATCAGATTATTGG - Intergenic
1072001040 10:91195967-91195989 CCAATTTTAAGGCACATTCTTGG - Intronic
1078784584 11:14476484-14476506 CCTATTTTAATTTATTTTATAGG + Intronic
1079271874 11:18994837-18994859 CCCATTTTTAATCGGATTATTGG + Intergenic
1081285247 11:41260977-41260999 TCTCTTTTAAGGCAGAATATTGG + Intronic
1082903755 11:58284538-58284560 CCTTTTTTCACTCAGACTATTGG - Intergenic
1082975807 11:59070561-59070583 CCAATTATAAGTCATATTATAGG - Intergenic
1084720725 11:70904017-70904039 CCTAATTTAATACAGATTAGGGG - Intronic
1086288523 11:85277502-85277524 ACTATTTTAGATCATATTATTGG + Intronic
1087887834 11:103500572-103500594 GCTATTCTATGTCATATTATTGG - Intergenic
1088548548 11:110986778-110986800 CCCATTTTAAGTCATATTACTGG + Intergenic
1091845405 12:3652423-3652445 CTTATTTTAAGTCAGCTACTTGG + Intronic
1093196549 12:16136233-16136255 ACTGTTTTAAGTCAGGTTTTAGG + Intergenic
1093472647 12:19520797-19520819 CATTTTTTATGTCAGATTTTTGG - Exonic
1094665871 12:32520403-32520425 CCTATTTTAAGTTCTATTGTGGG + Intronic
1096040805 12:48514944-48514966 CCATTTTTTAGTCAGAGTATTGG + Intronic
1097426592 12:59453158-59453180 ACAATTTCAAGTCAGATTAAGGG - Intergenic
1098084414 12:66826769-66826791 CCAATTTTAATTCAGTTTAATGG - Intergenic
1098593019 12:72237012-72237034 CCTCTTTTAAGTAAAATTGTTGG + Intronic
1099291220 12:80778461-80778483 CTTATTTTAAGTCAAAATTTTGG + Intergenic
1099333041 12:81315771-81315793 CCTACTTAAAGACAGATGATGGG + Intronic
1099572837 12:84347140-84347162 CCTCTTTTAAGGCAGGTTAGAGG + Intergenic
1099573168 12:84351304-84351326 CCTAATTTAACTCGTATTATTGG - Intergenic
1100133477 12:91524600-91524622 CTAATTTTAAAACAGATTATTGG - Intergenic
1104001275 12:124862285-124862307 CCTCTTTGCAGTCAGATTACAGG + Intronic
1105478973 13:20755647-20755669 TCTATTTGAAGTGAGATTATTGG + Intronic
1109220022 13:59631995-59632017 CCTTCTTTAAGCCTGATTATTGG + Intergenic
1109587292 13:64423134-64423156 CCTATTTTAATTCTGGTTTTTGG + Intergenic
1109601204 13:64630913-64630935 TCTACTTTAATTCAGATTTTAGG - Intergenic
1114789276 14:25638148-25638170 CCTTGTTTAAGTCAGAAAATTGG + Intergenic
1114973774 14:28067782-28067804 ACTAATTTAAGTCAGAATAAAGG + Intergenic
1116850858 14:49907868-49907890 CCTATTTTAATTCAGAATGGGGG - Intergenic
1117924040 14:60757594-60757616 CCTAGTTTACATCAGAATATAGG + Intronic
1119157042 14:72421106-72421128 CAAGTTTTAAGACAGATTATCGG - Intronic
1120729536 14:87987045-87987067 CCTATATCAAGACATATTATAGG - Intronic
1127008847 15:54600489-54600511 GCTAGATTAAGTTAGATTATAGG + Intronic
1128600715 15:68993276-68993298 CCAATTATAAGTCAGGTTAAAGG - Intronic
1129286724 15:74531479-74531501 TGTATTTTAAGTCAGACAATTGG - Intergenic
1130408663 15:83625673-83625695 TTTATTTTAAGTCATTTTATTGG + Intergenic
1131390682 15:92045527-92045549 GCTATTTTAAGACAAATTAGTGG - Intronic
1133635956 16:7665534-7665556 GCAATTTTAAGTCAGGTAATTGG - Intronic
1134041782 16:11074391-11074413 CCCATTTCCAGTCAGTTTATAGG - Intronic
1137816126 16:51399377-51399399 GCAATTTTAAGTCAGATGTTTGG - Intergenic
1139125875 16:64076569-64076591 GCTATGTTCAGTCAGATTTTTGG - Intergenic
1141011093 16:80400307-80400329 CCATTTTAAAATCAGATTATTGG - Intergenic
1141719413 16:85747470-85747492 GCTATTTGAAGTCAGGTTAACGG + Intronic
1145756337 17:27393529-27393551 CCATTTTTTAATCAGATTATTGG + Intergenic
1149228212 17:54500065-54500087 TCTATATTAAGTCAGTTTAATGG - Intergenic
1149473101 17:56935355-56935377 CCTCTTTTGAGTCTGATTAGAGG + Intergenic
1150541778 17:66108424-66108446 CCATTTTCAAGTCGGATTATTGG - Intronic
1150800819 17:68281257-68281279 CCATTTTTAAGCCAGATTGTTGG - Intronic
1150902154 17:69292190-69292212 CTTATTTTAACTTAGATTATTGG - Intronic
1152826372 17:82468009-82468031 TCTCTTTTAAGACAGAGTATTGG + Intronic
1153403911 18:4713516-4713538 CCAATTTTAAGTAAGATTGTGGG - Intergenic
1153706358 18:7749494-7749516 TTTATTTTAAGTGAGATTATGGG + Intronic
1155393078 18:25357534-25357556 ATTATTTGAACTCAGATTATAGG - Intergenic
1164054349 19:21609284-21609306 CCCATCATAAGTCAGATTAAAGG + Intergenic
1166146580 19:40841440-40841462 ACGATTTGAAGTCAGATAATGGG + Intronic
1166150626 19:40872050-40872072 ACGATTTGAAGTCAGATAATGGG + Intronic
925049276 2:798919-798941 CATTTTTTCAGTCGGATTATTGG + Intergenic
926519221 2:13889306-13889328 CCACTTTTTAATCAGATTATTGG - Intergenic
930442474 2:51426319-51426341 CCCATTTTAAATCAGATTATTGG - Intergenic
930527136 2:52544213-52544235 CCCATTTTTAATCAGATTATTGG + Intergenic
933259744 2:80119004-80119026 CCTCTTTTTAATCAGATTAGAGG + Intronic
933525136 2:83427890-83427912 CATTTTTAAAATCAGATTATCGG - Intergenic
933887482 2:86732645-86732667 TATATTCTAAGTCAGAATATAGG - Intronic
935979754 2:108615164-108615186 CTAGTTTTAAGTCAAATTATGGG + Intronic
939801545 2:146717625-146717647 ACTATTTTCAGCAAGATTATTGG + Intergenic
940462305 2:153980699-153980721 CTTATTTTAAGACAGATGAATGG + Intronic
940990884 2:160095102-160095124 CCAATCTAAAATCAGATTATTGG - Intergenic
941735745 2:168974141-168974163 AGTATTTTAAATCAGATTTTGGG - Intronic
942261976 2:174174551-174174573 GCTATTATAAGTGATATTATAGG - Intronic
948215484 2:236226333-236226355 CTTATTTAAATCCAGATTATTGG - Intronic
1168867603 20:1101866-1101888 CATCTTTTAAGTCAGATAAGAGG + Intergenic
1170246682 20:14228286-14228308 ATTATTTTAAGTAAAATTATTGG - Intronic
1174397400 20:50256153-50256175 ACTATTTCAAATCATATTATAGG - Intergenic
1175455649 20:59111244-59111266 CTTATTTTAAGTAATAATATTGG + Intergenic
1178777205 21:35563420-35563442 CCTATTTGAATTCAGATCATTGG + Intronic
1179311639 21:40201250-40201272 GTTATTTCAAGTCACATTATTGG + Intronic
1183159136 22:36099343-36099365 TGTCTTTTAAGTCAGATAATAGG + Intergenic
950985840 3:17365479-17365501 CCTTATTTAAGTCAGACTACTGG - Intronic
951291973 3:20882154-20882176 CCTATTTGAAGACAGATTCCAGG - Intergenic
952401837 3:32970384-32970406 CCCATTATAAGTCAGATTAAAGG + Intergenic
954065437 3:48102260-48102282 CCTATTTTATATTAGATTAGTGG + Intergenic
954952027 3:54483797-54483819 CTTATTGTAATTCAGATAATAGG + Intronic
956858027 3:73294854-73294876 CTTCTTTTAAGTCAGATAAATGG + Intergenic
960443603 3:117720109-117720131 GCTATTTTAAATCAGGATATAGG - Intergenic
962170509 3:133096631-133096653 TCTATTTTAATACATATTATAGG - Intronic
964015833 3:151945359-151945381 CCTATTTTAAGTCTTCTTTTGGG + Intergenic
964257937 3:154798860-154798882 CTTATTTTAAGAAACATTATCGG - Intergenic
964697280 3:159523937-159523959 CCTGTGTTGACTCAGATTATTGG - Intronic
967445525 3:189561340-189561362 CCTTTTTAAAGTCAAATTCTCGG + Intergenic
970441608 4:16084840-16084862 CCTGTTTTATGTTAGATTCTGGG - Intergenic
970737566 4:19192513-19192535 ACTATTTTAGCTAAGATTATGGG - Intergenic
971105140 4:23516346-23516368 CATTTTTTAAATCAGATTATTGG + Intergenic
972291657 4:37695423-37695445 CCTACTATAAGTAAGATCATAGG - Intergenic
972836770 4:42880474-42880496 CCTATTTTTGGTCTGATTTTAGG - Intergenic
974989042 4:69062288-69062310 CCAATCATAAGTCAGATTAAAGG + Intronic
975887575 4:78983561-78983583 CCTATTATAGGTCAGGTTCTAGG + Intergenic
976675137 4:87694683-87694705 ACTATGTTAACTCAAATTATCGG - Intergenic
976732805 4:88281581-88281603 CCTACTTTAAGGCATATTATTGG + Intronic
977713231 4:100150919-100150941 CCAATTTTGAGTCATTTTATTGG - Intergenic
977837938 4:101667071-101667093 CCCATTTTAAATCATATTGTTGG + Intronic
978435349 4:108678081-108678103 ACTATTTTAACTGAGATGATAGG + Intergenic
979288891 4:118958227-118958249 ACTTTCTTAAGTCAGAATATTGG + Intronic
979493304 4:121355453-121355475 CCTTTTTTCAGTCAGATTAAAGG + Intronic
980674086 4:136051492-136051514 CTTATTTTATGTCACATTGTTGG + Intergenic
981070342 4:140529089-140529111 CCTATTAAAACACAGATTATTGG + Intronic
981329039 4:143487209-143487231 CATATTTTAAGTCAAAATACAGG - Intergenic
983689317 4:170449134-170449156 CCTATTTTAAAATAAATTATTGG + Intergenic
983841966 4:172468200-172468222 CTTATTTTAAATCACAGTATTGG - Intronic
984288491 4:177763564-177763586 CATATTTTAAGTCTGAGGATGGG + Intronic
986388598 5:7264162-7264184 CCAATTTTAAATCAGATAAGCGG + Intergenic
987788921 5:22538294-22538316 AATATTTTAAGTCAGTTGATAGG - Intronic
987880823 5:23743123-23743145 TTTATTTTACTTCAGATTATAGG + Intergenic
988239113 5:28585799-28585821 GCTATTTTAAGTCAAATTTTGGG + Intergenic
988372233 5:30386126-30386148 CCCATTTTGAGTCAAATTTTGGG - Intergenic
988809979 5:34775421-34775443 CCATTTTTAAATCAGATTATTGG - Intronic
989438608 5:41443827-41443849 GCTATTTTAAGTAAAATTACAGG - Intronic
990093207 5:52081595-52081617 TCTATTTTCAGACAGATTGTTGG + Intergenic
990605648 5:57407136-57407158 CCTTTTTAAAGTCAGCTCATGGG + Intergenic
991401082 5:66252159-66252181 CCTATGTTCAGTCAGTCTATAGG + Intergenic
991537158 5:67682489-67682511 CCATTTTTAAATCAGATTATAGG + Intergenic
992331860 5:75725229-75725251 TCTATTTTAAGTCTGATTAATGG + Intergenic
992825412 5:80545143-80545165 CCCATTTTTAGTCAGTTTTTTGG - Intergenic
995289614 5:110436287-110436309 CCTATTTTAAATCAGATTATTGG + Intronic
995558052 5:113350847-113350869 CATTTTTAAAATCAGATTATTGG - Intronic
995984738 5:118156258-118156280 TCTATTTTACGCTAGATTATGGG - Intergenic
998024718 5:138805582-138805604 CCTATTTTAAGTTGGATTATTGG + Intronic
1000623930 5:163517474-163517496 CTTATTTTAAGTAAGCTTTTTGG + Intronic
1000732192 5:164848865-164848887 CCAATCTTAAGTCACATTGTTGG - Intergenic
1001728217 5:173926400-173926422 CCTATTCTAAGTCAGTCTGTTGG + Intronic
1004067054 6:12257689-12257711 CCTATCTTAAGAAAGATTACAGG + Intergenic
1004227591 6:13800777-13800799 CCTATTTAAAGTCCCATAATAGG - Intronic
1006863061 6:37186558-37186580 CCCATTTTTAATCAGATTATTGG + Intergenic
1008871510 6:56277686-56277708 CATATTTTAAATCACATTTTGGG + Intronic
1009602524 6:65820760-65820782 CCATTTTTAAAGCAGATTATTGG - Intergenic
1009778498 6:68237468-68237490 CCTATTTTATGCCAGACTAAAGG + Intergenic
1009912118 6:69943224-69943246 CCATTTTAAAATCAGATTATTGG + Intronic
1010156886 6:72804994-72805016 CCGTTTTAAAATCAGATTATTGG + Intronic
1010308637 6:74355672-74355694 CCTTTTTTAAGTAAAATAATTGG + Intergenic
1010692543 6:78927374-78927396 CCATTTTTAAATCGGATTATTGG + Intronic
1015266440 6:131295940-131295962 CCAATTTTAAATCAGGTTAGCGG + Intergenic
1016583170 6:145652650-145652672 GCTATTTTAAGTCAGAATAGTGG - Intronic
1016916313 6:149247459-149247481 GTCATTTTAAGTCAGATTAAAGG - Intronic
1017864650 6:158432459-158432481 GCTATTTTAACTCACATTAAAGG - Intronic
1021273071 7:18616160-18616182 TCTTTTTTAAGTCAGTTGATTGG + Intronic
1025859148 7:65310236-65310258 CCTAATGCAACTCAGATTATAGG + Intergenic
1027553619 7:79634132-79634154 CCAGCTTTAAGTCACATTATTGG - Intergenic
1028491775 7:91420626-91420648 TCTATATTAAGTCAGCTAATAGG - Intergenic
1029497410 7:100903505-100903527 CCTTTTTTAAGTTACATTTTGGG + Intergenic
1030567390 7:111175933-111175955 CCCATTTTTAATCAGATTATTGG - Intronic
1030637016 7:111961637-111961659 CCTATTTTAAGTCTGAATCAAGG + Intronic
1031745593 7:125493749-125493771 TCTACTTTAATTCAGAATATTGG - Intergenic
1032810436 7:135409070-135409092 TCTAATTTAAGTCAAATTCTGGG - Intronic
1033080830 7:138295635-138295657 CCCATTTAAAATCAGTTTATGGG + Intergenic
1034305961 7:150045874-150045896 ACAATTTTAAGTCAGATTTAAGG + Intergenic
1034800878 7:154054772-154054794 ACAATTTTAAGTCAGATTTAAGG - Intronic
1041980353 8:63851106-63851128 CCTATTTTAAATCTGGTTCTTGG - Intergenic
1042233708 8:66586344-66586366 CCTATTTTAAGTCAGATTATTGG - Intronic
1043567836 8:81568288-81568310 CCATTTTTAAATCAGATTATTGG - Intergenic
1046335881 8:112786571-112786593 CCATTTTTTATTCAGATTATTGG - Intronic
1048637013 8:136307878-136307900 CCTATTTTAGTGAAGATTATAGG - Intergenic
1050179788 9:2908916-2908938 CCTTTTTTAACTCAGCTAATTGG + Intergenic
1051002842 9:12306120-12306142 GCTCTTTTAAGAGAGATTATGGG - Intergenic
1051846468 9:21456852-21456874 TTTATTTTATGTCTGATTATCGG + Intergenic
1051982184 9:23034125-23034147 CCAATTTTAAGTAATATTTTTGG - Intergenic
1055467557 9:76580475-76580497 CGTATTTTAAGTCAGCCTAAAGG - Intergenic
1187066208 X:15840730-15840752 CCTATTTTAAGCTAGATTTTTGG - Intronic
1187145469 X:16632933-16632955 CCTATTTTATGACAGAGAATAGG - Intronic
1187513019 X:19939027-19939049 TCTATTTCATGTCAGATTCTGGG - Intronic
1188241635 X:27800087-27800109 GCTATTTTAAGCCAGTTAATTGG - Intergenic
1188962697 X:36512101-36512123 CCTATTTTTACCCAAATTATGGG - Intergenic
1190230418 X:48577647-48577669 CCTATTTAAAGACAAATTATGGG + Exonic
1192821086 X:74646436-74646458 CATTTTTTTGGTCAGATTATTGG + Intergenic
1193512546 X:82422184-82422206 CTCATTTTAAGTTATATTATTGG - Intergenic
1194251899 X:91586312-91586334 CCATTTTGAAATCAGATTATTGG - Intergenic
1194704356 X:97156894-97156916 CCAAATTTAACTGAGATTATTGG - Intronic
1195230139 X:102838757-102838779 CATAGTTTAGGTCAGGTTATAGG - Intergenic
1195545795 X:106110975-106110997 CCTTTTTTAAACCAGATCATTGG - Intergenic
1196407651 X:115381728-115381750 ATTTTTTTAAATCAGATTATTGG - Intergenic
1198798818 X:140428879-140428901 CCATTTTAAAATCAGATTATTGG - Intergenic
1199450537 X:147974071-147974093 CCATTTTTAAATCAGATTATGGG - Intergenic
1199729377 X:150616081-150616103 CCTATTATAAGGCAGAAAATAGG - Intronic
1200570829 Y:4827543-4827565 CCATTTTGAAATCAGATTATTGG - Intergenic
1202052012 Y:20791207-20791229 CCAATTATAAATCAGATTATAGG - Intergenic