ID: 1042233710

View in Genome Browser
Species Human (GRCh38)
Location 8:66586380-66586402
Sequence TGTTTTCTTTTGAGAAATAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1161
Summary {0: 1, 1: 0, 2: 22, 3: 143, 4: 995}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042233710_1042233714 30 Left 1042233710 8:66586380-66586402 CCAATATTTCTCAAAAGAAAACA 0: 1
1: 0
2: 22
3: 143
4: 995
Right 1042233714 8:66586433-66586455 GCTCAATATCACTAGTCATCAGG No data
1042233710_1042233713 -6 Left 1042233710 8:66586380-66586402 CCAATATTTCTCAAAAGAAAACA 0: 1
1: 0
2: 22
3: 143
4: 995
Right 1042233713 8:66586397-66586419 AAAACATACAAATGGACAATGGG No data
1042233710_1042233712 -7 Left 1042233710 8:66586380-66586402 CCAATATTTCTCAAAAGAAAACA 0: 1
1: 0
2: 22
3: 143
4: 995
Right 1042233712 8:66586396-66586418 GAAAACATACAAATGGACAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042233710 Original CRISPR TGTTTTCTTTTGAGAAATAT TGG (reversed) Intronic
900230081 1:1552266-1552288 TGGTTACCTTTGAGAAAAATGGG - Intronic
900434815 1:2624567-2624589 TTTTATGTTTTGACAAATATTGG + Intronic
902111981 1:14087876-14087898 TCTATACTTTTGAGAAGTATTGG + Intergenic
902365915 1:15974344-15974366 TTTTTTCTTTTAATAAAGATGGG + Intronic
902401833 1:16162223-16162245 TGTGTTCTTTTGAAAAAGATGGG - Intergenic
902634819 1:17728372-17728394 TTTTTTTTTTTGAGAAGTAGGGG + Intergenic
902757749 1:18560300-18560322 TGTTTCCTGATGAGAAAAATGGG - Intergenic
903111755 1:21141131-21141153 GGTTTTCTATTTTGAAATATGGG - Intronic
903945101 1:26957720-26957742 TGCTTTAGTTTGAGAAATGTGGG + Intronic
904109753 1:28116544-28116566 TGCTTTTTTTTAAGAGATATGGG + Intergenic
904634368 1:31868317-31868339 TGTTTTCTTTTGAGTTGTAGGGG - Intergenic
905058022 1:35115748-35115770 TTTTTACTTTTGATAGATATTGG + Exonic
905112588 1:35607320-35607342 TGTTCTCTATTGAGATATTTCGG - Intronic
906757956 1:48338777-48338799 TGTTTGCTTTTCAGAGATTTTGG - Intronic
906878312 1:49562100-49562122 TGTCTTCTTTTGAGAAGTGTGGG + Intronic
906991175 1:50740881-50740903 TGTTTTACTTTGTGAATTATTGG + Intronic
907103638 1:51860329-51860351 TGTTTTTTCTTCAAAAATATAGG + Intronic
907224656 1:52934416-52934438 TGGTTTTTTTGGAAAAATATCGG - Intronic
908152707 1:61320054-61320076 TGATTTCTGTTGTCAAATATTGG + Intronic
908290231 1:62658540-62658562 TGATTTTTTATGAGAAATCTAGG - Intronic
908924537 1:69238657-69238679 TGTCTTCTTTTGAGAAGTGTTGG + Intergenic
908927371 1:69272039-69272061 TCTTGTCTTTTGAGAGGTATAGG + Intergenic
908951268 1:69566505-69566527 GGTATTCTTTTGTGGAATATAGG - Intergenic
909085778 1:71168754-71168776 GGTTTTCTTTTTGGAAATAATGG + Intergenic
909248123 1:73315296-73315318 TGTTTTCTGTGTAAAAATATTGG - Intergenic
909290147 1:73872783-73872805 TGTTTTCTGTAGTGAAATAGTGG + Intergenic
909291038 1:73883906-73883928 TGTTTTCTTTGGCGAAGTGTTGG - Intergenic
909470071 1:76017641-76017663 TTTCTTCTTTTGAGAGAGATAGG - Intergenic
909558918 1:76987288-76987310 TATCTTCTTTGGAGAAATGTTGG - Intronic
909868678 1:80709250-80709272 TGATTTCTGTTTTGAAATATGGG - Intergenic
909974738 1:82032189-82032211 TTTTTTCTTTAAAAAAATATCGG + Intergenic
910011218 1:82465162-82465184 TGTGTTTTTTTGATAAATACTGG - Intergenic
910194537 1:84626420-84626442 TGTGTTTTTTTGAGAGAGATAGG - Intergenic
910346899 1:86249101-86249123 TGTTTTCCTTAGAAAAACATTGG + Intergenic
910764925 1:90772176-90772198 TGTCTTCTTTTGAGACGTGTCGG - Intergenic
911308821 1:96267147-96267169 CATTTTCTTTTGAAAAATAGGGG - Intergenic
911506815 1:98763242-98763264 TGTTTTCTTCTGAGAGTTTTAGG + Intergenic
911533184 1:99070570-99070592 TGGTTTATTCTGAGATATATTGG + Intergenic
911534339 1:99081948-99081970 TGTTATCTTTGGGGAAAAATAGG + Intergenic
911707249 1:101027580-101027602 TGGTTTCTATTGAGATATACAGG - Intergenic
911779665 1:101860251-101860273 TCTTTACTTCTAAGAAATATTGG - Intronic
911963117 1:104332795-104332817 TGTCTTCTTTTGAGAAGTGTCGG + Intergenic
912116731 1:106416636-106416658 TGTTTTCTTTTGTTCAATAGAGG + Intergenic
912117471 1:106424599-106424621 TCTCTTCTTCTGAGAAATACCGG - Intergenic
912237867 1:107871718-107871740 TGTTTTCTTTTGGAAAATCCTGG - Intronic
912393250 1:109319475-109319497 AATATTCTTTTGAGAAATGTGGG - Intronic
912484716 1:110016764-110016786 TGTGTACTTATTAGAAATATTGG + Intronic
912586571 1:110772145-110772167 TGTTTTCTTTTGAGAACCTGTGG + Intergenic
913132188 1:115850648-115850670 TGTCTTCTTCTGAAAAAGATGGG + Intergenic
913153108 1:116065385-116065407 TGTTTTATTCTGCAAAATATAGG + Intronic
914710578 1:150209382-150209404 TTTTTTCTTTTTATAAAGATAGG - Intergenic
915069777 1:153257208-153257230 CATTTTCTTCTAAGAAATATAGG - Intergenic
915183624 1:154084777-154084799 TTTTTTTTTTAAAGAAATATGGG - Intronic
917031416 1:170696404-170696426 TGTTATCTTTTCATAACTATTGG - Intronic
917595495 1:176525117-176525139 GGTTTTCTTTCTTGAAATATAGG + Intronic
917635364 1:176930496-176930518 TGGTTTCTTTAGAGGAGTATGGG + Intronic
917674271 1:177304414-177304436 TGTTTGCTTATGAGAAACAAGGG - Intergenic
917847106 1:179028884-179028906 TTTTTTCTTTTGACAAAAAGAGG - Intronic
918176434 1:182050331-182050353 TGTTTCCTTTTCTGAAAAATGGG + Intergenic
918653626 1:186997280-186997302 TGCATTCTTTTGAGGAAGATGGG + Intergenic
918913382 1:190603252-190603274 TGTTTTTTTTTCAGAACTGTTGG - Intergenic
918944370 1:191042548-191042570 TCTCTTCTTTTGAGAAATGTTGG - Intergenic
919024824 1:192154119-192154141 ATCTATCTTTTGAGAAATATAGG + Intergenic
919030070 1:192230700-192230722 TTTCTTCCTTTGAGAAATTTAGG - Intergenic
919208015 1:194442348-194442370 TATTTTCCTTTAAGAAAAATAGG + Intergenic
919279703 1:195473076-195473098 TGTTTTAGTTTGAGAAAACTGGG + Intergenic
919373870 1:196767058-196767080 CTTTCTCCTTTGAGAAATATAGG - Intergenic
919374438 1:196776315-196776337 CTTTCTCCTTTGAGAAATATAGG - Intronic
919380311 1:196851741-196851763 CTTTCTCCTTTGAGAAATATAGG - Intronic
919383532 1:196889611-196889633 CTTTCTCCTTTGAGAAATATAGG - Intronic
919394571 1:197028698-197028720 TGTTTTCTTTCCTTAAATATGGG + Intergenic
919616764 1:199817575-199817597 TGTTTGCTTTTGGGAAACAGAGG - Intergenic
919771340 1:201161099-201161121 TTTTATCTTTTGGAAAATATAGG - Intronic
920027877 1:203014209-203014231 TGTTTTCTTATTAGTAAAATGGG + Intronic
920774930 1:208926875-208926897 TGTTTTGTTGTGGGAAATAAGGG - Intergenic
921525849 1:216216980-216217002 TATTTTTTTTTGACAAATAAAGG - Intronic
921567652 1:216739528-216739550 TATTTTCCTTTGAGAACTACTGG - Intronic
921970654 1:221145786-221145808 TGTTTTCTTGTGACAATTTTTGG - Intergenic
922600066 1:226844534-226844556 TGTTTTCTTATGACAACAATTGG - Intergenic
922716905 1:227882079-227882101 AGTTTTCTTTTAATTAATATTGG - Intergenic
922923077 1:229325069-229325091 TGTTTTATTTTGATGAATATTGG - Exonic
923082618 1:230672947-230672969 TTTGTTCTTTGCAGAAATATGGG + Intronic
923195833 1:231666552-231666574 TGTTATCTTTTAACAAATAATGG + Intronic
923431973 1:233931494-233931516 TGTCTTCTTTTGAGAAGCGTCGG - Intronic
924013120 1:239689223-239689245 TCTTTTTTGTTGAAAAATATAGG + Intronic
924245271 1:242077738-242077760 TGTCTTCTTTTGAGAAGTGTTGG + Intergenic
924253625 1:242160015-242160037 TATTTTTTTTTGAGATAGATAGG + Intronic
924365363 1:243287476-243287498 GGTTTGCTATTGAGAAGTATAGG + Intronic
924430425 1:243991765-243991787 TGTCTTCTTTTGAGAACCACTGG + Intergenic
924432037 1:244005491-244005513 AGGTTCCTTTGGAGAAATATTGG - Intergenic
924479132 1:244411839-244411861 TGCTGTCTTCTGAGAAATCTAGG + Intronic
924524115 1:244831676-244831698 TGTTTTTTTTTGACAGAGATGGG + Intergenic
924635921 1:245787824-245787846 GGTTTGCTTTTGAGGAATCTGGG - Intronic
924831640 1:247601936-247601958 TGTTTCCATTTTGGAAATATTGG - Intergenic
924885656 1:248213679-248213701 TTGTTTATTTTGAGGAATATAGG + Intergenic
1063085819 10:2816897-2816919 TGTTCACTTTTAAAAAATATTGG + Intergenic
1063108020 10:3010739-3010761 TATTTTCTTTTTAAAAGTATCGG + Intergenic
1063122366 10:3114011-3114033 GGTTTTCTTGTGAGGAAAATGGG - Intronic
1063661120 10:8035727-8035749 TTTTTTCATTTGAGAAAGACGGG + Intergenic
1063829448 10:9935349-9935371 TTTTTTTTTTTTAGAAAGATGGG - Intergenic
1064484777 10:15774556-15774578 TGTCTTCTTTTGAGAAGTGTCGG - Intergenic
1064764856 10:18660063-18660085 TTTTTTTTTTTGAGTAATGTAGG + Intronic
1064887681 10:20129270-20129292 TGTTTTCATTTGAGAAATGTCGG + Intronic
1065048708 10:21768099-21768121 TGTATATTTTTAAGAAATATGGG + Intronic
1065070029 10:22014229-22014251 TGTATTCTTTTGAGATAAAGGGG - Intergenic
1065348427 10:24772262-24772284 TGTTTTCTTTTGAAAAAAAAAGG - Intergenic
1065525381 10:26614919-26614941 TGTCTTCTTTTGAGGAGTGTTGG - Intergenic
1065597397 10:27327961-27327983 TGTCTTCTTTTGAGGAGTGTTGG + Intergenic
1065612315 10:27484313-27484335 TGTTTTCTTTTGTATAAAATGGG - Intergenic
1065637942 10:27750525-27750547 TATTTTCTTGTGTGTAATATAGG - Intergenic
1065726021 10:28668701-28668723 TGTTTTATTTTGAGACAAGTCGG + Intergenic
1066079678 10:31917960-31917982 TTTTTTCTTTTGAGAGATGGGGG + Intronic
1066451393 10:35533345-35533367 TGTTTTCCTTTGAGGAAGATGGG - Intronic
1066574251 10:36808277-36808299 TGTTTTCTTTTAATTGATATAGG - Intergenic
1067470492 10:46534251-46534273 TGTTTTCTTTGTATAAATTTAGG - Intergenic
1068004469 10:51376479-51376501 TGTTTGCTATTGAAAAAAATTGG + Intronic
1068078750 10:52292053-52292075 TGTCTTCTTTTGAGAAGTGTCGG + Intronic
1068245683 10:54363910-54363932 TTATTTCTTTTAAAAAATATTGG + Intronic
1068309545 10:55260460-55260482 TGTTTTCTTTTAATCAATTTTGG - Intronic
1068504443 10:57882199-57882221 TGTTTTCTGTAGTGACATATGGG - Intergenic
1068678984 10:59798618-59798640 TGTTTTCTTTAAAAAAACATTGG + Intronic
1068897002 10:62215966-62215988 TGTTTTGTTTTGACAAATCAAGG - Intronic
1068941886 10:62688750-62688772 TTTTTTCTTTTGAGGCTTATGGG - Intergenic
1069054228 10:63828169-63828191 TTTTTTCTTTTAAGAGATGTAGG + Intergenic
1069099716 10:64304874-64304896 TGTTTTCTTTTAAGAAAGGAGGG - Intergenic
1069169737 10:65211292-65211314 TGTTTGCTTAAGAGAAAAATGGG - Intergenic
1069203805 10:65656884-65656906 TGTCTTCTTTTGAGAAGCATCGG - Intergenic
1069329143 10:67270119-67270141 TTTTTTTTTTTGACAAATACTGG - Intronic
1069388431 10:67906438-67906460 TTTTTTCTTTAAAGAAAAATGGG - Intronic
1069390724 10:67931766-67931788 TGTTTTCTTTTGAGACAGACAGG + Intronic
1069528690 10:69198237-69198259 TGTTTTCTTTTGAAAAACATTGG + Intronic
1069683727 10:70303009-70303031 TTTTTTCTTTTAAGAAATAGAGG - Intronic
1070110359 10:73481171-73481193 TTTTTTTTTTTTAGAAAAATAGG + Intronic
1070224670 10:74490050-74490072 TGGTTCATTTTCAGAAATATTGG - Intronic
1070817508 10:79334531-79334553 TGTTGTCTTTTGATGAATACAGG + Intergenic
1071066260 10:81639751-81639773 TGTCTTCTTTTGAGAAGTGTTGG + Intergenic
1071143093 10:82535480-82535502 TTTTCTATTTTGAGATATATAGG + Intronic
1071185600 10:83040549-83040571 TTTTTTCATTTGACAAATACTGG + Intergenic
1071612713 10:87046114-87046136 TTTTTTTTTTTGAAAGATATAGG + Intergenic
1071743315 10:88387101-88387123 TTTTTTCCCTTGAGAAATAGAGG - Intronic
1072416832 10:95254308-95254330 TGTTTTCTTTTGATTAATATTGG - Intronic
1072428708 10:95352470-95352492 TGTAGTCTTTGGAGAAAAATCGG - Intronic
1072588746 10:96807222-96807244 CATTTTCTTTTTAGAAATTTTGG + Intergenic
1073167640 10:101471421-101471443 TTTTTTCATCTGAGATATATAGG + Intronic
1073667012 10:105545005-105545027 TGTTTTCTGATGAGAAATGATGG - Intergenic
1073833803 10:107417565-107417587 TGTTTTCTTGTGAAAAATCTGGG + Intergenic
1073983773 10:109184642-109184664 TGTCCTCTTTTGAGAAGTGTTGG + Intergenic
1074354910 10:112773995-112774017 TGTCTTCTTTTGCCAAATAAGGG - Intronic
1074661450 10:115662590-115662612 TTTTATCTTTTGAGAATTTTTGG + Intronic
1074665352 10:115716315-115716337 TTTTTTCCTTTGAGGAAAATGGG - Intronic
1075251654 10:120882545-120882567 TTTTTTTTTTTCATAAATATAGG + Intronic
1075541035 10:123314423-123314445 TTTTTTCTTTTGAGAAAACTAGG - Intergenic
1075708809 10:124519333-124519355 TTTTTTCTTTTTATAAAAATGGG + Intronic
1075750310 10:124764091-124764113 TGTTTTCTTTTTAGTATTAAGGG - Intronic
1075962050 10:126576269-126576291 TGTCTCCTTTTGAGAGATGTTGG - Intronic
1076146053 10:128123223-128123245 TGTTTTATTTTGGGAAATTGAGG - Intronic
1078602000 11:12740960-12740982 AATTTTCTTTTTAAAAATATTGG + Intronic
1079078930 11:17400544-17400566 AGTTTTCTTATGAAAAAAATGGG + Intronic
1079213002 11:18480390-18480412 TGTTTTCTTTTGGTAAAGACTGG - Exonic
1079360212 11:19764533-19764555 TGTTTTCTTATCAGTAAAATAGG + Intronic
1079421530 11:20294808-20294830 TTTTTTTTTTGGAGAAATATTGG + Intergenic
1079716491 11:23754353-23754375 TCTATTCTTTTGAGAAATAAAGG + Intergenic
1079938756 11:26651547-26651569 GTTTTTCTTTTGGAAAATATAGG + Intronic
1080303890 11:30816291-30816313 TTTTTCCTTTTCAAAAATATAGG - Intergenic
1080757997 11:35220467-35220489 TGTTTTCTTCTTGGAAATTTTGG - Intronic
1080959255 11:37138944-37138966 TGTCTTCTTTTGAGAAATGTTGG - Intergenic
1080972531 11:37295475-37295497 GGTCTTCTTTGGAGAAACATTGG + Intergenic
1081140013 11:39486911-39486933 TGTTTTCCTTGGAAAAATATAGG + Intergenic
1081305104 11:41502202-41502224 TGTTTGTTTCTGAAAAATATTGG - Intergenic
1081341952 11:41938850-41938872 TGTTCTCATTTGTGAAATAATGG + Intergenic
1083020266 11:59499716-59499738 TGTTTACATTTGGGACATATAGG - Intergenic
1084689112 11:70714773-70714795 TTTTTTCTTTTGCAAAAGATTGG + Intronic
1085175543 11:74484163-74484185 TGTTTTTTTCTGAGGAGTATCGG - Intergenic
1085342262 11:75740401-75740423 TGTTTAGTTTTGAGAAGTACAGG - Intergenic
1085569591 11:77547641-77547663 TGTATTCTTTAGAAATATATAGG - Intronic
1085574781 11:77592255-77592277 TTTTTTCTTTTGAGACAGACAGG - Intronic
1085834763 11:79941005-79941027 TGTTTTCATATGAACAATATGGG - Intergenic
1085862591 11:80252086-80252108 TGTCTTCAAGTGAGAAATATTGG + Intergenic
1086587296 11:88469029-88469051 TTTTTTCTTTTGATAGAGATGGG + Intergenic
1087103681 11:94389518-94389540 TGTCTTCTTTTGAGAAGTGTTGG - Intronic
1087240429 11:95768963-95768985 AGTTTTTTATTGTGAAATATTGG + Exonic
1087584754 11:100104694-100104716 TGTTTTCCTTTGAGGAAAATGGG + Intronic
1087847964 11:102994697-102994719 TGGTTTATTTTAAGCAATATAGG + Intergenic
1088347846 11:108849227-108849249 AGTTTTCTTTTTTGAAAAATAGG + Intronic
1088519744 11:110682828-110682850 TGTTTTCCTCTGTAAAATATGGG - Intronic
1089033386 11:115357600-115357622 TGTTTTCTTTTCTGTAAAATGGG + Intronic
1089104504 11:115990946-115990968 TGGTTTCTTTTGATAAATGGGGG - Intergenic
1089211522 11:116807114-116807136 TGCTTTCTTTTGATTACTATTGG - Intergenic
1089444174 11:118538590-118538612 TGTCTTCTTTTGAGAAATGTCGG + Intronic
1089939573 11:122401603-122401625 TGTCTTCTTTAGAGAAATGTCGG - Intergenic
1090039185 11:123275331-123275353 TGTTTTCATTTGAGCAGGATAGG + Intergenic
1090045628 11:123330192-123330214 AGAGTTCTTTTGAGAAATCTTGG - Intergenic
1090194924 11:124806735-124806757 TTTTTTTTTTTTAGAAACATGGG - Intergenic
1090698570 11:129273675-129273697 TCCTTTCATTGGAGAAATATAGG - Intronic
1091088618 11:132748070-132748092 TTTTTTTTTTAGAGAAAAATAGG + Intronic
1091191198 11:133696709-133696731 AGTGTTCTTTAGTGAAATATTGG - Intergenic
1091371901 11:135067673-135067695 AGTTATCTTTTGAGAAAGAGAGG + Intergenic
1091956815 12:4651497-4651519 TGTTTTTTTTTAATAATTATGGG - Intronic
1092042967 12:5401627-5401649 TGTGTTATTTTTAGAAATAATGG - Intergenic
1092051131 12:5471104-5471126 TGATTTCTGTTGAGAAACATGGG + Intronic
1092077001 12:5682189-5682211 TTTTTGTTTTTGATAAATATAGG - Intronic
1092177861 12:6423167-6423189 TGTTTTCTTTTTATAGATGTAGG + Intergenic
1092721600 12:11446641-11446663 TTTTTTTTTTTGAGACAGATTGG - Intronic
1092748543 12:11696402-11696424 AGTTTTCTTGTGAGTAAAATAGG + Intronic
1092797358 12:12125783-12125805 TGTTTTCTTTTGAGCAAGTCTGG - Intronic
1092833467 12:12466558-12466580 TTTTTTCTTTTCAGAAATGAAGG - Exonic
1093069339 12:14692363-14692385 TTTTTTGGCTTGAGAAATATAGG + Intronic
1093135227 12:15441470-15441492 TCTTTTCTTCTGAGAACTTTGGG - Intronic
1093420887 12:18973377-18973399 TGTTCTGTTTTGACCAATATTGG + Intergenic
1093573636 12:20698995-20699017 TGTTTTTGTTTGATAAATAAGGG - Intronic
1093630785 12:21406937-21406959 TGTTTTCTTTTGAGAAAAGATGG - Intronic
1093838008 12:23859863-23859885 TCTTTTCTATTGTGAACTATTGG - Intronic
1094111295 12:26865514-26865536 TGTTATTTTTTGAGAGATTTTGG + Intergenic
1094211742 12:27900418-27900440 TTTTTTTCTCTGAGAAATATGGG - Intergenic
1094293024 12:28873388-28873410 AGTTTTCTTTTGGAAAATATGGG - Intergenic
1094537114 12:31331450-31331472 TGTTTTGTTGTGAGAAAAAGAGG - Intergenic
1095094589 12:38139041-38139063 TTTTTTTTTTTGAGAAAAGTTGG + Intergenic
1095312048 12:40710775-40710797 AGTATTCTTTTTAGAAATAGAGG - Intronic
1095437511 12:42207308-42207330 TGCTTTCTTTTCAGAAATGAAGG - Intronic
1096093859 12:48921522-48921544 TTTTTTTTTTTGAGAAATGTAGG + Exonic
1096201005 12:49682943-49682965 TGTTATCTGTGGAGAGATATGGG + Intronic
1096237434 12:49939265-49939287 TTTTTTTTTTTGAGAAATCTCGG - Intergenic
1097327508 12:58295027-58295049 TCTTTTCTTTACAGTAATATGGG + Intergenic
1097653545 12:62333467-62333489 TGTTTTGTTTTTATAAAGATGGG + Intronic
1097855543 12:64457862-64457884 TGTTTCCTTTGGAGAACTTTAGG - Intronic
1098083021 12:66809831-66809853 TGTTTTGTTTTGAGACAGACAGG + Intergenic
1098278986 12:68843988-68844010 TGTTTTTTTCTGAGGAGTATCGG + Exonic
1098347380 12:69520200-69520222 TGTGTTCTTTTGAAAAGTGTTGG + Intronic
1098569408 12:71971802-71971824 TGGTTGCTTTTGAGATATAGTGG + Intronic
1098691052 12:73488540-73488562 CCTTTTCTGTAGAGAAATATTGG - Intergenic
1099074326 12:78086216-78086238 TGTTTTCTTTTATGCAATTTTGG - Intronic
1099194826 12:79603429-79603451 TCTTTTTTTTTGTGAAAAATGGG - Intronic
1099278761 12:80614768-80614790 AGTTTTCTTATGTGAAAAATTGG + Intronic
1099316554 12:81090276-81090298 TGTTTTCTTTTAAGCAAATTTGG + Intronic
1099411858 12:82339776-82339798 TGTTTTATGTTGACACATATAGG + Intronic
1099506777 12:83487459-83487481 TGTCATCTTTTGAGAAATTCGGG + Intergenic
1100028440 12:90157363-90157385 TTTTATGTTTTGAGATATATTGG + Intergenic
1100113895 12:91279198-91279220 TGTTTTCTTTTTAAACATTTTGG - Intergenic
1100628996 12:96367916-96367938 TGCTTTCTTTTGGTAAATTTAGG - Intronic
1100889995 12:99114823-99114845 TGTCTTCTTTAGAAAAGTATCGG - Intronic
1100905925 12:99299064-99299086 TTTTTTTTTTTGAGATAGATAGG + Intronic
1101227076 12:102699325-102699347 TGTTATATTTGGAGAAATGTGGG + Intergenic
1101457335 12:104848223-104848245 TGTTTTCTTCTTTGAACTATGGG - Intronic
1101486002 12:105160521-105160543 TGTTTTCTTTTTTAAGATATGGG + Intronic
1101550002 12:105752812-105752834 TATTTTCTTTTGATAAAACTTGG - Intergenic
1101622548 12:106403158-106403180 TGTCTTCTTTTGAGAAGTGTCGG - Intronic
1102082402 12:110109089-110109111 TGTGTGCTTTGGAGAGATATTGG + Intergenic
1102958557 12:117075986-117076008 TTTTTTTTTTTTAGAAATACAGG + Intronic
1104107046 12:125672765-125672787 TGATGTCTTTTGAAAAACATAGG - Intergenic
1104214529 12:126723118-126723140 TGTTTTCTTGTGTGTAAAATTGG + Intergenic
1104696643 12:130869202-130869224 TGTTTTTTTTTTAGAGACATGGG + Intergenic
1105629429 13:22147294-22147316 TCATTTCTTTTGAGATATTTAGG - Intergenic
1106279088 13:28247208-28247230 TGTCTTCTTTTGGGAAATGTCGG + Intronic
1106327012 13:28702153-28702175 TGTTTTTTTTTGGTAAAGATGGG + Intronic
1106345066 13:28868703-28868725 TCTTTTCTTTTATGAACTATGGG - Intronic
1106636508 13:31534360-31534382 TGTTTTCCCCTAAGAAATATGGG - Intergenic
1106836939 13:33644676-33644698 TGTTTTGTTTTGTCAATTATAGG - Intergenic
1107379092 13:39836497-39836519 TGTTTTTTCTTTAGATATATTGG + Intergenic
1107476934 13:40746148-40746170 TGTTTTGTTTTTAGTAGTATTGG - Intronic
1107804871 13:44144246-44144268 TGATTCCTGTAGAGAAATATTGG + Intronic
1108162993 13:47662247-47662269 TGTGTTCTTTTGAAAAATGTGGG - Intergenic
1108402349 13:50058918-50058940 TGTTTTCTTTGGAGAAAAGCAGG - Intergenic
1108994278 13:56706511-56706533 TTTTTGCTTTTAAGAAATACAGG - Intergenic
1109061290 13:57623712-57623734 TGTATTTTTCTGAGAAAAATTGG + Intergenic
1109094965 13:58102346-58102368 TGTCTTCTTTTGATAATTGTTGG + Intergenic
1109235946 13:59820220-59820242 TGCTTTCTATTCAGAGATATTGG + Intronic
1109376739 13:61504973-61504995 AGTTTGCTTTTGAGAAGTAGGGG - Intergenic
1109495588 13:63167576-63167598 TTATTTCTTTTGAGAAAAAATGG + Intergenic
1109672917 13:65633837-65633859 TGTTTGATTTTTAGCAATATTGG - Intergenic
1109817240 13:67601057-67601079 TGTTTTATTTTCAAAAATATGGG + Intergenic
1109873184 13:68364221-68364243 TGTTTTCTTATAAGCAAGATAGG + Intergenic
1109884224 13:68522769-68522791 TGTTTTCTTCTGAGAAGTGTTGG - Intergenic
1110010485 13:70326772-70326794 TGTCTTCTTTTGAAAATTGTCGG + Intergenic
1110251666 13:73387387-73387409 TTTTTTTTTTTGCCAAATATCGG + Intergenic
1110339576 13:74373739-74373761 TTTTTTTTTTTCAGAAATAACGG + Intergenic
1110358515 13:74597617-74597639 TCATTTCTTTTGGCAAATATAGG + Intergenic
1110393275 13:75000883-75000905 TTTTTTTTTTTGAGAAATACAGG - Intergenic
1110403644 13:75123066-75123088 TTTTAGCATTTGAGAAATATGGG + Intergenic
1110577960 13:77082150-77082172 TTTTTGTTTTTGAGAAATAAAGG + Intronic
1111039989 13:82735332-82735354 TGTCTTCTTTTGAGAAGTGTCGG + Intergenic
1111191562 13:84814180-84814202 TGTTTTTACTTGAGAATTATTGG + Intergenic
1111346444 13:86961473-86961495 TATTTTCTTTGGAGAAATATTGG + Intergenic
1111605578 13:90534523-90534545 TTATTTCTTTTAACAAATATAGG - Intergenic
1111624553 13:90767957-90767979 TGTTTTCTAATGGGAAAAATTGG - Intergenic
1111845594 13:93504736-93504758 TGTTTTTTTTAGATAATTATTGG - Intronic
1112134255 13:96558659-96558681 TGTTTTCTTTTTAGAAATTTAGG + Intronic
1112282944 13:98078558-98078580 TTTTTTTTTTTGAGAAAGAAAGG - Intergenic
1112863556 13:103865304-103865326 GGTTTTGCTGTGAGAAATATTGG + Intergenic
1113220098 13:108090525-108090547 TGATTTCTTTTAGGAAAGATTGG - Intergenic
1113239040 13:108316018-108316040 TGTTTTGTTTTAAGATATCTTGG + Intergenic
1113360223 13:109623633-109623655 TGTTTTCCTGTGTGAAATAAGGG - Intergenic
1113400818 13:109991611-109991633 TATTTACATTTGAGAAATTTGGG - Intergenic
1114516557 14:23303288-23303310 TGTTTTCTTTTCTGAAACCTAGG + Intronic
1114535370 14:23419045-23419067 TGATTTCTTTTTAGAATTCTTGG + Intronic
1114703437 14:24702370-24702392 TGCTTGCTTTGGAAAAATATCGG + Intergenic
1114734894 14:25034131-25034153 TGTTTGCTTTTGATAAAGGTAGG + Intronic
1114770309 14:25423324-25423346 TGTCTTCTTTTGAGAAGTGTCGG + Intergenic
1114982453 14:28182155-28182177 TGTATTCTTTTTAGAAATTTAGG + Intergenic
1115181274 14:30628726-30628748 TCTTTTCCTTTGAGAAATACTGG + Intronic
1115400222 14:32949929-32949951 TGTTTTCTTTGAAGAGATTTTGG + Intronic
1115581201 14:34760493-34760515 TTTTTTTTTTTGAGAAACAGTGG + Intronic
1115586354 14:34817573-34817595 TGTTTTGTTTTGAGACAGACTGG - Intronic
1115915530 14:38309222-38309244 TGTTTTATTATAAAAAATATTGG - Intergenic
1116065547 14:39977882-39977904 TTTTTTGTTTTTAAAAATATGGG + Intergenic
1116120318 14:40714807-40714829 TGTGTTCTTTTGAGAGTTATTGG + Intergenic
1116284192 14:42950766-42950788 TGTTTTCTTTTTAGATGTGTCGG + Intergenic
1116343473 14:43756603-43756625 TGTCTTCTTTTGAGGAGTGTCGG - Intergenic
1116591238 14:46776983-46777005 TCTTTTTTTCTGAAAAATATTGG + Intergenic
1116907438 14:50417755-50417777 TGTTTTCTTTTTGGAACTCTGGG + Intergenic
1116994251 14:51305755-51305777 TCCTTTCTTTTAAGAAATAATGG - Intergenic
1117208024 14:53464756-53464778 TGGTTTCTTTTTTGGAATATGGG + Intergenic
1117693381 14:58333371-58333393 TATTTACTTTGGATAAATATAGG + Intronic
1117768183 14:59105078-59105100 TGTCTTCTCTGGAGAAATGTTGG - Intergenic
1118174153 14:63421273-63421295 TCTATTCTTTTGAGAAATTTTGG + Intronic
1118281904 14:64436940-64436962 TTTTTTCTTTTGAAAAATAAGGG + Intronic
1118374052 14:65161602-65161624 TGTGTTCTTTACAGAAATTTTGG - Intergenic
1118545513 14:66883555-66883577 TGTTCTATGTTGAGAAATTTTGG + Intronic
1118815421 14:69309824-69309846 TGTTTTCTTTTATGACATATGGG + Intronic
1118962079 14:70543036-70543058 TGATTTCTTTTAATAAAAATGGG + Intergenic
1119342470 14:73891135-73891157 TGGTTGCCTTTTAGAAATATTGG + Intronic
1120306351 14:82775475-82775497 TGTTTTCTGTTTAAAAATTTGGG + Intergenic
1120332638 14:83113248-83113270 TATTTTCTTTTTAGAAATTGTGG - Intergenic
1120582280 14:86267611-86267633 TGTCTTCTTTTGAGAAGTGTGGG - Intergenic
1120894344 14:89516376-89516398 TGTGTTCATTTGTGAAATTTCGG - Intronic
1121207006 14:92178021-92178043 GGTTTCCTTTTCAGAAGTATAGG - Intergenic
1121307488 14:92916213-92916235 TGTTTTCTCTTCAGGAAGATAGG - Intergenic
1121776557 14:96594642-96594664 TGTTTTCTTGTGAAAATTAAAGG + Intergenic
1124410062 15:29429736-29429758 TGTATTCCTTTGAGAACTACGGG - Intronic
1124705958 15:31964383-31964405 TTTTATCATTTTAGAAATATGGG + Intergenic
1124797392 15:32795172-32795194 TGTTTTCTTTTGAGTCATTCAGG - Intronic
1124823640 15:33072119-33072141 TCTTTTCTTTTGAGTAACTTGGG + Intronic
1125047260 15:35256529-35256551 TTTTTTCTTTTTAGAAATAAAGG + Intronic
1125550124 15:40538800-40538822 TGTTTTCCTTAGAGCAATAAAGG + Intronic
1125798874 15:42426574-42426596 TTTTTTTTTTTGAGAAACAGAGG + Intronic
1125876715 15:43154403-43154425 AATTTTCTTTTGACAAATCTAGG - Intronic
1125965072 15:43867774-43867796 TGTTTTCTTTTCAGAAGTTATGG + Exonic
1126390740 15:48148761-48148783 TGTTTTCTGTTAATAAAGATAGG - Intronic
1126523661 15:49625183-49625205 TCACTTCGTTTGAGAAATATAGG - Exonic
1126732449 15:51698078-51698100 TGCTTTCTTTTTGGAAATAGTGG - Intronic
1127481778 15:59384314-59384336 TTTTTTTTTTTGAGAGAGATAGG - Intronic
1127491015 15:59463669-59463691 TGTTATTTTTAGAGAAAGATAGG - Intronic
1127545394 15:59989721-59989743 TGTTTTGTTTTGGAAAATATAGG - Intergenic
1127788329 15:62376274-62376296 GTTTTTTTTTTGAGATATATTGG - Intergenic
1128232378 15:66044489-66044511 TGTTTACTCTTGAGAATTATGGG - Intronic
1128591351 15:68900569-68900591 TGTTTTGTTTTAAGAAATGGTGG - Intronic
1128827049 15:70728886-70728908 TGTGTTCTTTTGAGAGGTGTCGG - Intronic
1129080424 15:73034566-73034588 TGTCATGTTTTGGGAAATATGGG - Intergenic
1129100048 15:73253028-73253050 TGTATTCTTTTGAGTATTATTGG - Intronic
1130167267 15:81474295-81474317 TGTTTCCTTTTTACAAATACAGG - Intergenic
1130338076 15:82974761-82974783 TGTCTTCTTTTAAGAAATGTCGG - Intronic
1131138441 15:89957588-89957610 TGTTTGCTTTTAAGGAATGTAGG - Intergenic
1131343372 15:91623737-91623759 TGTTCTCTTATGAAAAATGTGGG - Intergenic
1131599763 15:93835305-93835327 TCTTTTCTTTTGAAAAAAGTGGG - Intergenic
1131835544 15:96386867-96386889 TGTTTCTTTATGTGAAATATAGG - Intergenic
1132307140 15:100824518-100824540 TGATTCCTTTTGAGAATTCTGGG - Intergenic
1132919018 16:2373653-2373675 GATTTTCTTTTCAGAACTATAGG + Intergenic
1133330739 16:4971824-4971846 TTCATTCCTTTGAGAAATATTGG + Intronic
1134107925 16:11497337-11497359 TGTTTTCTTTGCTCAAATATAGG - Intronic
1134126849 16:11621933-11621955 TGGTTTCTTTTGAAAAAAATGGG - Intronic
1134358600 16:13508114-13508136 TGTTTCCTTTTCTGTAATATGGG + Intergenic
1134389263 16:13803998-13804020 TGATGTCTTTTGAGATATATTGG - Intergenic
1134424127 16:14123083-14123105 TATCTTCTTTTGAGAAGTGTCGG + Intronic
1134447821 16:14344143-14344165 TTTTTTTTTTTGAGAGAGATGGG + Intergenic
1135009171 16:18858305-18858327 TGTTTTATGTTGAGTAATTTTGG - Intronic
1135068156 16:19329073-19329095 TTTTTTTTTTTTAGAAATAATGG - Intergenic
1135253521 16:20921698-20921720 TTTTTTTTTTTAAGAAATTTGGG - Intronic
1135431034 16:22383581-22383603 TTTTTTTTTTTTAGAAATAGGGG + Intronic
1135505953 16:23036476-23036498 TTTTTTTTTTTGAGATATTTCGG + Intergenic
1135843687 16:25898955-25898977 CGTCTTATTTTGAGAAATACTGG + Intronic
1135919827 16:26639741-26639763 TTTTTTTTTTTAAAAAATATGGG - Intergenic
1136219414 16:28818775-28818797 TTTTTTCTTTTGGTAAAGATGGG - Intergenic
1137481896 16:48858848-48858870 TAGTTTATTTTGAGAAATTTGGG - Intergenic
1138167625 16:54817886-54817908 TCTTTTCATTTTAGACATATGGG + Intergenic
1138387386 16:56644893-56644915 TGTTTTCTTAAATGAAATATGGG + Intronic
1138823838 16:60294201-60294223 TGTATACTTTTGAGAAAATTGGG + Intergenic
1138972518 16:62162802-62162824 TTTTCTCTTTTGAGAAGTTTCGG + Intergenic
1138996614 16:62461844-62461866 TGTGTTATTTTGAGAAATCCTGG + Intergenic
1140345308 16:74207509-74207531 TGTTTTTTTTTGGTAAATATGGG - Intergenic
1140411404 16:74743019-74743041 TATTTTCTTTTTATAGATATAGG + Intronic
1140970295 16:80006106-80006128 TGTTCTCTTTTGAGAGGCATTGG - Intergenic
1141130565 16:81433567-81433589 TTTTTTATTTTGAGAGACATGGG + Intergenic
1142526565 17:546257-546279 TGGTTTCTTCTAAGAAATTTAGG - Intronic
1143064605 17:4236081-4236103 TGTTTTCTATTGATAAATTCTGG + Intronic
1143418005 17:6764155-6764177 TTTCTTCTTTTGAGGAAAATGGG + Intronic
1143746753 17:9000617-9000639 TTTTTTCTTTTAAGAAAGAAAGG + Intergenic
1143935544 17:10480805-10480827 TGTCTTCTTTTAAGAAATTTAGG + Intergenic
1144158978 17:12538499-12538521 TGTTTATTTTTAAGAAATAGTGG + Intergenic
1146382675 17:32342372-32342394 TATTTTCCTTTGAGACATCTGGG + Intronic
1147604281 17:41765204-41765226 TTTTTTCTTTTTATAAAGATGGG + Intronic
1148476995 17:47935255-47935277 TAGTTTCCTTTGAGAAATCTTGG - Intergenic
1148658048 17:49303152-49303174 TTTTTTCTTTTAATAAATTTGGG - Intronic
1149134896 17:53352793-53352815 TGTTTTATTTTTAGCCATATGGG - Intergenic
1149144387 17:53472496-53472518 TCTTTTAATATGAGAAATATTGG + Intergenic
1149187909 17:54023145-54023167 TGTTTTCATATAAGAAATAAGGG + Intergenic
1149374095 17:56026528-56026550 TGTTTTCTCTAAAGAAAAATGGG + Intergenic
1149742080 17:59056211-59056233 TTTTTTCTTTTTAAAAAGATGGG + Intronic
1149753845 17:59171646-59171668 TGGTTTATTTTGAAAAAGATGGG - Intronic
1149964097 17:61144399-61144421 TGTTTTCTTATGCTATATATAGG + Intronic
1150173736 17:63027630-63027652 TCTGTTTTTTTGAGATATATGGG + Intronic
1150174941 17:63044123-63044145 TGTTTTATTTGGAGAACTAATGG - Intronic
1150198376 17:63325701-63325723 TGTTTTCTATTAGGAAATCTTGG + Intronic
1150725465 17:67648121-67648143 TGTATTATTTTGGGAAATTTAGG - Intronic
1150886041 17:69087113-69087135 ATTTTTCTTTTGAGAAAAGTGGG - Intronic
1150933249 17:69608320-69608342 TTTTTTTTTTTGAGACATATTGG + Intergenic
1151043327 17:70890056-70890078 TTTTATTTTTTGAGAAAAATGGG + Intergenic
1151521173 17:74630961-74630983 TTTCTTCTTTTGAGAATTGTAGG - Intergenic
1152761561 17:82110425-82110447 TGTTTGTTTTTGAGGAACATGGG - Intronic
1153354057 18:4116204-4116226 TGTCTTCTTATTAGAAATATTGG - Intronic
1153393124 18:4585935-4585957 TATTTTCTTGTAAGTAATATGGG - Intergenic
1153428997 18:4994542-4994564 TGTTTTCTCATATGAAATATTGG + Intergenic
1153774867 18:8443533-8443555 TGTTAACTTTTGAGGAATCTGGG - Intergenic
1153775137 18:8446418-8446440 TGTCTTCTTTTGAAAAGTGTCGG - Intergenic
1153918858 18:9770861-9770883 TTTTTTTTTTTGAGAAATTTAGG + Intronic
1154007466 18:10545003-10545025 TGTTATCTTTTTAAAAATAGTGG - Intronic
1154100849 18:11472160-11472182 TGTTTTTTTTTGATAAGTTTTGG - Intergenic
1155037634 18:22038609-22038631 TTTTTTTTTTTTTGAAATATGGG - Intergenic
1155508943 18:26558151-26558173 TGTCTTCTTTTGAGAAATGTAGG - Intronic
1155737717 18:29244630-29244652 AATTTTCTTTTGATATATATTGG + Intergenic
1155931534 18:31713896-31713918 TGTTTTCTTTTGAAAATAATAGG - Intergenic
1156179615 18:34587449-34587471 TATTTTATATTGAGAAATAATGG - Intronic
1156252292 18:35362302-35362324 TTTTTTCTTTTTAAAAAGATGGG + Intergenic
1156288139 18:35720115-35720137 TGTTTTGTTTTTAGACATAATGG + Intergenic
1156768555 18:40689669-40689691 TGTTTGCTTTTGAGAAGAAGAGG - Intergenic
1156817045 18:41324152-41324174 TGTTTAATTTGGAGAAGTATTGG - Intergenic
1156875357 18:42003977-42003999 TATTTTCTGTTGTAAAATATAGG + Intronic
1156932246 18:42659973-42659995 TTTTTTTTTTTGAGATAGATAGG + Intergenic
1158275275 18:55760168-55760190 TGTTTTTTTCTGAAAAACATGGG + Intergenic
1158601109 18:58856569-58856591 TCTTTTTTTTTTTGAAATATTGG + Intergenic
1158604925 18:58887326-58887348 TGTTTTCTGAAGAGAAACATGGG + Intronic
1159025183 18:63177194-63177216 TTTTTACTTTTGAAAAATGTTGG - Intronic
1159102873 18:63974670-63974692 TAATTGCTTTTTAGAAATATTGG + Intronic
1159483477 18:69022382-69022404 TTTTTTCTTTTGAATAATGTTGG + Intronic
1159808645 18:72988494-72988516 TATTGTCATTTTAGAAATATGGG + Intergenic
1160117002 18:76088439-76088461 TGTTAACCTTTGAGAAATCTGGG + Intergenic
1160560030 18:79750392-79750414 TATTTTCTACTGAGAAATAAAGG - Intronic
1161841490 19:6684091-6684113 TTTTTTCTTTTTAGAGAGATAGG - Intronic
1162128892 19:8513462-8513484 TTTTTTCTTTTTATAAAGATGGG + Intronic
1162658638 19:12152319-12152341 TGTTTTCTTTTGAAATTTAAAGG - Intronic
1163054382 19:14707230-14707252 TTTTTTTTTTTTAGAAATAGGGG - Intronic
1163072793 19:14858624-14858646 TGTTTTCTTTGGTGAATTCTGGG - Intergenic
1163226488 19:15964941-15964963 AGTTTTCTTTTAAGAACTAGTGG - Intergenic
1163735408 19:18977271-18977293 TTTTTTTTTTTGAGAGAGATAGG + Intergenic
1163834607 19:19565511-19565533 TGTTTTCATTTGATAAGTTTGGG - Intronic
1164606750 19:29605096-29605118 GGTTTTAGTTTGAGAAACATTGG - Exonic
1164633107 19:29774446-29774468 TTTTTTTTTGTGAGAAATAAGGG - Intergenic
1165436629 19:35798872-35798894 TTTTTTTTTTTGAGAGATAATGG + Intergenic
1166041653 19:40206391-40206413 TTTTTTTTTTTGGTAAATATGGG - Intronic
1166099389 19:40562227-40562249 TGTGTACATTTGAGAAAAATAGG + Intronic
1166549405 19:43655311-43655333 TGTTTGCTTTTCTGAAAAATGGG - Intronic
1166598218 19:44070620-44070642 TGCTTTCTTTTAAGTAATAATGG + Intergenic
1166672988 19:44722648-44722670 TGTTTTCTCGTGTGAAATGTGGG - Intergenic
1167392513 19:49205237-49205259 TGTTTTCTTCTGAGGGATGTCGG + Intronic
925524971 2:4789250-4789272 ATTTTTCTTTTGAAAAATACAGG - Intergenic
925898214 2:8489293-8489315 TGTTTTCTCTTCTGAAAAATGGG - Intergenic
925989626 2:9243949-9243971 AGTTTTCTTTTGGGAATTAGTGG + Intronic
926110061 2:10176631-10176653 TGGTTTCTTTTGCTTAATATTGG + Intronic
927820515 2:26259951-26259973 TGTTCTATTTTGAGAAGTAGTGG + Intronic
928236895 2:29550453-29550475 TCATTTCCTTTGAGAAATAATGG + Intronic
928524615 2:32127045-32127067 AGTTTTCTGTTGAGATATTTGGG + Intronic
928524618 2:32127166-32127188 TGTTTTGTTTTGAGTGATCTGGG + Intronic
929041551 2:37749537-37749559 TCTTTTCTTTTGACAAATTGGGG + Intergenic
929516762 2:42610327-42610349 TGTTTTCTTTTGAGGATCACTGG + Intronic
930146409 2:48010392-48010414 TCTATTATTTTGAAAAATATAGG + Intergenic
930610438 2:53537029-53537051 TTTCTTCTTTTGCCAAATATAGG - Intronic
930773262 2:55149083-55149105 TGTTCTCCTTTGAGGAATACGGG + Intergenic
930975517 2:57454718-57454740 TATTTTCATTTGAAAAAAATGGG + Intergenic
931082355 2:58788683-58788705 TCTTTTACTTAGAGAAATATAGG + Intergenic
931394978 2:61879576-61879598 TGTGATATTTTGAGAAGTATCGG - Intronic
931492052 2:62758644-62758666 TGTTATCTTATTAGAAATTTAGG + Intronic
931492675 2:62766410-62766432 TGTTTCTCTTTGAGAAACATGGG + Intronic
931545772 2:63384893-63384915 TGTTTGTTTATGGGAAATATTGG - Intronic
931551681 2:63453292-63453314 TGTCTTCTTTTGAGAAGTGTCGG - Intronic
931666585 2:64613555-64613577 AGTTTTCTCTTGTGAAAAATGGG - Intergenic
931923675 2:67047814-67047836 TGTTGGCTCTTGTGAAATATAGG - Intergenic
932136462 2:69234834-69234856 TGTTTTCTTTTCTGTAAAATGGG - Intronic
932979511 2:76647346-76647368 TATTTTCTTTTAAGAATTGTAGG - Intergenic
933051106 2:77603834-77603856 TATTTTCTTATCAGAAATAAAGG - Intergenic
933158504 2:78999622-78999644 TGTTTACTTCTGAGAAATGCAGG + Intergenic
933283002 2:80353382-80353404 TGTCTTCTGTTGTCAAATATCGG + Intronic
933455124 2:82509787-82509809 AGTTTTCTGATGTGAAATATCGG - Intergenic
933578311 2:84095127-84095149 TGTTTTATTTTTTGAACTATTGG - Intergenic
934084119 2:88495419-88495441 TCTATTCTTATGATAAATATAGG + Intergenic
934586265 2:95499527-95499549 TGTTATCTTCAGGGAAATATTGG + Intergenic
934593159 2:95576964-95576986 TGTTTTCTTTGTATAAATGTGGG + Intergenic
934733364 2:96673363-96673385 TTTTTTCATGTGTGAAATATAGG - Intergenic
935019830 2:99219319-99219341 TGTTTTGTTTTCAGATATTTAGG + Intronic
935457165 2:103283224-103283246 CGTGTGCTTTAGAGAAATATTGG - Intergenic
935460708 2:103330055-103330077 TCTATGCTTTTGAGAAATATTGG + Intergenic
935674562 2:105583329-105583351 TGTTTTCTTTAGAAACATATTGG - Intergenic
935742524 2:106162526-106162548 TTTTTTCTTTTTAGAAAAATTGG - Intronic
935896541 2:107744195-107744217 CTTTTTGTTTTGAAAAATATAGG + Intergenic
936746047 2:115577787-115577809 AGTTCTCATATGAGAAATATTGG - Intronic
936747970 2:115603190-115603212 TGTGTTCTTTGGAGAAAAAAAGG + Intronic
936757124 2:115728278-115728300 TTTTTTTTTTTTAGAAATAAAGG - Intronic
937196298 2:120159913-120159935 TGTGTCCTTTGCAGAAATATGGG + Intronic
937458719 2:122067074-122067096 TATTTTCTTTTAAGTACTATTGG + Intergenic
938277478 2:130038676-130038698 TGATGTCCTTTGAGAAATAAGGG + Intergenic
938375050 2:130799415-130799437 GGTCTTCTTTTGGGAGATATGGG - Intergenic
938429029 2:131216212-131216234 TTTTTTCAGTTGACAAATATAGG - Intronic
938437905 2:131298704-131298726 TGATGTCCTTTGAGAAATAAGGG - Intronic
938469931 2:131550290-131550312 TTTTTTCAATTGATAAATATAGG - Intergenic
938749612 2:134316047-134316069 TGCTTTCTTTAGAAAACTATCGG + Intronic
938848836 2:135239465-135239487 TGTTTTAATTTTACAAATATGGG - Intronic
939123073 2:138141666-138141688 TGTCTTCTTTTGAGAAGTGTTGG + Intergenic
939123807 2:138150964-138150986 TGTTTTCTTTTGAGTGGTAAGGG - Intergenic
939151979 2:138483952-138483974 TGTCTTCTTTTGAGAAGTGTTGG - Intergenic
939157191 2:138539542-138539564 TGTCTTCTTTTGAGAACTGTTGG + Intronic
939235796 2:139490630-139490652 TGTTTTTTTTTTAAAAAAATAGG - Intergenic
939501895 2:142997225-142997247 TGTTTTGTTTAGAGAACAATTGG - Intronic
939988754 2:148857731-148857753 TATCTTCTTTTGAGAAGTGTTGG - Intergenic
940340787 2:152578596-152578618 TTTTTTTTTTTGAGAGATGTGGG + Intronic
940470916 2:154099210-154099232 TGTCTTACTTTGAGAAATGTTGG + Intronic
940506537 2:154561426-154561448 TGGTATATTTTGAGAAATATGGG + Intergenic
940690431 2:156912158-156912180 TGCTTTATTCTGAGAATTATGGG - Intergenic
941115405 2:161466544-161466566 TGGTTTCTGATGAGAAATTTGGG + Intronic
941168984 2:162115074-162115096 TGAGTTATTTTGAAAAATATCGG - Intergenic
941284754 2:163596357-163596379 TGTTTTCATTTTAGAAATGATGG - Intronic
941400822 2:165028659-165028681 TGTTTTCATTTGTGAAATGGGGG + Intergenic
942041043 2:172063093-172063115 TGTTTACTCTTGACAAATAATGG + Intronic
942478536 2:176356468-176356490 TGTTTTCTCATCAGAAATAATGG - Intergenic
942543265 2:177036584-177036606 AGTTCTCATTTAAGAAATATGGG + Intergenic
943195202 2:184737801-184737823 ATTTTTCTTTTGAGAAATATAGG - Intronic
943883924 2:193186275-193186297 TGTTTTAGTATTAGAAATATGGG - Intergenic
943948044 2:194092693-194092715 TATTTTCTTTTCAGGATTATGGG - Intergenic
944015223 2:195027790-195027812 TGTTTTCTACTTAGAACTATAGG + Intergenic
944345704 2:198662921-198662943 TTTTTTTTTTTGAGAAATCTTGG + Intergenic
944878572 2:203987780-203987802 TATCTTCTTTTGAGAATTGTGGG + Intergenic
945138690 2:206659473-206659495 TTTTTTTTTTTGAGAATTGTTGG - Intronic
945559853 2:211326318-211326340 TATTTTCTTTTAAAAAATAATGG - Intergenic
945730869 2:213532008-213532030 TGTTTGCTTTTAAAAAATACTGG + Intronic
946724204 2:222645826-222645848 TGTTTTTTTATGAGAAAAACTGG + Intronic
946866008 2:224041428-224041450 TGTTTTTTCTTGAAAAACATTGG - Intergenic
946963771 2:225014099-225014121 TTTTTTTTTTTAAGAAATACAGG + Intronic
947230716 2:227883288-227883310 AGTTTTCTTATGATAAAAATTGG + Intronic
947442080 2:230132204-230132226 AGTTTTCTTTTCTGAAAAATGGG + Intergenic
947631573 2:231656863-231656885 TTTTTTTCTTTGAGAAATGTTGG - Intergenic
947702319 2:232244730-232244752 GGTTTTCTGCTGAGAAAGATTGG + Intronic
947885401 2:233565786-233565808 TGTTTTCTTATGTGTAAAATAGG + Intronic
947940356 2:234049047-234049069 TGTTTTCTTTTGAGAAGTGTCGG - Intergenic
948153349 2:235762565-235762587 TGTTTTCCTAAGAGAAAAATAGG + Intronic
948181474 2:235984482-235984504 TTTTTTTTTTTAAGAAATAAAGG - Intronic
948267913 2:236650600-236650622 TTTTTGCTTATGAGAAGTATTGG + Intergenic
1168811480 20:707509-707531 TGTCTTGTATTGAGAAAAATAGG - Intergenic
1168924634 20:1569220-1569242 TGTTTTCCTTTGAAAGATCTGGG - Intronic
1169144369 20:3242777-3242799 TTTTTTTTTTTGAGAGAAATGGG + Intergenic
1169978413 20:11356468-11356490 TGTTTCCTTTGGAGAAATATAGG - Intergenic
1170177730 20:13491169-13491191 TGTTTTGTTTTGATAATGATAGG - Intronic
1170401558 20:15990437-15990459 TGTTTTATTATGATATATATTGG + Intronic
1170877250 20:20262005-20262027 TATTTACTTTTGAAAAGTATAGG - Intronic
1171368435 20:24643913-24643935 GTTTTTCTATTGAGAAATCTGGG - Intronic
1171566849 20:26202490-26202512 TCTTTTCTTTTTTGAAATAATGG - Intergenic
1171756060 20:29110891-29110913 TGTCTTCTTTTGAGAAGTGTCGG - Intergenic
1172455106 20:35065036-35065058 TGATCTCTTTTGAGAAGAATTGG - Intronic
1172533315 20:35650415-35650437 TATTTTCATTTTAGAAAAATGGG - Exonic
1172870647 20:38133501-38133523 AGTGTTCTTTTCAGAAACATGGG - Intronic
1172987246 20:39001716-39001738 TTTTTTCTTTTTAGAAATTCCGG + Exonic
1173043168 20:39484515-39484537 TGTCTTCTTTTGAGAAGTGTCGG + Intergenic
1173536927 20:43822486-43822508 TTTTTTTGTTTGGGAAATATTGG - Intergenic
1174240358 20:49129145-49129167 TATTTTCTTTGATGAAATATAGG - Intronic
1174277782 20:49416318-49416340 TGTTTTGTTTTTAGAAATGGGGG - Intronic
1174720470 20:52806455-52806477 TGTTTTCTGTTTAAAAAAATAGG + Intergenic
1174926961 20:54770877-54770899 GGTTTTTTTTAGAGAAATATTGG - Intergenic
1175529423 20:59664238-59664260 TTTTTAATTTTGAGAGATATTGG + Intronic
1175584821 20:60130735-60130757 TTTTTTTTTTTGAGAATTTTAGG - Intergenic
1176587762 21:8605552-8605574 TGTATTGTTTTGTTAAATATAGG - Intergenic
1176879332 21:14172065-14172087 TGTCTTCTTTTGAGAAGTGTTGG - Intronic
1177066743 21:16446713-16446735 TGTTTTTCATTGACAAATATTGG - Intergenic
1177290277 21:19102750-19102772 TTTGTTATTTTGAGAAATATTGG - Intergenic
1177377470 21:20292027-20292049 TATTTTCTTTTGAGAATACTTGG - Intergenic
1177466548 21:21489951-21489973 TGTTTTCCTTAGATAAAAATTGG - Intronic
1177885613 21:26742104-26742126 TATTTTCATTAGAGAAATTTTGG - Intergenic
1178198346 21:30374540-30374562 TCTTTTCTCTTTAGAAATTTAGG + Intronic
1178284148 21:31310974-31310996 TATTTTCTCTTAAGAAAAATTGG - Intronic
1178363793 21:31971613-31971635 ATTTTTCTTTTGAGAAAGTTAGG + Intronic
1179072239 21:38082610-38082632 TGTTTTCATTTGGGACACATGGG - Intronic
1179092701 21:38282058-38282080 TATCTTCTTTTGAGAAGTGTCGG + Intronic
1179707383 21:43189679-43189701 TTTTTTTTTTTGAGATAGATAGG - Intergenic
1180000776 21:44994424-44994446 TGTCCTCTATTTAGAAATATTGG - Intergenic
1180270592 22:10582551-10582573 TGTATTGTTTTGTTAAATATAGG - Intergenic
1181296358 22:21842821-21842843 TTTTTTCTTTAGAGAAAATTTGG - Intronic
1182027853 22:27134494-27134516 TGTTTTCAGTTGAGAAATAAGGG + Intergenic
1182480067 22:30602553-30602575 TCTTTTCTTTTGATAAAGATAGG + Intronic
1182591323 22:31382601-31382623 TGTCTTCTTTTGAAAATTGTCGG + Intergenic
1182969456 22:34559283-34559305 TGTCTTCTTTTGAGAAGTGTCGG + Intergenic
1183830002 22:40413283-40413305 TGTTGTTTTTTGATAAAGATGGG - Intronic
1184135244 22:42545058-42545080 TTTTTTTTTTTGACAAATATAGG + Intergenic
949169112 3:977453-977475 AGGTTTCTTTTTAAAAATATTGG + Intergenic
949199473 3:1357204-1357226 TGTTTAATTTTGATAAAAATAGG + Intronic
949210644 3:1495905-1495927 TGTTTTCTATTAAAACATATTGG - Intergenic
949403150 3:3686346-3686368 TGTTCTCTTTTGATAAAAACAGG + Intergenic
949793423 3:7818857-7818879 TTTTTTAATTTGAGAAATGTTGG + Intergenic
949799709 3:7890299-7890321 AGTTTTCTTTTCTGTAATATGGG - Intergenic
950182441 3:10925336-10925358 TGTTTTCTTAGCTGAAATATGGG - Intronic
950668321 3:14510564-14510586 TCTTTTCTTTTAAGAAAAGTTGG - Intronic
950842830 3:15983922-15983944 TGTCCTCTTTTGAGAAGTGTTGG + Intergenic
950993987 3:17474366-17474388 TGTTTTCCTTTGGGCAAAATGGG + Intronic
950995020 3:17486134-17486156 TGTCTTCTTTTGAGAAGTGTCGG + Intronic
951012669 3:17698742-17698764 TGTCTTCTTTTGAGAAGTGTCGG - Intronic
951150928 3:19289022-19289044 TGTCTTCTTTTGAGAAGTGTGGG + Intronic
951340114 3:21475437-21475459 ATTTTTGTTTTGAGAAATTTTGG + Intronic
951415330 3:22416239-22416261 TTTATTTTATTGAGAAATATTGG - Intergenic
951672168 3:25196862-25196884 TGTCTTCTTTTGAGAAGTGTTGG + Intronic
952591292 3:34957649-34957671 TAATTTCTTTTGACAAATTTAGG - Intergenic
952931935 3:38367250-38367272 TGTTTTCTTTGGAAATGTATAGG + Intronic
953113561 3:39968223-39968245 TTTTTTTTTTTGAGATATAGTGG + Intronic
953152619 3:40338833-40338855 TGATTTCTTTAGCGAAATCTGGG + Intergenic
953174168 3:40534250-40534272 TTTTTTTTTTTAAGAAATAAAGG + Exonic
953483025 3:43268691-43268713 AGTTTACTTTTGGGAAATATGGG + Intergenic
953491224 3:43353626-43353648 TGTATTCGTGTGAGAAGTATTGG + Intronic
953892047 3:46758291-46758313 TGTTTTTGTTTCAGAAAGATGGG - Intronic
954494082 3:50936386-50936408 TTTTTTTTTTTAAGAAATAATGG + Intronic
954824806 3:53363297-53363319 TGTTTTATTTAGGGAAAAATGGG + Intergenic
955567909 3:60269418-60269440 GCTGTTCTTTTGAGAAATCTTGG + Intronic
955592919 3:60557165-60557187 TGTTTTCTTTTGTAAAATTAGGG - Intronic
955597652 3:60609148-60609170 TATTTTCTTTTGAGACAGTTTGG - Intronic
955683599 3:61527877-61527899 TGTTTTCTTCTGAGACAAACTGG - Intergenic
956014140 3:64863308-64863330 TGTTTAAGTTTGAGAATTATTGG - Intergenic
956520028 3:70093969-70093991 TGTTTTATTTTGTGATATATGGG + Intergenic
956975770 3:74576740-74576762 TTTTTTCTATTTAGAAATGTAGG + Intergenic
957111228 3:75960956-75960978 TCTTTTCTTTTTTGAAATAATGG + Intronic
957152780 3:76507693-76507715 TTTCTCCTTTTGTGAAATATGGG - Intronic
957411360 3:79845622-79845644 TATCATCTTTTGAGAAATATCGG - Intergenic
957614368 3:82508605-82508627 TGACTTCTTTTGAAAAGTATTGG + Intergenic
957744845 3:84326748-84326770 TGTGTTCTTTTGATAAATTGAGG + Intergenic
957769107 3:84665343-84665365 TGTTTAGTTTTCAAAAATATAGG - Intergenic
958137957 3:89520622-89520644 TATTTTATTTTGATAAAGATGGG - Intergenic
958143796 3:89598162-89598184 TTTTTTCCTCTGAGAAAGATTGG - Intergenic
958451826 3:94282524-94282546 CTTTTTCCTTTGAGGAATATTGG + Intergenic
958513458 3:95080345-95080367 TGTTTTGTTTGGCAAAATATGGG - Intergenic
958539180 3:95448117-95448139 TCTTGTCATTTGAGATATATAGG - Intergenic
958844023 3:99243755-99243777 TGTTTTCATTTGAGACCTACAGG - Intergenic
958848083 3:99289389-99289411 TGTCTTCTTTTGAGAAGTATCGG + Intergenic
958877350 3:99631457-99631479 TGTTTTGTTTTGAGCCAAATGGG + Intergenic
958917219 3:100062981-100063003 TGTTTCCTTTTGACACATAAAGG + Intronic
959206694 3:103316916-103316938 TGTTTTATTTCAAGGAATATTGG + Intergenic
959283983 3:104383413-104383435 TACTTTCTTTTGAAAATTATCGG - Intergenic
959318410 3:104839596-104839618 TGTTTGCATTTAAGCAATATTGG + Intergenic
960070054 3:113419297-113419319 TTTTTTCTTTTTACAAATATAGG + Intronic
960245696 3:115398130-115398152 TGTTTTGCTCTCAGAAATATTGG + Intergenic
960722383 3:120637715-120637737 TGTTTCCTTTTGGGGAATACTGG - Intronic
960819913 3:121718493-121718515 TGTTTTCTTCTCAGAAATTGAGG - Exonic
961223195 3:125216228-125216250 TGTATTTTTATGAGAAATGTTGG - Intergenic
962100679 3:132339265-132339287 TGTTTTCAAGTGAGAAAAATAGG - Intronic
962118360 3:132535794-132535816 TGTGTTCTTCAGAGAAAGATGGG - Intronic
962410357 3:135136005-135136027 TGCTTTCTTATTAGAAAAATAGG - Intronic
962443658 3:135446342-135446364 AGTTTTTTTTTGGGTAATATTGG - Intergenic
962452408 3:135531319-135531341 TGATGTCTGTTGAGAAATACAGG - Intergenic
962691589 3:137904417-137904439 TGTGTTCTTTTGAAAAGTGTTGG - Intergenic
962881685 3:139583556-139583578 TCACTTCATTTGAGAAATATAGG + Intronic
962881689 3:139583701-139583723 TCACTTCATTTGAGAAATATAGG + Intronic
963149014 3:142024448-142024470 TTTTCTCTTCAGAGAAATATAGG + Intronic
963323065 3:143830430-143830452 TGTTTGCTTTTGAAAAATTAGGG - Intronic
963415181 3:144985527-144985549 AGTACTCTTTTGTGAAATATTGG + Intergenic
963725413 3:148914692-148914714 TGTTATCTTTTTAAAAATCTGGG - Intergenic
964018184 3:151973698-151973720 TATTTTCTTTAAAGCAATATTGG + Intergenic
964436535 3:156659213-156659235 TGTTTTCTTTGGAGAATTGTTGG - Intergenic
964440632 3:156705119-156705141 TGTTTCCATTTGAAAAATCTTGG + Exonic
964739585 3:159951438-159951460 TGTTTGCTGTTGAGAAAAGTAGG + Intergenic
964774200 3:160257179-160257201 TCTTTTCTTTTCCGGAATATTGG - Exonic
964837612 3:160956706-160956728 TGTTTACTTTTCTGAAATAATGG + Intronic
965076985 3:163991424-163991446 GCTCTTCTTTTGAGAAGTATAGG + Intergenic
965193755 3:165566740-165566762 TATCTTCTTTTGAGAAATATCGG - Intergenic
965200460 3:165650181-165650203 AGATTTTCTTTGAGAAATATTGG + Intergenic
965513931 3:169600383-169600405 TGTTTTCTTGAGAAAACTATGGG - Intronic
965610747 3:170541424-170541446 TTTTTTCTTTTGATAGAGATGGG - Intronic
965908193 3:173736886-173736908 TGTTTAATTATGAGCAATATTGG + Intronic
965921189 3:173916063-173916085 TTTTTACATTTGTGAAATATAGG + Intronic
966063845 3:175792910-175792932 TTTTTTCTTTTGAAAAGTATGGG - Intronic
966526893 3:180929512-180929534 GGCTTTGTTCTGAGAAATATGGG + Intronic
966728056 3:183125966-183125988 TTTTTTCGTTTAAGAAATATAGG - Intronic
966739871 3:183222633-183222655 TGTTTTTTATTAAGAAATAGTGG + Intronic
967216446 3:187214619-187214641 ATTTTTGTTTTGAGAAGTATTGG + Intergenic
967280505 3:187818047-187818069 TGTCTTCTTTTGAGAAGTTACGG + Intergenic
967548173 3:190757488-190757510 TGTCTTCTTTTGAAAAGTATCGG - Intergenic
968197824 3:196723672-196723694 TGATTTCTGTTAAGAAATTTTGG + Intronic
968249521 3:197194581-197194603 TATTTTCTTTACAGAAATACAGG - Exonic
969138029 4:5046686-5046708 TGTCTTCTTTTGAGAAGTGTCGG - Intergenic
970021063 4:11568901-11568923 TATTTTATTTTGAGAGATTTTGG + Intergenic
970127064 4:12826355-12826377 TATTATTTTTTGAGAAATCTGGG - Intergenic
970214062 4:13740206-13740228 TGTCTTCTTTTGAGAAGTGTTGG + Intergenic
970221828 4:13819621-13819643 TTTTTTCTTCTGAGCAATATTGG + Intergenic
970516180 4:16832988-16833010 TGTTTCCTTATGAGTAAAATAGG - Intronic
970698044 4:18700698-18700720 CTTCTTCTTTTGAGAAATAAAGG + Intergenic
970712378 4:18878259-18878281 GTTTTTCTTTTGAGAAAGAGGGG - Intergenic
971008702 4:22405536-22405558 TTTTTTTTTTTTAGAAATAGGGG - Intronic
971110154 4:23575989-23576011 TGTTTTCTTGTAAGAATTGTGGG + Intergenic
971229141 4:24784444-24784466 TATCTTCTTTTGTGAAACATTGG + Intergenic
971333114 4:25698797-25698819 TGTTTTCTTTTGGTAGATGTAGG - Intergenic
971930249 4:33071972-33071994 TGTGTTCTTATCAGAAATACTGG + Intergenic
972255983 4:37355903-37355925 TTTTTTTTTTTAAGAAATGTAGG + Intronic
972427470 4:38947358-38947380 TGTTTTCATGTTAGAAATAAAGG + Intergenic
972707999 4:41564527-41564549 TTTTTTCTGTATAGAAATATCGG - Intronic
972848455 4:43018665-43018687 TTCTTTCATTTGAGAAAAATGGG + Intronic
972929619 4:44055620-44055642 TGCTTTTTTTTAAGGAATATAGG + Intergenic
973023616 4:45236643-45236665 TGTTTTCTTGTTATAAAGATGGG + Intergenic
973067012 4:45807817-45807839 TGTCTTCTTTTGAGAAGTGTCGG - Intergenic
973886976 4:55332550-55332572 TCTTTGCTTATGAGGAATATTGG - Intergenic
973897420 4:55427987-55428009 TGTTATTTTTTGAGAAATGCAGG + Exonic
973940577 4:55905972-55905994 TGTTTTTTTTTGAGAGAGACAGG + Intergenic
974262920 4:59547652-59547674 TTATTACTTTTGAAAAATATTGG - Intergenic
974264147 4:59562184-59562206 TATTTTCTTTTTTTAAATATTGG + Intergenic
974311377 4:60214652-60214674 TGTTTTGTTTTTGGAAAGATGGG + Intergenic
974522588 4:63003512-63003534 GGTTTTCTTTTAAAAAAAATTGG - Intergenic
974805898 4:66880540-66880562 TCTTTTCTTGTGAAAAATTTAGG - Intergenic
974930667 4:68357849-68357871 TGCTTACTTTTGAGTAATATCGG + Intergenic
975037500 4:69702457-69702479 TGTTATTTTTTTAGAAGTATAGG - Intergenic
975195997 4:71524335-71524357 TGTGTTCTTTTGAGACAGAATGG + Intronic
975337215 4:73192707-73192729 TGTATTGTCTTGAGATATATAGG + Intronic
975368775 4:73559390-73559412 TGTTCTCTTATGAGAGATACAGG - Intergenic
975445521 4:74459828-74459850 TGTCTTCTTTGGAGAAATATCGG + Intergenic
975486417 4:74938183-74938205 TGTTTTCATGAGAAAAATATTGG + Intronic
976456144 4:85248887-85248909 ATTTTTCTTTAGAGAAAGATTGG - Intergenic
976892602 4:90068425-90068447 TGTCTTCTTTTGAAAAGTGTCGG + Intergenic
977014261 4:91672684-91672706 TGTTCTCTTTTTAAAAAGATTGG + Intergenic
977129094 4:93211459-93211481 TGTTTTATTTTGCAAAATAGTGG - Intronic
977347190 4:95831030-95831052 TGTCTTCTTTTGAGAAGTTTAGG - Intergenic
977374268 4:96181212-96181234 TGTCTTCTTTTGAGAAGTGTTGG + Intergenic
977508535 4:97933160-97933182 TGTCTTCTTTTGAGAATTCTCGG + Intronic
977592297 4:98840829-98840851 GGTCTTTTTTTGAGAAATACAGG + Intergenic
977605253 4:98977783-98977805 TGTGTTGTAATGAGAAATATTGG + Intergenic
977709481 4:100108247-100108269 TGTTTTCTTTATAGAAACGTAGG + Intergenic
977816886 4:101425240-101425262 TTCTTTCTTTTGATAAATTTGGG + Intronic
977910321 4:102526811-102526833 TATTTTATTTTGAAAAATGTTGG + Intronic
977959028 4:103063883-103063905 TGTCTTCTTTTGAAAAATTCAGG - Intronic
978007531 4:103636038-103636060 TGTTTATTTTTGAGAAATTCTGG - Intronic
978118636 4:105051241-105051263 TGTCTTTTTTTCAGAAATATGGG - Intergenic
978151180 4:105437138-105437160 TTTCTTTTTTTGAGAAATGTTGG - Intronic
978356169 4:107877125-107877147 TTTTTTTTTTTTAGAAATATGGG - Intronic
978482344 4:109207580-109207602 TGTTTTCTTGTTAAAAACATTGG - Intronic
978508803 4:109492889-109492911 TTTTTTCTTTTCATAAAGATGGG + Intronic
978719315 4:111888528-111888550 AGTTTTCTTATGAGAATTACAGG - Intergenic
978751379 4:112251701-112251723 TGTATTTGTTTGAGAAATAAAGG + Intronic
978942293 4:114450866-114450888 TGTATGGTTTTGAGAAATCTTGG - Intergenic
978965857 4:114740620-114740642 TGGTTTCTTCTGAGCACTATTGG + Intergenic
979420971 4:120504723-120504745 TTTTTTCATTTGATAAATTTGGG + Intergenic
979571326 4:122229293-122229315 TGTTTTATTTCAAGAAATAGAGG - Intronic
979878383 4:125923116-125923138 TGTCTTCTTTTGAAAAGTGTTGG + Intergenic
980183761 4:129435164-129435186 TGTCTTCTTTTGAGAAGTGTCGG + Intergenic
980239174 4:130151036-130151058 TGTTTTTTTTTTCCAAATATAGG - Intergenic
980312789 4:131155410-131155432 TGTTTGTTTATGAGGAATATTGG - Intergenic
980381627 4:132027748-132027770 TGTTTTCTTTTGTAAAATGCTGG - Intergenic
980390643 4:132141435-132141457 TTTTTTATTTTGATAAATTTTGG + Intergenic
980763512 4:137267786-137267808 TGATTTCATTTGTGCAATATTGG + Intergenic
981029881 4:140113610-140113632 TGTTTTATGTTGAAAGATATTGG - Intronic
981145162 4:141315466-141315488 TGTTGTATTTTGAGAAACATTGG + Intergenic
981577656 4:146222120-146222142 TTTTTTCTTTTTATAAATATTGG - Intergenic
981600146 4:146478893-146478915 TGTTTTCTTGGGAAAAATGTTGG - Intronic
981848088 4:149193400-149193422 TGTTTTCTTTTATGTAAAATGGG + Intergenic
982355835 4:154466797-154466819 TGTTTTAGTTCAAGAAATATAGG + Intronic
982446309 4:155494893-155494915 AGTGATCTTTTGAGAAATTTTGG + Intergenic
982547849 4:156758188-156758210 TGTTTTCTTTGGAGCACTGTTGG - Intergenic
983018748 4:162648077-162648099 TGTCTTTTTTTAAGAAATACTGG + Intergenic
983104123 4:163664467-163664489 TGTTTTCTTTGAAGAAATGGAGG + Intronic
983814824 4:172110816-172110838 TGTTTTCTTTTAGGAGTTATGGG - Intronic
983962264 4:173768996-173769018 TGTCTTCTTTTGAGAAGTGTCGG + Intergenic
983982138 4:174010951-174010973 TCTTTTCTGTTGAAAAATAAAGG + Intergenic
984040675 4:174729101-174729123 TCTTTTCTTTGGAGGCATATAGG - Intronic
984104189 4:175524065-175524087 TGTTTTCTTTTGAGTTGTTTGGG - Intergenic
984469106 4:180143466-180143488 TGTCTTCTTTTGAAAAACACTGG + Intergenic
984698004 4:182798859-182798881 TGTTTTCATTTGGGAAACAATGG + Intronic
984906096 4:184627202-184627224 TATTTTCATTACAGAAATATTGG + Intergenic
985022197 4:185703652-185703674 TGATTACTGTTGAGAAATGTCGG + Intronic
986546150 5:8899617-8899639 TTTTTTCTTTTCCGAGATATAGG - Intergenic
987527099 5:19066272-19066294 TGTTTGCTTATTAGATATATGGG + Intergenic
988018240 5:25589047-25589069 TGTTTTCCTTTAAGAAATTAAGG + Intergenic
988105871 5:26746365-26746387 AATTTTCTAATGAGAAATATGGG - Intergenic
988116684 5:26901959-26901981 TATTTTCTTTTGAAAATTGTTGG - Intronic
988770648 5:34429542-34429564 TGTCTTCTTTTGAAAAGTGTTGG + Intergenic
989178321 5:38551917-38551939 CCTTTCCTTTTGTGAAATATGGG - Intronic
989283614 5:39673312-39673334 GGTATTCTTTTGAGAGATAATGG + Intergenic
989342492 5:40391762-40391784 TGTTTTATTTTTAGTAATTTAGG - Intergenic
989535716 5:42561640-42561662 TGCTTTTTCTTGAGAAAGATGGG + Intronic
989588302 5:43090199-43090221 TTTTTTTTTTTGTGAAATAGAGG + Intronic
989780548 5:45259705-45259727 TTTTTTATTTTGAGCACTATTGG - Exonic
989975531 5:50582039-50582061 TGTCTTCTTTTGAGAAGTGTCGG - Intergenic
990173572 5:53082351-53082373 TGTTTTATTTTGTGAAGGATGGG + Intronic
990353481 5:54941600-54941622 TGATTTTTTTTGACAAAAATTGG - Intergenic
990663733 5:58048643-58048665 TGTTTCCTTTTGGCAGATATTGG - Intergenic
990826792 5:59909400-59909422 TTTTTTCTTTTGAGACAAAGGGG + Intronic
991103273 5:62816910-62816932 TGTTATCTATTGAGAAAAAGTGG + Intergenic
991359694 5:65806874-65806896 TGTCTTATTTTAAGAAATAGCGG + Intronic
992191605 5:74297296-74297318 TGTTTTGTTTTAAGAGAGATAGG - Intergenic
992220092 5:74563413-74563435 TGCTTTCTACTTAGAAATATGGG + Intergenic
992427635 5:76674366-76674388 TGCTTTCTCTTGGGAAATGTAGG + Intronic
992715363 5:79505558-79505580 TGTTATCTTTTGAGAAGTGTTGG - Intronic
993057918 5:83003621-83003643 TTTTTTCTCTGGAGAAATTTGGG - Intergenic
993634632 5:90328646-90328668 TCTTTTCTTCTGATAAATTTGGG + Intergenic
993957782 5:94257351-94257373 GGTTTTCTTTTTTAAAATATAGG - Intronic
994397355 5:99235920-99235942 TGTCTTCTTTTGAGAATTGTCGG - Intergenic
994543440 5:101130524-101130546 TGCTTTATTTTGGAAAATATTGG - Intergenic
994582104 5:101656743-101656765 TGTTTCCTTGTAAGAAATATAGG - Intergenic
994964401 5:106649830-106649852 TGCCTTCTTCTGAGAAATATTGG + Intergenic
995158457 5:108944687-108944709 TGTTTTATTTGTAGAAATCTGGG + Intronic
995577569 5:113557435-113557457 TGTTTTCTTATGACCAATAGTGG + Intronic
995734131 5:115280723-115280745 TTTTTTTTTTTGATAGATATAGG + Intronic
995884113 5:116874125-116874147 TTTTATATTTAGAGAAATATTGG + Intergenic
995958850 5:117814628-117814650 TAGTAGCTTTTGAGAAATATTGG - Intergenic
996003964 5:118398804-118398826 TGTTATTTTTTCAGAAATATAGG + Intergenic
996235474 5:121124551-121124573 TGTATATTTTTGAAAAATATGGG + Intergenic
996529629 5:124514478-124514500 TGTTTTCTTTTGATTAAAAATGG + Intergenic
996812118 5:127528073-127528095 ATTCTTCTTTTGTGAAATATCGG + Intronic
996941019 5:129005557-129005579 TGGCTGCTTTTGAGAAACATGGG - Intronic
997063543 5:130535843-130535865 TGTTTAGTTATCAGAAATATGGG + Intergenic
997222005 5:132177010-132177032 TGTTTTCTCATGAGTAAAATGGG + Intergenic
997306279 5:132839145-132839167 TGTTTCATTTTGAGAAATCAAGG - Intergenic
997604658 5:135165901-135165923 TGTCTTCTTTTGAGAAGTTTTGG + Intronic
998532835 5:142901367-142901389 TGTTTACTTTTGAGTAGTTTGGG + Intronic
998573075 5:143282783-143282805 TTTTTTTTTTTGAGATAGATAGG + Intronic
999022519 5:148183638-148183660 TGTTTTCTTCTAAGAACTTTGGG + Intergenic
999340494 5:150766172-150766194 TATTCTTTTTTGAAAAATATAGG + Intergenic
999397486 5:151239276-151239298 AGTTTTTTTTTAATAAATATCGG + Intronic
999561822 5:152811864-152811886 TTTTTTTTTTTGAGAGAGATGGG - Intergenic
999580063 5:153028523-153028545 AATTTTCATCTGAGAAATATTGG - Intergenic
999842291 5:155441240-155441262 TGTGTTCTTTGGAGCAATTTGGG - Intergenic
1000619612 5:163468849-163468871 CATTTTCTGTTGACAAATATTGG + Intronic
1000675864 5:164121817-164121839 TGTGTTCTTTTGAGAAGTGCCGG + Intergenic
1000818390 5:165953098-165953120 TGTTTTTTTTTTAAAAAAATGGG + Intergenic
1001082199 5:168675692-168675714 TGTTGTTTTTTAAGAAATAGGGG - Intronic
1001159961 5:169303937-169303959 AGTTTGCTTTTGAGAAACACAGG - Intergenic
1001213875 5:169837150-169837172 TTTTTTCTTTTAATAATTATAGG - Intronic
1001261300 5:170232013-170232035 TGTTTTCTATTGAGAGGGATGGG - Intergenic
1001355164 5:171014145-171014167 TATTTTCTTTTGATTAATGTTGG + Intronic
1001718072 5:173833551-173833573 TGTTTCCTTTTAAAAAACATAGG - Intergenic
1001770126 5:174288956-174288978 TTTTTTCTTTGTTGAAATATGGG + Intergenic
1001786156 5:174415533-174415555 GGTTTTCTTTAGAGAAAAAAAGG - Intergenic
1001833209 5:174807000-174807022 TGTTTTCTTGTGTGTAAAATGGG + Intergenic
1002270429 5:178068209-178068231 TTTTTTATTTTGAAAAATTTTGG - Intergenic
1002510084 5:179710027-179710049 TGTTTTCTTATCAGTAAAATAGG - Exonic
1003498463 6:6684837-6684859 TGTTGTCTTTTGAGAGATTCTGG + Intergenic
1003741350 6:8944119-8944141 TTTTTTCTATTAAGAAAAATTGG - Intergenic
1003803003 6:9692855-9692877 TTATTTCTTCTGAAAAATATGGG + Intronic
1003943304 6:11049912-11049934 TGTCTTCTTTTGAAAAATGTTGG + Intergenic
1004096373 6:12558942-12558964 TGTTTTGATTTTTGAAATATAGG - Intergenic
1004574183 6:16877507-16877529 TGTCTTCTTTTGAAAAGTATTGG + Intergenic
1004575851 6:16893552-16893574 TGATTTCTTTTCAGAAACAATGG - Intergenic
1004818512 6:19339132-19339154 AGTTTTCTTTTCAGTAATATGGG - Intergenic
1004988651 6:21112075-21112097 TTTTTTCTTTTGATAAATCACGG + Intronic
1005264984 6:24102228-24102250 TGATTACATTTGAGAAATTTTGG + Intergenic
1005396663 6:25389347-25389369 TGTTTTCTTTTTTGAGATTTGGG + Intronic
1005768369 6:29038016-29038038 TGTCTTCTTTTGTGAAGTGTTGG + Intergenic
1005777392 6:29150106-29150128 TGTCTTCTTTTGAAAACTGTCGG + Intergenic
1005796750 6:29371191-29371213 TGTTTTCTTCTTATAAATCTAGG + Intronic
1006873818 6:37277954-37277976 TTTTTTTTTTTGAGAGATAAGGG - Intronic
1006961623 6:37937222-37937244 TATTTTCCTTTTAGAAATGTAGG + Intronic
1007150758 6:39688509-39688531 TATTTTCATTTGATAGATATCGG + Intronic
1007233748 6:40374760-40374782 TGTTTTGTTTTGATTTATATCGG - Intergenic
1007331803 6:41116853-41116875 TTTTTTTTTTTGAGAGAGATGGG - Intergenic
1007335612 6:41153048-41153070 TTTTTTTTTTTAAGAAAGATAGG - Intronic
1007419695 6:41712200-41712222 TGTGTGCTTGTGAGAAACATGGG - Intronic
1007434933 6:41803643-41803665 TTTTTTGTTTTTAGAAAAATGGG + Intronic
1007541115 6:42645598-42645620 GGTTTTCTTTTTAGAAATGTAGG - Intronic
1007688275 6:43680483-43680505 TGTTGTCTTTTAAGGATTATAGG + Intronic
1007772974 6:44206029-44206051 TGTTTCTTTTTTAGTAATATAGG + Intergenic
1008026464 6:46641893-46641915 TGTTTTCTTTAGAGAATATTTGG - Intronic
1008059074 6:46977856-46977878 TTTTTTCTTCTGAAAAATAATGG - Intergenic
1008203128 6:48617334-48617356 TGACTTCTTTTGAGAAATGTCGG + Intergenic
1008242960 6:49135031-49135053 TGTTTTCATTTCAGAAATGAGGG - Intergenic
1008328873 6:50221236-50221258 TTATTTCTTTTGTGAACTATAGG - Intergenic
1008438322 6:51502221-51502243 AGTTTTCTTTAGAAAAAAATTGG + Intergenic
1008813613 6:55535935-55535957 TCTTTTCTTTTGAGGAAGGTAGG - Intronic
1009338405 6:62523428-62523450 CTTTCACTTTTGAGAAATATTGG - Intergenic
1009534084 6:64858782-64858804 AGTTTTCTTTTGATCATTATGGG - Intronic
1009601228 6:65802787-65802809 TGTTATGTATTGAGAAATATTGG - Intergenic
1009747557 6:67837970-67837992 TATTTTATTTCCAGAAATATTGG - Intergenic
1009749420 6:67864382-67864404 TGTTAGCTTTAGAGAAATTTGGG - Intergenic
1009849596 6:69179114-69179136 TGAATTTCTTTGAGAAATATTGG - Intronic
1010272557 6:73930727-73930749 TTTTTTTTTTTGAAAATTATAGG + Intergenic
1010364736 6:75037023-75037045 TTTTTTCTTTTTAAAAATTTTGG - Intergenic
1010912564 6:81578052-81578074 TGTTTTCTTTTGAAGAATTGTGG - Intronic
1011009076 6:82683407-82683429 TATTTTCTTTTCAGAATTATTGG - Intergenic
1011063521 6:83298355-83298377 TGTCTTCTTTTGAGAAGTGTTGG + Intronic
1011154705 6:84317392-84317414 AGTTATCTTTTAAGAAAAATTGG + Intergenic
1011401002 6:86961308-86961330 TATTTTCTTTTGTTTAATATGGG - Intronic
1011765267 6:90612574-90612596 TTGTTTCTTCTGAGAAACATCGG + Intergenic
1011809261 6:91111554-91111576 TATTTTGTTGTGAGCAATATTGG + Intergenic
1012180322 6:96144864-96144886 TGTTTTCTTTTCAGTAAAATGGG - Intronic
1012631905 6:101480836-101480858 TGTTTTATAATGACAAATATTGG + Intronic
1012666111 6:101972393-101972415 TGTCTTCTTTTGAGAAGTATCGG + Intronic
1012681716 6:102190982-102191004 AGATTTCTCTTAAGAAATATTGG - Intergenic
1012704605 6:102505768-102505790 TGTTTTCTTTTGATAGTTGTAGG - Intergenic
1012718421 6:102707185-102707207 TGTTGTATTTTGAGAAACAAAGG + Intergenic
1012760913 6:103299263-103299285 TGTTTTCTTTTCAAAACAATTGG + Intergenic
1012802987 6:103857718-103857740 TTTTTTGTTTTCATAAATATTGG - Intergenic
1013016713 6:106166373-106166395 TATTTTCTTTTTAGAGATAGTGG - Intergenic
1013046869 6:106495066-106495088 TGTTGTCTTTTCAGCAATTTTGG + Intergenic
1013200856 6:107894500-107894522 TGTTTTTTTTTTATAGATATGGG - Intronic
1013413976 6:109908252-109908274 TGGGTTCTTTTGATAAAAATTGG + Intergenic
1013560476 6:111298657-111298679 TTTTTTCTATTGAAAAAAATAGG + Intergenic
1013684453 6:112563160-112563182 TGTTTTCTTTTGGCAGATATTGG + Intergenic
1013714094 6:112936821-112936843 TGTTTTCTAGTGAGCATTATGGG + Intergenic
1013720468 6:113020143-113020165 TGCTTTGTTTTGAGAATTTTTGG - Intergenic
1013940358 6:115653583-115653605 TATTTTCTTCTGGGAAATACTGG + Intergenic
1014427699 6:121329192-121329214 TGCATTTTTTTGGGAAATATAGG - Intronic
1014567545 6:122968984-122969006 TTTTCTCTTTTAAGAAATGTTGG + Intergenic
1014953034 6:127581908-127581930 TATTTTCTTGTAACAAATATGGG - Intronic
1014954466 6:127598487-127598509 TGTCTTCTTTTGAGAAGTGTCGG - Intergenic
1015034757 6:128640000-128640022 ATTTCTCTTTGGAGAAATATGGG + Intergenic
1015087829 6:129316743-129316765 TGTTTTCTTATGACCAAAATTGG + Intronic
1015319003 6:131850455-131850477 AGTTTTATTTTGAAAAATATAGG - Intronic
1015345784 6:132156753-132156775 TATTTTCTTGTGAAAAACATTGG + Intergenic
1015459058 6:133467468-133467490 TGTTTTACTCTGAGAGATATTGG + Intronic
1015535390 6:134262441-134262463 TTTTTTCTTTTTAGAGATAGGGG + Intronic
1015568643 6:134599611-134599633 TGGTTTTTTTTTAGGAATATAGG - Intergenic
1016129907 6:140454903-140454925 TGCTTTCTTTTGATTAATGTTGG + Intergenic
1016385282 6:143524886-143524908 TGTTCCCTTTTCAGAAATGTGGG + Intergenic
1016407848 6:143749125-143749147 TGTTTTCTTTTGAAATTTAAAGG + Intronic
1016601066 6:145861292-145861314 TGTCTTCTTTAGATAAATGTTGG - Intergenic
1016618625 6:146081215-146081237 TGTTAACATTTGGGAAATATGGG + Intronic
1016677697 6:146791371-146791393 TGTTTTATTTTTAGAAAGGTTGG + Intronic
1017278707 6:152600415-152600437 TGTTTGCTTTTTAAAAAAATAGG - Intronic
1017455834 6:154600560-154600582 TGTTTTGTTCTCACAAATATTGG - Intergenic
1017704833 6:157112583-157112605 TGTTTTCTTCTTAGTAATAAAGG - Intronic
1018588808 6:165393128-165393150 TGTTGTCTTTTGAGCACTGTGGG - Intronic
1018749156 6:166788027-166788049 TGTCTTTTTTTGAGAAGTGTCGG - Intronic
1020252488 7:6481046-6481068 TGTTTTCATTTGAGAGATTCAGG - Intronic
1020937973 7:14491598-14491620 TGTGTTCTTTTAGGAAATATTGG - Intronic
1021745488 7:23736680-23736702 TATTTTTTTTTGAGAATTAGAGG + Intronic
1021751025 7:23799933-23799955 TGTCTTCTTTTGAGAAGTGTCGG - Intronic
1021795199 7:24247574-24247596 TGTTTCCTTTTCAGTAAAATAGG + Intergenic
1021879735 7:25083088-25083110 TGTTTACTTTTCAGAACTTTTGG - Intergenic
1021975998 7:26011646-26011668 TGGATTCTTTTGTGAAATTTTGG + Intergenic
1022263586 7:28731516-28731538 TCGTTTCTTTTGAGAAAAAAAGG + Intronic
1022556213 7:31299933-31299955 TGTTTACTTTTGACAAAGAAAGG + Intergenic
1022613594 7:31904639-31904661 TTTTTTCTTTAGAGAAATGATGG - Intronic
1022973819 7:35539200-35539222 TGTCTTCCTTTGTGAAATGTGGG - Intergenic
1023503432 7:40875114-40875136 TGTTTTCTTCTGAGATAGATTGG + Intergenic
1023704140 7:42922440-42922462 TGTTTTCATTTAAAACATATTGG - Intronic
1023778636 7:43634879-43634901 GGTTTTCTTTTGCCTAATATTGG - Intronic
1023825997 7:44009545-44009567 TGGTTTATTTTGAAAAACATGGG + Exonic
1024371177 7:48586060-48586082 TTTTTTCTGATGAGAGATATGGG + Intronic
1024375545 7:48634015-48634037 TGTGTGGTTTTGAGAAATCTTGG - Intronic
1024646081 7:51371508-51371530 TAAAATCTTTTGAGAAATATAGG + Intergenic
1025036935 7:55599362-55599384 TAAAATCTTTTGAGAAATATAGG + Intergenic
1025061016 7:55808202-55808224 TGTGTTTGTTTGAGAAAAATGGG - Intronic
1025243742 7:57299925-57299947 TGTTTTCTTTATGAAAATATAGG + Intergenic
1025770696 7:64502644-64502666 TTGTTTATTTTGAGAAAAATAGG - Intergenic
1026089566 7:67288414-67288436 TGGTTTATTTTGAAAAACATGGG + Intergenic
1026332112 7:69361411-69361433 TGCTTTCCTTTGTGAAAGATTGG + Intergenic
1026497383 7:70914842-70914864 TTTTTTCTTTTGAGAGACAGGGG + Intergenic
1026637891 7:72100163-72100185 TGTTTTTTTTTTAGAGATAAGGG + Intronic
1026724717 7:72862090-72862112 TGGTTTATTTTGAAAAACATGGG - Intergenic
1026746850 7:73020289-73020311 TGGTTTATTTTGAAAAACATGGG - Intergenic
1026750502 7:73048432-73048454 TGGTTTATTTTGAAAAACATGGG - Intergenic
1026754149 7:73076542-73076564 TGGTTTATTTTGAAAAACATGGG - Intergenic
1026757800 7:73104575-73104597 TGGTTTATTTTGAAAAACATGGG - Intergenic
1027032954 7:74904860-74904882 TGGTTTATTTTGAAAAACATGGG - Intergenic
1027089603 7:75288909-75288931 TGGTTTATTTTGAAAAACATGGG + Intergenic
1027093248 7:75316837-75316859 TGGTTTATTTTGAAAAACATGGG + Intergenic
1027096891 7:75344804-75344826 TGGTTTATTTTGAAAAACATGGG + Intergenic
1027119161 7:75503731-75503753 TGGTTTATTTTGAAAAACATGGG + Intergenic
1027272666 7:76531876-76531898 TGGTTTATTTTGAAAAACATGGG - Intergenic
1027289518 7:76689717-76689739 TTTTTTTTTTTAAGAAATTTGGG + Intergenic
1027322457 7:77022876-77022898 TGGTTTATTTTGAAAAACATGGG - Intergenic
1027326115 7:77050961-77050983 TGGTTTATTTTGAAAAACATGGG - Intergenic
1027515888 7:79141088-79141110 TGTTTTAATTTGATAAATGTAGG - Intronic
1027803138 7:82781552-82781574 TGTGTTCTTATGATATATATTGG + Intronic
1027928084 7:84493464-84493486 TGTTTTCTTGTGAAAAAGAGTGG - Intergenic
1027974983 7:85141724-85141746 TGTTTTCTATTGAGAGAAACTGG + Intronic
1027987553 7:85313095-85313117 TCTTTACTTTTGAGCAAAATTGG + Intergenic
1028037116 7:85998908-85998930 TGTTTTCTTGTGAGGAAATTAGG - Intergenic
1028108656 7:86911782-86911804 TGTTTTGTTTTCATAAAAATGGG - Intronic
1028152665 7:87392271-87392293 TGCTTTCATTTTTGAAATATCGG + Intronic
1028339357 7:89699181-89699203 TGTTTCCTCATGAGAAATGTTGG - Intergenic
1028414599 7:90566523-90566545 TGCTTGCATTTGATAAATATGGG - Intronic
1028542592 7:91959685-91959707 TGTTTTCTTTTTAGACATGACGG + Intronic
1028667980 7:93369090-93369112 TGTTGTCTTTAGATAAATACAGG - Intergenic
1029455674 7:100670409-100670431 TATTTTCTTTAAAAAAATATTGG + Intergenic
1029718335 7:102346310-102346332 TGGTTTATTTTGAAAAACATGGG - Intergenic
1029754282 7:102562946-102562968 TGGTTTATTTTGAAAAACATGGG + Intronic
1029772232 7:102662036-102662058 TGGTTTATTTTGAAAAACATGGG + Intronic
1029800579 7:102943000-102943022 TGTTTTATTTTCAGTTATATTGG + Intronic
1029853320 7:103487510-103487532 TGTTTTGTTTTGGCAATTATTGG + Intronic
1030154102 7:106435320-106435342 TGTTTTCTTCTGATAAATTCAGG - Intergenic
1030356495 7:108549061-108549083 CATGTTATTTTGAGAAATATAGG - Intronic
1030371543 7:108705192-108705214 TGTCTTCTTTTGAGAAGTGTCGG - Intergenic
1030473250 7:109995038-109995060 TCTTTGCTTTGGAGACATATGGG + Intergenic
1030481894 7:110114931-110114953 TGTTTTCTTTTAAGAATTTTGGG + Intergenic
1030878587 7:114847462-114847484 TGTATTCTTTTCAGACATATAGG + Intergenic
1030974490 7:116104742-116104764 TTTTTTTTTTTGTGAAATACAGG - Intronic
1031006619 7:116480280-116480302 TGTCTTCTTTTGAGAAGTGTCGG + Intronic
1031031488 7:116740309-116740331 TTTTTCTTGTTGAGAAATATAGG - Intronic
1031103290 7:117508337-117508359 TGTTTTCTTTTAAATACTATAGG - Intronic
1031383658 7:121119198-121119220 TTTTTTCTATTGCGAAATATAGG + Intronic
1031673175 7:124576976-124576998 AGTTTTCTATTCAGAAAAATGGG - Intergenic
1031793528 7:126140808-126140830 TATTTTCTTTATAAAAATATAGG + Intergenic
1031811583 7:126376006-126376028 TGTTTTCTTTTGTGAAATAAGGG + Intergenic
1031831764 7:126636039-126636061 TATTTTCTTTTCAGACATTTTGG - Intronic
1033071064 7:138202732-138202754 TGTCTTCTTTTGAAAAATGTTGG - Intergenic
1033302372 7:140197869-140197891 TGTTAGCTTTTCAGAAATTTTGG + Intergenic
1033819022 7:145110904-145110926 TGTCTTCTTTTGAAAAGTGTCGG + Intergenic
1034018609 7:147615080-147615102 TTTTTTTTTTTGATAAAGATGGG - Intronic
1034104010 7:148475241-148475263 TGTTTTCTTTTCTGACAAATGGG + Intergenic
1034542460 7:151767294-151767316 TGTTTTATTTTGTTAAAGATGGG + Intronic
1034699592 7:153084420-153084442 TGTTTTCCTTTCTGAAACATCGG + Intergenic
1035026604 7:155830640-155830662 TTTTTTTTTTTGAGATAGATAGG + Intergenic
1035181676 7:157093808-157093830 TTTTTTTTTTTAAGAGATATGGG - Intergenic
1035648183 8:1244321-1244343 TGTATGCTTTTGAGAAAAAATGG - Intergenic
1035886578 8:3297889-3297911 TGATTTCTTTTGATAAACACAGG - Intronic
1036800410 8:11786809-11786831 TGTTTACTTTTTAGAGAGATGGG + Exonic
1037039523 8:14213249-14213271 TCTTTACTTTTCAGAAATTTAGG - Intronic
1037148295 8:15601496-15601518 TGCTTTCTTTGGAGAATTTTTGG + Intronic
1037284272 8:17280909-17280931 TCCTTTTTTTTCAGAAATATAGG - Intronic
1037364811 8:18110240-18110262 TATTTTCTTCTGATAAATTTGGG + Intergenic
1037587657 8:20288996-20289018 TTTTTTTTTTTTAGACATATGGG + Intronic
1038137796 8:24807588-24807610 TATTTTCTTTTGAGAATTCTGGG - Intergenic
1038197031 8:25377914-25377936 TTTTTTTTTTTGGTAAATATGGG + Intronic
1038356340 8:26832532-26832554 TGTTTTCTTGGGAGAAATTAAGG + Intronic
1038450396 8:27635625-27635647 TTTTTTTTTTTGATAGATATGGG + Intronic
1038689632 8:29749516-29749538 TTTTTTCTATTGTTAAATATTGG - Intergenic
1038735476 8:30165106-30165128 TGTTTTCTTTCAAGAAACCTAGG - Intronic
1039345287 8:36696949-36696971 TTTTTTTTTTGGAGAAATAGGGG + Intergenic
1039371549 8:36989016-36989038 TGTTTTCTTATGACTAAAATGGG + Intergenic
1039497986 8:37995720-37995742 TGTTTTCTTTGTAGAGATAGGGG - Intergenic
1039622141 8:39007568-39007590 AGATTTCTTTTGAGAAAAAAGGG + Intronic
1039658883 8:39440262-39440284 TGTTTGGTTTTGAGAGATCTTGG + Intergenic
1039782928 8:40804928-40804950 TGCTTACACTTGAGAAATATTGG - Intronic
1040031038 8:42823882-42823904 TTTCTTCTTTTTAAAAATATAGG + Intergenic
1040117164 8:43635472-43635494 TGGAGTCATTTGAGAAATATGGG + Intergenic
1040647511 8:49416567-49416589 TGTCTTCTTTAGAGAAGTATTGG + Intergenic
1041728451 8:61040631-61040653 TGTCTTCTTTTGAGAAGTGTTGG + Intergenic
1042233710 8:66586380-66586402 TGTTTTCTTTTGAGAAATATTGG - Intronic
1042440928 8:68825237-68825259 TGGCTTATTTTGAGTAATATTGG + Intergenic
1042447304 8:68900664-68900686 TGTTTTGTTTTGAAAATTACTGG - Intergenic
1042532989 8:69833610-69833632 TTTTTTCCTTTTAGAAAAATTGG - Intronic
1042592289 8:70408053-70408075 TGTTTTTGCTTGAGAAATAAGGG - Intergenic
1042702163 8:71627342-71627364 TGATATATTCTGAGAAATATAGG + Intergenic
1042930591 8:74009363-74009385 TTTTTTTTTTTGAGAAAGACTGG - Intronic
1042991386 8:74644563-74644585 TTTTTCCTTTTGTGAAACATAGG + Intronic
1043191880 8:77234786-77234808 TCTTTGCTTTTTAAAAATATTGG + Intergenic
1043391048 8:79792076-79792098 TGTCTTCTTGTGATAAATGTCGG + Intergenic
1043620256 8:82181706-82181728 TTTTTTCCTGTGATAAATATAGG + Intergenic
1044099150 8:88109548-88109570 TTTTTGCTTTAGAGAAATATAGG + Intronic
1044151353 8:88779531-88779553 TCTTTTCTTTTTTGATATATGGG + Intergenic
1044301159 8:90584856-90584878 TGTTATTGGTTGAGAAATATAGG + Intergenic
1044426709 8:92060113-92060135 TGTTTTCTTATGAGAAGGCTGGG - Intronic
1044658734 8:94574723-94574745 TTTTTTCTTTTGGTAAAGATGGG - Intergenic
1044893195 8:96859286-96859308 TGTCTGCTTTTGAGAGATTTGGG + Intronic
1045089891 8:98730975-98730997 TCTGTACTTTTGAGAAATCTTGG - Intronic
1045138711 8:99254558-99254580 TTTTGTCTTTTGTCAAATATGGG + Intronic
1046730161 8:117716628-117716650 TTTTTACTTTTGAAAAAAATTGG - Intergenic
1046794478 8:118356168-118356190 AGTTTTCTTTTAAGTAAAATGGG - Intronic
1046831067 8:118746895-118746917 TTTTTTCTTTTGAGAGAGAGAGG - Intergenic
1046923074 8:119755065-119755087 TGTTTTCATTTGTAAAATGTAGG - Intronic
1046948943 8:120001744-120001766 GTTTGTCTTTTGAGAAATAGTGG + Intronic
1046966591 8:120174183-120174205 TGTTTTCTTTTTGTAAAAATAGG + Intronic
1047600574 8:126422207-126422229 TGTTTTCTTATGTATAATATAGG - Intergenic
1047835374 8:128684400-128684422 TTTTTTCATTTGTAAAATATAGG + Intergenic
1048824014 8:138406006-138406028 TGTCTTCTTTTGAGAAGTGTCGG + Intronic
1048935716 8:139355114-139355136 TGTTTTCTTCTCAGTAAAATGGG + Intergenic
1049140014 8:140945581-140945603 TGTTTTTTTTTGAGAAATAAAGG - Intronic
1050143130 9:2537590-2537612 TGTTTACTTTTCAGTAAAATGGG + Intergenic
1050236095 9:3581594-3581616 TGGTTTCTTTTGAGATTTTTTGG - Intergenic
1050579577 9:7037848-7037870 TGTTTTGTTTTGGGGAACATTGG + Intronic
1050722143 9:8602207-8602229 AGTTTTCTATTTAGAACTATTGG - Intronic
1050870605 9:10564185-10564207 TTTTTTTTTTTGAGACATAGGGG + Intronic
1051146100 9:14029246-14029268 TGTTTTCTTATAAGATATTTAGG - Intergenic
1051402236 9:16695543-16695565 TTTTTTTTTTTGATAAAAATGGG + Intronic
1051730400 9:20136525-20136547 TCCTTTCTTGTGAGAAAAATTGG - Intergenic
1051968078 9:22854038-22854060 TTTTTTCTTTTGAGAAGAAAAGG + Intergenic
1052254993 9:26445470-26445492 TGCTTTCTCTTGAGATAAATTGG - Intergenic
1052260606 9:26512091-26512113 TGTTTTCTTTTAATAAATGGTGG - Intergenic
1052302101 9:26963751-26963773 TGTCTTCTTTTGGGAAGTGTCGG + Intronic
1052512860 9:29444009-29444031 TTTTTTCTATTGAAAAATCTTGG - Intergenic
1052575570 9:30285889-30285911 TGTCTTTTTATTAGAAATATGGG + Intergenic
1053553389 9:39107828-39107850 TGTTCTCTTTTAAGAAAAAATGG - Intronic
1053817496 9:41927985-41928007 TGTTCTCTTTTAAGAAAAAATGG - Intronic
1053819975 9:41956560-41956582 TTTTTTCTTCTGGGACATATAGG - Intronic
1054107751 9:61071657-61071679 TGTTCTCTTTTAAGAAAAAATGG - Intergenic
1054110246 9:61100245-61100267 TTTTTTCTTCTGGGACATATAGG - Intergenic
1054610611 9:67230880-67230902 TTTTTTCTTCTGGGACATATAGG + Intergenic
1054613106 9:67259468-67259490 TGTTCTCTTTTAAGAAAAAATGG + Intergenic
1054785463 9:69205951-69205973 TTTTTTCCTTTGAAAAATCTTGG - Intronic
1054838201 9:69702836-69702858 TTTTTTTTTCTGAGATATATTGG + Intergenic
1055177744 9:73341061-73341083 TGTTCTCTTTTGGGAATTTTAGG + Intergenic
1055188433 9:73486960-73486982 TGTCATATTTTGAGAAATTTGGG - Intergenic
1055358494 9:75462710-75462732 TGTTTTCTTTTCTGTAAAATTGG - Intergenic
1055632899 9:78241880-78241902 TTTTGTCTTTTGATACATATGGG + Intronic
1056181018 9:84082457-84082479 TTTTTTCTTTTTAGCAAAATGGG + Intergenic
1056457578 9:86776012-86776034 TGTCTTCTTTGGTGAAGTATAGG + Intergenic
1056520594 9:87397592-87397614 AGTTTTCTTTTGGGGAATAATGG - Intergenic
1056854940 9:90118894-90118916 TTTTTTCTTTTTAAAAATTTTGG + Intergenic
1057233627 9:93341037-93341059 TGTTTGCTTTAGAGGAAAATTGG - Intronic
1057328097 9:94084952-94084974 TGTTTTTTTATTAAAAATATAGG + Intronic
1057416325 9:94866262-94866284 TGTTTTATTTTGTGAAATGTGGG + Intronic
1058222211 9:102316191-102316213 TGTTTTTTTTTGGCAAATATGGG - Intergenic
1058491824 9:105509760-105509782 TGTTTCTATTTGAGAACTATAGG + Intronic
1058678640 9:107422639-107422661 AGTTTTCTCTTGGGCAATATGGG - Intergenic
1059563697 9:115360862-115360884 TTTTTTTTTTTCAGCAATATAGG - Intronic
1059706111 9:116825124-116825146 TGTTTTCTTTCTATAAATAGAGG + Intronic
1059768853 9:117409126-117409148 TGATTTCTTGAGAGAAAGATAGG - Intronic
1060008713 9:120024605-120024627 TCATTTCTTATTAGAAATATTGG + Intergenic
1060557357 9:124515074-124515096 TGTTTTCTTATCTGTAATATGGG + Intergenic
1061038613 9:128127278-128127300 TGTATTCTTTTGTGTAAAATAGG - Intronic
1061645778 9:132000054-132000076 ATTTTACTTTTGAGAAATACAGG - Intronic
1061758102 9:132829588-132829610 TTTTTTTTTTTAAGAAAAATGGG - Intronic
1203617725 Un_KI270749v1:83738-83760 TGTATTGTTTTGTTAAATATAGG - Intergenic
1186238738 X:7543624-7543646 TTTTTTTTTTTCAGAAAGATTGG - Intergenic
1186545192 X:10441942-10441964 TTTTTTATTTTGTAAAATATAGG + Intergenic
1187022396 X:15397624-15397646 TATTTTAATTTGAGAAATAATGG + Intronic
1187579866 X:20596188-20596210 TGTTCTCTTGTGAGAATTTTAGG - Intergenic
1187799681 X:23047354-23047376 TCTTTTATTTTGAGGAAAATGGG - Intergenic
1188024127 X:25190727-25190749 TGTTTTTTTCTGAGGAGTATCGG - Intergenic
1188030097 X:25254399-25254421 TGTTTTACTTTGATAAATAAGGG + Intergenic
1188079391 X:25817497-25817519 TTTTTTATTTTGAGTATTATAGG + Intergenic
1188231545 X:27670037-27670059 TGCTTTCTTTTTAGAAATATTGG - Intronic
1188254128 X:27938897-27938919 TTTTTTCATATGAAAAATATAGG + Intergenic
1188724925 X:33571272-33571294 ATTTTTCTTTCGAGTAATATTGG + Intergenic
1188789030 X:34385734-34385756 CCATTTATTTTGAGAAATATAGG + Intergenic
1188866659 X:35321155-35321177 TTTAATCATTTGAGAAATATGGG - Intergenic
1189281112 X:39820816-39820838 TTTTTTTTTTTGAGAGATTTAGG - Intergenic
1189335301 X:40167558-40167580 GGTTTTCTTTTTAGAAACAGTGG - Intronic
1189462696 X:41254903-41254925 TGTTTTCTTTTTAAAAAAAGGGG - Intergenic
1189953231 X:46253453-46253475 TGTTTCCTTTGGAGAAAAATAGG + Intergenic
1190307460 X:49093236-49093258 TGTTTTCTTTTAATAGAGATGGG + Intronic
1190497951 X:51045074-51045096 TGTTTTCTTTAGGCAACTATAGG + Intergenic
1190558723 X:51665890-51665912 TGTTTTGTTTTGCCAAATCTAGG - Intergenic
1190570453 X:51776328-51776350 CGTTTTCTTTTGAGTTATTTGGG + Intergenic
1190905803 X:54726631-54726653 TGTCTTCTTTTGAAAAGTGTTGG - Intergenic
1191091024 X:56621628-56621650 TATATCCTTTTGAGAAATGTGGG + Intergenic
1191777800 X:64835968-64835990 TATTTTCTTCTCTGAAATATTGG + Intergenic
1192599685 X:72448777-72448799 TGTCTTCTTTAGAGAAGTGTCGG - Intronic
1192899142 X:75476252-75476274 TTTTTTTTTTTAAGAAATTTGGG + Intronic
1192994442 X:76497954-76497976 TGTCTAATTTTGAGAAATGTCGG - Intergenic
1193310151 X:79998042-79998064 TGTTATCTTTTGTGTAAAATGGG + Intergenic
1193371485 X:80703124-80703146 TGTTTTTTTTTAATAAATATTGG + Intronic
1193498811 X:82247048-82247070 TTTATTATATTGAGAAATATTGG + Intergenic
1193516147 X:82466835-82466857 TGTTTCCTTTTAAGATTTATTGG - Intergenic
1193774537 X:85625861-85625883 TGTCTTCTTTTGAGAAGTATTGG - Intergenic
1193830469 X:86283077-86283099 TGTCTTCTTTTAAGAAGTGTCGG - Intronic
1193895934 X:87114848-87114870 TGTCTTCTTTTGAAAAGTGTCGG - Intergenic
1193909414 X:87283294-87283316 TGTTTTCTTTTTATAAATGTTGG + Intergenic
1193944215 X:87712076-87712098 TGTTATTTTTTGAGAACTTTTGG - Intergenic
1194312376 X:92327767-92327789 TGTTTTCTTTTGAGCAACTAAGG + Intronic
1194725281 X:97388847-97388869 TTTTTTGTTTTGGAAAATATAGG - Intronic
1194762211 X:97808584-97808606 TTGTTTCTTTTGAGAAATCATGG + Intergenic
1195049883 X:101087451-101087473 AGTTTTCTCTTGAGAAACAGAGG + Intronic
1195248662 X:103021253-103021275 TGTCTTCTTTTGAGAAGTGTAGG + Intergenic
1195586632 X:106572479-106572501 TGTTTTCTTTTGATTAGTGTTGG - Intergenic
1196103154 X:111868595-111868617 TGATTTCTTTTAGGAAACATGGG - Intronic
1196579553 X:117362623-117362645 TGTCTTCTTTTGAGAAGTATTGG - Intergenic
1197283394 X:124565008-124565030 TTTTTCCTTTTGAAAAGTATAGG - Intronic
1197339897 X:125254695-125254717 TGTCTTCTATTGAGAAATACAGG - Intergenic
1197922990 X:131615435-131615457 AATTTTCCTTTTAGAAATATTGG + Intergenic
1198049480 X:132935858-132935880 TATTTTCTTTTTGAAAATATAGG + Intronic
1198134468 X:133734106-133734128 TCTGTCCTTATGAGAAATATTGG - Intronic
1198413831 X:136399362-136399384 TTTTTTATTTTGAAAAATACTGG + Intronic
1198773192 X:140152259-140152281 TGTCTTCTTTTGAGAAGTGTCGG + Intergenic
1198982912 X:142419594-142419616 AGTTTTCATTTTATAAATATAGG + Intergenic
1198995571 X:142569893-142569915 TTTTTTCTTCCAAGAAATATTGG + Intergenic
1199011404 X:142762914-142762936 TGATTTCTTCTGAGAAAGAGTGG - Intergenic
1199169137 X:144716114-144716136 TGTTTTCCTTAGAGAATAATGGG + Intergenic
1199198867 X:145064184-145064206 TGTTTTTTTCTGAGAGATAATGG - Intergenic
1199260936 X:145774032-145774054 TGCTTTACTTTGAGAAATACTGG - Intergenic
1199594438 X:149495474-149495496 TTTTTTTTTTTAAGAAATGTCGG + Intronic
1199906100 X:152233115-152233137 TGTCTTCTTTTGAAAAATGTCGG + Intronic
1200300420 X:154968934-154968956 TTTTTTTTTTGGAGAAATCTAGG - Intronic
1200406308 Y:2815070-2815092 TGTCTTCTTTTGAGAAGTGTTGG + Intergenic
1200620644 Y:5441898-5441920 TGTTTTCTTTTGAGCAACTAAGG + Intronic
1201684763 Y:16688559-16688581 TATCTTCTTTTGAGAAGTGTCGG - Intergenic
1202360978 Y:24110165-24110187 TGTGTTCTTTTGAGAAATGTCGG + Intergenic
1202509800 Y:25559953-25559975 TGTGTTCTTTTGAGAAATGTCGG - Intergenic