ID: 1042233712

View in Genome Browser
Species Human (GRCh38)
Location 8:66586396-66586418
Sequence GAAAACATACAAATGGACAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042233708_1042233712 29 Left 1042233708 8:66586344-66586366 CCAATAATCTGACTTAAAATAGG 0: 1
1: 1
2: 3
3: 24
4: 178
Right 1042233712 8:66586396-66586418 GAAAACATACAAATGGACAATGG No data
1042233710_1042233712 -7 Left 1042233710 8:66586380-66586402 CCAATATTTCTCAAAAGAAAACA 0: 1
1: 0
2: 22
3: 143
4: 995
Right 1042233712 8:66586396-66586418 GAAAACATACAAATGGACAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042233712 Original CRISPR GAAAACATACAAATGGACAA TGG Intronic
No off target data available for this crispr