ID: 1042235866

View in Genome Browser
Species Human (GRCh38)
Location 8:66613025-66613047
Sequence GGCGCTGCGGGCCGGGGTCG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 675
Summary {0: 1, 1: 1, 2: 9, 3: 63, 4: 601}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042235866_1042235888 26 Left 1042235866 8:66613025-66613047 CCCCGACCCCGGCCCGCAGCGCC 0: 1
1: 1
2: 9
3: 63
4: 601
Right 1042235888 8:66613074-66613096 AGGGATACCCCCAACATGTCAGG 0: 1
1: 0
2: 0
3: 6
4: 68
1042235866_1042235878 6 Left 1042235866 8:66613025-66613047 CCCCGACCCCGGCCCGCAGCGCC 0: 1
1: 1
2: 9
3: 63
4: 601
Right 1042235878 8:66613054-66613076 AGCCCCGGCCCGGCCCGGCCAGG 0: 1
1: 24
2: 99
3: 186
4: 852
1042235866_1042235877 1 Left 1042235866 8:66613025-66613047 CCCCGACCCCGGCCCGCAGCGCC 0: 1
1: 1
2: 9
3: 63
4: 601
Right 1042235877 8:66613049-66613071 CTCTTAGCCCCGGCCCGGCCCGG 0: 1
1: 0
2: 0
3: 20
4: 189
1042235866_1042235879 7 Left 1042235866 8:66613025-66613047 CCCCGACCCCGGCCCGCAGCGCC 0: 1
1: 1
2: 9
3: 63
4: 601
Right 1042235879 8:66613055-66613077 GCCCCGGCCCGGCCCGGCCAGGG 0: 1
1: 1
2: 11
3: 101
4: 666
1042235866_1042235889 29 Left 1042235866 8:66613025-66613047 CCCCGACCCCGGCCCGCAGCGCC 0: 1
1: 1
2: 9
3: 63
4: 601
Right 1042235889 8:66613077-66613099 GATACCCCCAACATGTCAGGAGG 0: 1
1: 0
2: 0
3: 4
4: 78
1042235866_1042235875 -4 Left 1042235866 8:66613025-66613047 CCCCGACCCCGGCCCGCAGCGCC 0: 1
1: 1
2: 9
3: 63
4: 601
Right 1042235875 8:66613044-66613066 CGCCGCTCTTAGCCCCGGCCCGG 0: 1
1: 0
2: 0
3: 5
4: 77
1042235866_1042235874 -9 Left 1042235866 8:66613025-66613047 CCCCGACCCCGGCCCGCAGCGCC 0: 1
1: 1
2: 9
3: 63
4: 601
Right 1042235874 8:66613039-66613061 CGCAGCGCCGCTCTTAGCCCCGG 0: 1
1: 0
2: 0
3: 3
4: 72

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042235866 Original CRISPR GGCGCTGCGGGCCGGGGTCG GGG (reversed) Exonic
900102298 1:967030-967052 GGCGGGGCGGGCCGCGGGCGGGG + Intronic
900185847 1:1332902-1332924 GGAGCTGCGGGCGGGGGACGGGG - Exonic
900244272 1:1630317-1630339 GGCGCGGCGGGCCGGGGGCGGGG - Exonic
900367017 1:2315479-2315501 GGGCCTGCGGGCCGGGATGGGGG - Intergenic
900474060 1:2868145-2868167 GGGGCTGCAGGCCGGGATGGTGG - Intergenic
900577983 1:3393846-3393868 GGCGGGGCGGGGCGGGGGCGGGG - Intronic
901017809 1:6241987-6242009 GGCGCATCGGGCCGGGGGCGGGG - Intergenic
901050725 1:6424712-6424734 GGCGGGGCGGGGCGGGGTGGGGG + Intergenic
901057624 1:6456015-6456037 GGCGCGGCGGGCGGGGGCGGCGG - Intronic
901379925 1:8866234-8866256 GGCGCTGCAGGGCTGGGTGGGGG + Intronic
901381628 1:8878460-8878482 GGCCCAGCGTGGCGGGGTCGGGG - Intronic
901916580 1:12504933-12504955 GGCGCTGGGGGCTGGGGGCTGGG + Intronic
902214122 1:14924040-14924062 GCCGCGGCGGGGCGGGGGCGGGG + Intronic
902385592 1:16073685-16073707 GGCGCGGCGGGCGGGGCCCGGGG + Intergenic
902770087 1:18640828-18640850 GGCGCGCCGGGCCGGGGGCTGGG + Intronic
902916784 1:19644402-19644424 GGAGCTGGGTGCGGGGGTCGCGG - Intronic
903263193 1:22142365-22142387 CGCGCTGCGGGCTGGGCTGGAGG - Intronic
903459414 1:23510000-23510022 GGAGCTGCACGCCAGGGTCGGGG + Exonic
903501166 1:23800804-23800826 GGCGTGGAGGGGCGGGGTCGGGG - Exonic
904614564 1:31742935-31742957 GCAGCTGCGGGCGGGGGTCCCGG - Exonic
905012278 1:34755578-34755600 GGAGGTGGGGGCCGGGGTTGGGG - Intronic
905189754 1:36224428-36224450 CGCGCTGTGGGGCGGGGGCGAGG + Exonic
905199890 1:36308170-36308192 GGCGCTGCGGAGGGGGGACGTGG + Exonic
905375052 1:37514531-37514553 GGCGCGGCGGGCCGGGTGCTCGG - Intronic
905379862 1:37554145-37554167 GGTGCTGCCGGCGGGGGTGGTGG - Exonic
905395119 1:37661736-37661758 GGGGCTGAGGGCCGGGGCCTGGG + Intergenic
905798276 1:40827612-40827634 GGCCCTGTGGGCTGGGGTCCCGG + Intronic
905912178 1:41662485-41662507 GGCGCCCCGGGCCGGCGGCGGGG - Intronic
905990582 1:42334652-42334674 GCCGCAGAGTGCCGGGGTCGGGG + Intronic
906027027 1:42682609-42682631 GGCGCTGAGGGCGGGGGCGGCGG - Exonic
906044410 1:42817068-42817090 GGCGGGCCGGGGCGGGGTCGGGG - Intronic
906325507 1:44843113-44843135 GGAGCTGCGGGTCCGGGGCGCGG + Intergenic
906637158 1:47417140-47417162 CGGGCAGCGGGCCGGGGCCGGGG - Exonic
906662658 1:47593743-47593765 GGGGCCGAGGGGCGGGGTCGGGG - Intergenic
906694704 1:47816191-47816213 GGCCCTGGGGCCCGGGGTCTGGG + Intronic
912576338 1:110675257-110675279 GGCCAGGCGGGCCGGGGGCGAGG - Intergenic
913356581 1:117929390-117929412 GGCGGAGAGGGCCGGGGGCGCGG - Intronic
913714450 1:121519539-121519561 GGCGCTCCGGGCAGGGTTGGCGG + Intergenic
914257785 1:145974875-145974897 CGGGGTGGGGGCCGGGGTCGTGG + Exonic
914489999 1:148146126-148146148 GGCCCTGGGGCCCGGGGGCGCGG + Intronic
915109037 1:153551362-153551384 GGTGCTGGGGGCCGAGGGCGAGG - Intergenic
915161262 1:153922521-153922543 GGCGCGCCGTGCCGGGGTGGGGG + Intronic
915165656 1:153946505-153946527 GGCGCAGCGCGGCGGGGACGCGG - Exonic
915321346 1:155058043-155058065 GGCGCAGCGGGCTGGGCTCCAGG - Exonic
916233340 1:162561646-162561668 GGCGGGGCGGGCCGGGAGCGGGG - Exonic
916961582 1:169894373-169894395 GCCGCTGCTGGCGGAGGTCGTGG + Intergenic
917838467 1:178959026-178959048 GGCGCGGGGGGCAGGGGTGGCGG + Intergenic
918066572 1:181105502-181105524 GGCGGGGCGGGGCGGGGGCGGGG + Intergenic
918821021 1:189254147-189254169 GGGGCAGGGGGCGGGGGTCGAGG + Intergenic
919640629 1:200041078-200041100 GGCGCTGGGGGGCTGGGTTGGGG + Intronic
919789971 1:201284507-201284529 GGCGCTGCGGGACGGGAAAGTGG + Intronic
920022653 1:202967277-202967299 GGCGGGGCAGGCCGGGGGCGGGG + Exonic
922488890 1:225999470-225999492 GGCGGTGCGGGCTGGGGGAGGGG + Intergenic
922602919 1:226870699-226870721 GGCGCTGAGGGCCCGGGGTGGGG + Intronic
922756967 1:228102208-228102230 GGCGCTGCGGGGCGTGGTGTGGG - Intronic
922766443 1:228158826-228158848 GGCGCTGCGCGACGGGGCAGCGG + Exonic
923631257 1:235650304-235650326 GGATCTGCGGGGCGGGGCCGGGG + Intronic
923783190 1:237043104-237043126 GGCGCAGCTGACCGGGGGCGGGG + Intronic
924414942 1:243849746-243849768 TGCGCAGCGGGCCGGGGGAGGGG - Intronic
924482786 1:244451931-244451953 GGCCCGGCGGGGCGGGGGCGGGG - Exonic
924624658 1:245688446-245688468 GCAGCTGCGGGCCGGGCCCGAGG + Exonic
924778401 1:247126821-247126843 GGGGCTGCGGGCGCGGGCCGGGG - Intronic
924783257 1:247171599-247171621 GGGGCTGCGGGCGCGGGCCGGGG + Intronic
1062857213 10:785311-785333 GGTGCTGCGGGCAGGGGGCTGGG - Intergenic
1063392829 10:5661319-5661341 GGCTCGGCGGGGCGGGGTTGGGG - Intronic
1063421007 10:5912492-5912514 GGGGCTGGGGGCCGGGGGAGGGG + Intronic
1063929988 10:11018537-11018559 GGCGCGGCGTCCCGGGGTCCGGG + Intronic
1064146309 10:12828896-12828918 GGAGGTGGGGCCCGGGGTCGGGG + Exonic
1064208844 10:13347424-13347446 CGGGCTGCGGGCCGGCGGCGGGG + Intronic
1064443018 10:15370765-15370787 GGCGGCGCGGGCCGGCGACGCGG - Intronic
1066126327 10:32346585-32346607 GCCGCGGCGGCCGGGGGTCGAGG + Intronic
1066181084 10:32961398-32961420 GGGGCTGGGGGTCGGGGGCGGGG - Intronic
1066661476 10:37741351-37741373 GGCGCTGGGGCCAGGGGTCCTGG + Intergenic
1069589005 10:69630449-69630471 TGCGCCGCGGGCCGGGCGCGCGG + Intronic
1070162253 10:73873764-73873786 GGCGCCGCGGGTGGGGGTGGGGG + Intronic
1070290645 10:75111457-75111479 GGCCCTACCGGCCGGGGACGGGG - Intronic
1071352775 10:84763245-84763267 GGGGCTGAGGGCCGGGGCCGTGG + Intergenic
1072151720 10:92689783-92689805 GGCGGGGCGGGCCGGGGTGGGGG + Intergenic
1072152609 10:92695912-92695934 GGCGCAGCGGGCCTGGGCCTCGG - Intergenic
1073094134 10:100969635-100969657 GGGGCTGCGGGCCGGGGGTCGGG + Intronic
1073110593 10:101061227-101061249 GGCACTTTGGGCCGGGGGCGGGG - Intergenic
1073392781 10:103193103-103193125 GTCCCTGGGGGCCGGGGGCGGGG + Intronic
1073491353 10:103855363-103855385 GGCGCGCCGGGCCGGGGTGGCGG - Exonic
1073491520 10:103855810-103855832 GGGGCTCCGGGCCGGGGGAGGGG + Intergenic
1074095115 10:110304767-110304789 GGGGCGGCGGGAAGGGGTCGGGG + Exonic
1075430302 10:122374785-122374807 GGTGCTCCGGGCCGAGGCCGCGG + Exonic
1076116985 10:127907500-127907522 CGCGCCACAGGCCGGGGTCGGGG - Intronic
1076395885 10:130136897-130136919 GGCGCGGAGGGCCGGGGTCTCGG - Intronic
1076657869 10:132036614-132036636 GGCGGGGCGGGCCGGGTTCGGGG + Intergenic
1076900467 10:133335293-133335315 GGCGCTGCGGGCCCTGGTGCGGG - Intronic
1076905218 10:133357897-133357919 AGCGCAGCGGGCCGGGGCCTCGG - Intronic
1077008443 11:369709-369731 GGCGGGGCGGGCCGGGGATGCGG + Intergenic
1077043683 11:535330-535352 CGCGGCGCGGGCCGGGGGCGCGG - Intronic
1077252136 11:1565377-1565399 GGTGCTGCGGGCGGGGGTGCGGG + Intronic
1078090773 11:8263190-8263212 CGCGCTGGGGGCCGGGGCTGGGG - Intronic
1078168472 11:8910963-8910985 GGCGCTGGGGGCCGGGGGTCGGG - Intergenic
1078266286 11:9758303-9758325 GGCCCCGCGCGCCCGGGTCGGGG - Intergenic
1078786492 11:14499572-14499594 GGGGGTGCGGGTCGGGGTGGGGG - Intronic
1080457153 11:32428113-32428135 GAGGCTGCGGGCAGGGGTTGGGG + Intronic
1081620828 11:44618374-44618396 GGGGCTGCGGATCGGGGGCGGGG + Intronic
1081831600 11:46120384-46120406 GGGGCTGCGGGCGGGGGCGGGGG - Intronic
1083303757 11:61752550-61752572 GGCGCGGCGGGCGGGGCGCGTGG + Intergenic
1083758424 11:64803255-64803277 GGGGCTGAGGCCCGGGGGCGGGG + Intergenic
1083762581 11:64826746-64826768 GCCGCTGTGGGCCGGAGCCGCGG + Exonic
1083766110 11:64842372-64842394 GGAGCTGTGGGCCTGGGTCCCGG + Intronic
1083922127 11:65786810-65786832 GGCCGGGCGGGGCGGGGTCGGGG - Intergenic
1083958831 11:66002681-66002703 CGCGCTGCGGGGAGGGGGCGGGG + Intronic
1084031337 11:66482407-66482429 GGCGCAGCTGGTCGGGGTCCTGG - Exonic
1084041568 11:66545916-66545938 CGCGCTGTGGGCCGCGGCCGTGG - Exonic
1084066134 11:66705361-66705383 GGCGCGGCGGGCCCGGCTGGAGG - Exonic
1084072508 11:66745297-66745319 GGCGTTGCGGGGCGGGGTGGGGG + Intronic
1084129102 11:67119558-67119580 GGCGCGGCGCGCCGGGATGGGGG - Intronic
1084295923 11:68213414-68213436 GGCGCAGCGAGCCGAGGCCGGGG - Exonic
1084804854 11:71571660-71571682 GGGGCTGGGGGCCGGGACCGCGG + Intergenic
1085312673 11:75525619-75525641 GGCGCAGCGGGTCAGGGCCGGGG + Exonic
1085666171 11:78417517-78417539 GCCGCGGGGGGCCGGGGGCGAGG - Intronic
1089525605 11:119094756-119094778 GGCGGTGCGGGACGGGAGCGGGG + Exonic
1089580918 11:119481631-119481653 CGCGCTGCGGGTGGGGGGCGCGG + Intergenic
1089842103 11:121427318-121427340 GGCGCTGCGGGGCCGGGACCTGG - Intergenic
1090210975 11:124921038-124921060 GGCGCGGCGCGCTGGGGACGAGG - Exonic
1091173719 11:133541494-133541516 GGCGCTCCGGGCAGGAGTCTGGG - Intergenic
1091259872 11:134225358-134225380 GGCGCTGGGGGAGGGGGTCCCGG - Intronic
1091273107 11:134331860-134331882 GGCGGGGCTGGCCGGGGCCGGGG - Exonic
1091616206 12:2052933-2052955 GGCGCGGCGGGGCTGGGCCGGGG + Intronic
1091696930 12:2633937-2633959 GGCGCTGCCGGGCTGGGGCGTGG + Intronic
1092487382 12:8914504-8914526 GGGGCTGCGGGCCGGGCTGGAGG - Intronic
1095977054 12:47946932-47946954 GGCGCTGGAGGACGGGGCCGTGG + Intergenic
1096232472 12:49904041-49904063 GGCGGTGGGGGGCGGGGTGGGGG - Intronic
1096392356 12:51239143-51239165 GGAGCTGCGGGCTCGGGTGGTGG + Intronic
1096465689 12:51847022-51847044 CGAGCTGCGGGCAGGGGGCGGGG - Intergenic
1096796741 12:54082569-54082591 GGGGCCGGGGGCCGGGGCCGGGG + Intergenic
1096978737 12:55716444-55716466 GGCGCTCCGGGGCAGGGGCGGGG - Intronic
1097155104 12:57006555-57006577 GGCGCTGCGGGCCGGGCGGCGGG - Intergenic
1097155125 12:57006605-57006627 GGCGCTGCGGCCGGGCGGCGGGG - Intergenic
1097896162 12:64825880-64825902 GGCGCTGGGGGGCGGGGGCCGGG - Intronic
1100611509 12:96194823-96194845 TGGGCTGCGGGCCGGGGTGGGGG + Intronic
1101371952 12:104138323-104138345 GGCGGGGCGGGGCGGGGCCGCGG - Intergenic
1101853120 12:108420597-108420619 GGGGCGGCTGGCCGGGGTGGGGG - Intergenic
1101875073 12:108592192-108592214 GGGGCTGAGGGCCGGGGTCCAGG + Exonic
1102244610 12:111347623-111347645 GGCTCTGCGGGGTGGGGTCTGGG - Exonic
1103381499 12:120496968-120496990 GGGGCTGGGGGCTGGGGTAGGGG + Intronic
1104074159 12:125374636-125374658 GCCGGGGCGGGGCGGGGTCGGGG - Intronic
1104289501 12:127455388-127455410 GGCCCTGCGGGGCGGGGGGGGGG - Intergenic
1104910130 12:132236304-132236326 GTCGCGGTGGGCCTGGGTCGGGG + Intronic
1104914430 12:132257516-132257538 GGGGATGAGGGCCGGGGACGAGG - Intronic
1104970203 12:132527588-132527610 GGGGCTGCGGGGCAGGGTTGAGG + Intronic
1104970213 12:132527616-132527638 GGGGCTGCGGGGCAGGGTTGAGG + Intronic
1104970223 12:132527644-132527666 GGGGCTGCGGGGCAGGGTTGTGG + Intronic
1104989682 12:132618674-132618696 GGCGAGGCGGGGCGGGCTCGAGG + Intergenic
1105434134 13:20362661-20362683 GGTGCTGCAGGGCGGGGTGGAGG + Intergenic
1105437921 13:20392342-20392364 GGCGCTGCGGGCTGGCGTCCGGG - Intergenic
1105512346 13:21061318-21061340 GGGGCTGGGAGCTGGGGTCGGGG - Intronic
1105890719 13:24680710-24680732 GGCGCCGCGGGCTGCGGGCGTGG - Exonic
1106422507 13:29595513-29595535 GGCGGGGCGGGGCGGGGGCGCGG + Exonic
1107468133 13:40667071-40667093 GGGGCCGAGGGCCGGGGGCGCGG + Intergenic
1108063260 13:46553361-46553383 GGAGCGGCGGGGCGGGGTGGGGG + Exonic
1108273271 13:48783683-48783705 GGGGCTGCGGGGAGGGGTGGAGG + Intergenic
1110237892 13:73235485-73235507 GGTGAGGCGGGCCGGCGTCGTGG - Intergenic
1110318640 13:74135698-74135720 GGCGGGCCGGGCCGGGGGCGCGG - Intergenic
1110569859 13:76991922-76991944 GCCGCCGCGGGCCGGGCGCGGGG + Exonic
1110775701 13:79405979-79406001 CGGGCTGGGGGCCGGGGACGGGG - Exonic
1112271883 13:97976441-97976463 GGCGCAGGGGGGCGGGGCCGAGG - Intronic
1112509239 13:99994130-99994152 GGCGCTGCGGGCAGCGGGCTTGG + Intergenic
1112752565 13:102597235-102597257 GGCGCGGGCGGCCGGGGACGCGG + Intronic
1112771784 13:102800410-102800432 GGCTCTGCGGGCTGGGGACTCGG + Intronic
1113796318 13:113060895-113060917 GGGGCTGGGGGCGGGGGTGGGGG - Intronic
1113899514 13:113788433-113788455 GGAGCTGCTGGCCTGGGTGGGGG + Intronic
1114474064 14:22981907-22981929 GGGGCTGAGGGCCGGGGCCGTGG + Exonic
1114519021 14:23321519-23321541 GGGGCTCCGGGCCGGGGCGGCGG + Exonic
1116817530 14:49598220-49598242 GGCGCTCACGGTCGGGGTCGTGG - Intronic
1116861787 14:50001326-50001348 GGCGGGGCGGGGCGGGGGCGGGG + Intronic
1118463906 14:66013736-66013758 GGCGCTGAGGGCGGGGGCGGCGG + Intergenic
1119325899 14:73759502-73759524 GCAGCTGCGGGCCGAGGGCGCGG + Intronic
1120188322 14:81417275-81417297 AGAGCTGGGGGCCGGGGGCGGGG - Intronic
1120521845 14:85533771-85533793 CCCGCAGCGGGCCGGGGCCGGGG - Intronic
1122108795 14:99480907-99480929 GCGGCTGCGGCCCGGGGGCGGGG - Intergenic
1122327298 14:100890445-100890467 GGGGCGGGGGGCCGGGGTGGGGG + Intergenic
1122822601 14:104354908-104354930 GGGGCTGGGGGCCGGGGGCAGGG + Intergenic
1122822626 14:104354950-104354972 GGGGCTGGGGGCCGGGGGCAGGG + Intergenic
1122917324 14:104865190-104865212 GGCGCGGCCGGGCGGGGGCGGGG + Intergenic
1122960950 14:105093419-105093441 GGCAGCGCGGGGCGGGGTCGGGG + Intergenic
1123023127 14:105411522-105411544 GGCGGGGCGGGGCGGGGACGGGG - Intronic
1123630772 15:22258276-22258298 GGCGCCGGGGGCCGCGGCCGGGG - Intergenic
1124249354 15:28096957-28096979 GGCGCCGCGGGGAGGGGTCCTGG - Intronic
1124387636 15:29223695-29223717 GGCGCTCCTGGCCAGGGTGGGGG + Intronic
1124458807 15:29870068-29870090 GGCGGTGGGGGGCGGGGTGGTGG - Intronic
1124628701 15:31325684-31325706 GGGGCCGCGGGCTGGGGTAGGGG + Intergenic
1124696817 15:31870525-31870547 GGCGCTGCGGGCTGGCGGAGCGG - Intronic
1127165825 15:56243955-56243977 GGCGCGACGGGCCGGGATGGGGG + Intergenic
1127342792 15:58065432-58065454 AGGGCTGCGGGACGGGGCCGGGG - Intronic
1128501420 15:68229731-68229753 GGGGCTGCGGACCCGGGGCGGGG + Exonic
1128999454 15:72320067-72320089 GGCGGGGCGGGCCCGGGCCGAGG + Exonic
1129150285 15:73684189-73684211 GGCGGGGCGGGGCGGGGGCGGGG + Intronic
1129386997 15:75201850-75201872 GGCGGGGCGGGCTGGGGGCGGGG - Intronic
1129423995 15:75451713-75451735 CCCTCTGCGGGGCGGGGTCGGGG - Intronic
1129697032 15:77746603-77746625 GGGGCTGGGGGCTGGGGGCGAGG + Intronic
1131054559 15:89367852-89367874 GGGGCTGCGGGCCTAGGTGGCGG + Intergenic
1131119712 15:89814729-89814751 GGGGCTGCGGGCGCGGGTAGGGG - Intronic
1131272606 15:90956360-90956382 GAAGCTGCGGGACGGGGTGGGGG + Intronic
1131515289 15:93072889-93072911 GGCACTGCCGGCCGGGCGCGCGG - Intronic
1131977610 15:97961356-97961378 GGCCCGGCGGGCCAGGGGCGGGG - Intronic
1132478520 16:154177-154199 GGCGGGGAGGGGCGGGGTCGCGG + Intronic
1132480573 16:164706-164728 GGCGGGGCGGGGCGGGGCCGCGG + Intronic
1132480588 16:164736-164758 GGGGCCGCGGGGCGGGGTCGCGG + Intronic
1132480601 16:164759-164781 GGCGGGGCGGGGTGGGGTCGCGG + Intronic
1132480610 16:164777-164799 CGCGGGGCGGGGCGGGGTCGCGG + Intronic
1132480685 16:164913-164935 GGGGTCGCGGGGCGGGGTCGCGG + Intronic
1132480706 16:164953-164975 GGCGGGGCGGGGTGGGGTCGCGG + Intronic
1132512982 16:353159-353181 GGCGGGGCGTGCCGGGGGCGCGG + Intergenic
1132560085 16:589631-589653 GGCGTTGTGGGCCGGGGGCGGGG + Intronic
1132663758 16:1072717-1072739 GGCGGGGCGGGGCGGGGGCGGGG - Intergenic
1132683574 16:1153336-1153358 GGCGCTGGGGGCCGGGGCCGGGG + Exonic
1132683593 16:1153370-1153392 GGCGCTGGGGGCCGGGGCCGGGG + Exonic
1132741344 16:1414783-1414805 GGGTCTGCGGGCTGGGGGCGGGG - Intergenic
1132741372 16:1414837-1414859 GGGTCTGCGGGCCGGGGGCGGGG - Intergenic
1132925808 16:2428777-2428799 GGGGATGCTGGCCGGGATCGTGG - Intergenic
1132934529 16:2473974-2473996 GGCGCGGGGGGCCGGGGGCCCGG + Exonic
1134645086 16:15858752-15858774 GGGGCTGGGGGCCGGGGGTGCGG + Intergenic
1134656101 16:15949593-15949615 GGCGCAGGGAGCCGGGGCCGGGG - Exonic
1135135827 16:19884927-19884949 GGCGGGGCCGGCCGGGGGCGGGG - Intronic
1135328526 16:21542972-21542994 GGCGCTGGGGGTGGGGGTGGGGG + Intergenic
1135976148 16:27109950-27109972 GGCGCGGCGGGGCGGGAGCGGGG - Intergenic
1136338873 16:29628945-29628967 GGCGCTGGGGGTGGGGGTGGGGG + Intergenic
1136356612 16:29748378-29748400 GGGGCTGCGGGCCACGCTCGAGG + Intergenic
1136779100 16:32885949-32885971 GCCGCCGCGGGCCCCGGTCGGGG - Intergenic
1138179234 16:54931050-54931072 GGCGCCGCGGGCCGGAGCCCCGG + Exonic
1139954293 16:70685932-70685954 CGCGCCGCGCTCCGGGGTCGCGG + Exonic
1140046208 16:71441899-71441921 GGGGCTGCGGGCCGATGGCGGGG + Intergenic
1141972272 16:87492297-87492319 GGCGCCGGGGGCCGCGGCCGGGG + Intergenic
1141989618 16:87602602-87602624 GGGGCCGCGGGCCGGGCGCGGGG - Intronic
1142291715 16:89196265-89196287 GGTGCTGGGGGCCGGGTTCCTGG - Exonic
1142291747 16:89196346-89196368 GGTGCTGGGGGCCGGGTTCCTGG - Intronic
1142291779 16:89196427-89196449 GGTGCTGGGGGCCGGGTTCCTGG - Intronic
1142305343 16:89281355-89281377 GGCGCTGCAGGACGGGGTCCTGG + Exonic
1142379165 16:89721862-89721884 GGCGTGGCGGGTTGGGGTCGCGG + Intronic
1142583219 17:954606-954628 GGCCCTGGGGCCTGGGGTCGTGG - Intronic
1142586776 17:979175-979197 GGGACTGGGGGCAGGGGTCGGGG + Intronic
1142592167 17:1011021-1011043 GGCTCTGTGGGTCGGGGTTGGGG + Intronic
1142670626 17:1485929-1485951 GGGTCCGCGGGCCGGGGGCGGGG + Intronic
1142696524 17:1636911-1636933 GGCGCTGGGGGCCGGGGTCTGGG - Intronic
1142811789 17:2399010-2399032 GCCGCGGCGGGCGGGGGTGGGGG - Intronic
1142848135 17:2691941-2691963 GGCGTGGCGGGGCGGGGGCGGGG - Intronic
1143188298 17:5023699-5023721 GGCTCTGGGGGCCGGGGCGGGGG + Exonic
1144185091 17:12789559-12789581 GGCGGAGCGGGCCGGTGCCGAGG + Exonic
1144342777 17:14324031-14324053 GGGGTTGGGGGCAGGGGTCGGGG - Intronic
1144647047 17:16982146-16982168 GGGGCTGGGGACCTGGGTCGGGG + Intergenic
1144682809 17:17206472-17206494 GGCGCTGCGTGACGGGGGCGTGG - Intronic
1144784404 17:17823731-17823753 GGGGCTGCGGGCCGGGCATGGGG + Intronic
1145056183 17:19705520-19705542 GGGGCTGCGGGCCGGACTCACGG - Intronic
1145190605 17:20840777-20840799 GGCCCTGGGGCCCGGGGGCGCGG + Intronic
1145874554 17:28307134-28307156 GGCGCTGCGTGCCGGCGGCTTGG - Intergenic
1146382590 17:32341933-32341955 CGGGCGGCGGGCCGGGGGCGGGG + Intronic
1146787422 17:35731937-35731959 GGGGGGTCGGGCCGGGGTCGGGG + Intronic
1147158953 17:38559699-38559721 GGTGCTGCTGGCCGAGGGCGGGG + Exonic
1147183622 17:38702272-38702294 GGAGCTGCGGGCTGCGGTCAGGG - Intergenic
1147232187 17:39027505-39027527 GCCGGTGGGGGCGGGGGTCGGGG - Intergenic
1147563325 17:41522048-41522070 GTGGCTGCGGGGCGGGGTCTGGG - Exonic
1147731854 17:42609192-42609214 GGCGCAGCGGGCCCTGGTGGAGG - Exonic
1147742979 17:42679259-42679281 GACGCTGAGGGCCTGGGTGGGGG - Exonic
1148440384 17:47708951-47708973 GGCGCTGCGGGCTGGGGGACTGG - Exonic
1148551922 17:48555673-48555695 GGCTTTGCGGGGCGGGGGCGGGG - Intronic
1149477825 17:56978052-56978074 GGGCCTGCGGGTCGGGGGCGGGG - Intergenic
1149491010 17:57085308-57085330 GGCGCTGCGGGCCGGGCCGCGGG + Intronic
1149616645 17:58006695-58006717 GGCGCTGAGGGCTGGTGTAGTGG - Intronic
1149997486 17:61412549-61412571 GGCGCTGCAGGCCAGGGCCCGGG + Exonic
1150217119 17:63476996-63477018 AGCGCGGCGGGGCGGGGGCGGGG + Intergenic
1150373672 17:64662383-64662405 GGCGGGGCGGGGCGGGGCCGGGG + Intergenic
1150398214 17:64837200-64837222 GGCACCGCGGGCCGGGGGCAGGG - Intergenic
1150643554 17:66964865-66964887 GGCGCGGCGGGCCGGGCCGGCGG + Intergenic
1150643746 17:66965629-66965651 GGCGGGGCCGGCCGGGGGCGGGG + Intronic
1151491127 17:74432707-74432729 GGCGCTGCGGCTCGGGCTGGAGG + Intronic
1151559172 17:74861556-74861578 GGCGCGGCGGGGCGGGGGCGGGG + Intergenic
1151745359 17:76008953-76008975 GCAGCTGCGGGCCGGCGTGGAGG - Exonic
1151780212 17:76240446-76240468 GGGGCTGCGGGTCTGGGCCGGGG + Intergenic
1151812530 17:76452967-76452989 GGCGCTGCGAGCCGGCTTCTGGG + Exonic
1152175143 17:78782312-78782334 GGCGCGGGGCGCCGGGGGCGGGG - Intergenic
1152468047 17:80476699-80476721 CGCGCCGCGGGCCCGGGCCGCGG - Intronic
1152468406 17:80477883-80477905 GGGGCGGCGGGGAGGGGTCGGGG - Intergenic
1152581124 17:81166045-81166067 GGCGGCTCGGGCCGGGGCCGCGG - Intronic
1152583237 17:81178297-81178319 GGGGCTGTCTGCCGGGGTCGGGG - Intergenic
1152627375 17:81393831-81393853 GGGGCTGCGGGCCGCGGGCGGGG - Intergenic
1152654323 17:81512958-81512980 GGCGGTGCGGGCTGGGGGCGGGG - Intronic
1152721912 17:81927537-81927559 GGCCCGGCGGGCCGAGGCCGGGG + Exonic
1152773844 17:82187688-82187710 GGGGGTGCTGGCGGGGGTCGGGG + Intronic
1152821595 17:82440303-82440325 GGCGCGGCGGCCCAGGGACGGGG + Intronic
1153480692 18:5543667-5543689 GGCGGAGCGGGCGGGGGGCGCGG + Intronic
1154125519 18:11689378-11689400 GGTGCGGCAGGCCGGGGCCGAGG - Exonic
1154270268 18:12912317-12912339 GGCTCTGCGGGCCCACGTCGAGG - Intronic
1156904936 18:42341185-42341207 GGAGCTGTGGTCAGGGGTCGGGG + Intergenic
1157353985 18:46917104-46917126 GGGGCGGCGGGCCTGGGCCGCGG - Intronic
1157753085 18:50195201-50195223 GGGCCTCCGGGCCGGGGGCGGGG + Intergenic
1159054434 18:63450378-63450400 GGGGCGGCTGGCCGGGCTCGGGG + Intergenic
1159586571 18:70288776-70288798 GGGGCGCCGGGCCGGGGTCGTGG - Intergenic
1159601185 18:70430321-70430343 TGGCATGCGGGCCGGGGTCGCGG + Intergenic
1160080760 18:75725220-75725242 GGCCCTGTGGGGCGGGGGCGGGG - Intergenic
1160204664 18:76822754-76822776 GGAGCGGCGGGGCGGGGGCGGGG + Intronic
1160500787 18:79400369-79400391 GGCGGGTCGGGCCGGGGCCGGGG - Intronic
1160592737 18:79952886-79952908 GGGGCAGGGGGCCGGGATCGTGG - Intergenic
1160631051 18:80246864-80246886 GGCTCTGGGGGCCCGGGCCGTGG - Intronic
1160810565 19:1011275-1011297 GGCGCTGGAGGCGGGGGTGGTGG - Intronic
1160861228 19:1237961-1237983 GGGGCGGCGGGCCGGGGACCGGG - Exonic
1160861847 19:1240470-1240492 GGAGCAGCGCGCCGGGGTCCGGG + Intergenic
1160897010 19:1407835-1407857 GGAGCGGCGGGCCGGGCTCGGGG - Intronic
1160991963 19:1863740-1863762 GGCGCGCCGGGCGGGGGGCGTGG - Intergenic
1160996710 19:1885361-1885383 GGCCCTGGGGCCCGGGGGCGCGG - Exonic
1161264864 19:3359515-3359537 GGTCCTGCGGGCCGGGGGGGCGG + Intergenic
1161265088 19:3360113-3360135 GGCGCGTGGGGCGGGGGTCGCGG + Intronic
1161308044 19:3578124-3578146 GGCGAGGCGGGGCGGGGCCGGGG + Intronic
1161333753 19:3700214-3700236 GGGGCTGCGGGGCCGGGGCGGGG - Intronic
1161412465 19:4124011-4124033 GGCGCTGCGGGCCTGGGCCGAGG + Exonic
1161809849 19:6465324-6465346 GGCTCTGCGGGACTGGGTCGGGG + Intronic
1161854220 19:6754301-6754323 GGCGCTGCGGCCAGGGGCGGCGG - Exonic
1161955040 19:7489029-7489051 GGCGCGGCGCGCCGACGTCGCGG - Intronic
1161973375 19:7596122-7596144 GGTGCTGCGGGCCGCGTTCGGGG + Exonic
1161973392 19:7596158-7596180 GGCTCGGGGGACCGGGGTCGGGG + Intronic
1162396454 19:10420443-10420465 GCCGCGGCGGGCGGGGGGCGGGG + Intronic
1162817864 19:13207361-13207383 GGCCCCGCGGGCCGGGCTCCAGG - Exonic
1162954308 19:14090003-14090025 CGCGGTGCGGGCCGGCGGCGCGG - Exonic
1163035487 19:14566720-14566742 GGTGTTGCGGGCCGGGGTGTTGG + Intronic
1163117109 19:15195580-15195602 TTCGCTGGGGGCCGGGGTGGGGG - Intronic
1163443674 19:17334377-17334399 GGTGCTTCGGGCTGGGGTCCCGG - Intronic
1163595947 19:18221072-18221094 GGCGGGGCGGGGCGGGGGCGGGG - Intronic
1163655517 19:18543152-18543174 GTCGTTGGGGGCCTGGGTCGCGG - Intronic
1163668263 19:18613102-18613124 AGGGCTGCGGGCCGAGGTCGCGG - Exonic
1163820143 19:19491857-19491879 GGGGCTGCGGGCTGGTGGCGAGG + Intronic
1163852009 19:19669374-19669396 GAAGCTGGGGGACGGGGTCGTGG - Intronic
1164159656 19:22618055-22618077 TGCGCTGCGGGCAGTGGTGGAGG + Intergenic
1164713513 19:30375553-30375575 TGCGCTGCGGCCCGGGGTGTGGG + Intronic
1165496001 19:36152189-36152211 GGGGCTTTGGGCCGGGGTGGGGG + Intronic
1165746014 19:38229725-38229747 AGCGGGGCGGGCCGGGGGCGGGG + Intergenic
1165878491 19:39026339-39026361 GGAGCTGCAGGCCAGGGTGGTGG - Intronic
1166083276 19:40458326-40458348 GGCGCTGGGGGCCGAGGTGTAGG + Intronic
1166298013 19:41898019-41898041 GGGGCTAAGGGCCGGGGTGGGGG + Intronic
1166514936 19:43439442-43439464 GGCGGCGGGGGCCGGGGTGGAGG - Intergenic
1167071741 19:47226162-47226184 GGCGCTGCGGGCCGCGCGAGAGG + Intronic
1167171999 19:47839586-47839608 GGCGCAGCGGGCTGGGCTGGTGG + Exonic
1167284100 19:48589123-48589145 GGCGGCGCTGGCCGGGGTCCAGG + Intronic
1167509915 19:49890606-49890628 GGCGGGGCGGGGCGGGGTGGGGG + Intronic
1167558496 19:50210569-50210591 GGCGCTGCGGGACGAAGGCGAGG + Exonic
1167569147 19:50276144-50276166 GGCGCTGCGGGGCGAGCTGGAGG + Exonic
1167614468 19:50524814-50524836 GGGGCTGCTGGCTGGGCTCGGGG - Intronic
1167648853 19:50719156-50719178 GGCTCTGCTGGCCGGGGGTGGGG + Intronic
1167748414 19:51366387-51366409 GGCGCGGGGGGCGGGGGTGGTGG - Intronic
925927629 2:8681771-8681793 GGAGCGGCGGGCGGGGGGCGGGG - Intronic
926141960 2:10373104-10373126 AGAGCTGCGAGCCGGGGCCGGGG + Intronic
926155024 2:10448685-10448707 GCTGCCGCGGGCCGGGGCCGGGG - Intergenic
926272160 2:11374974-11374996 GGCCCTGAGAGCCGGGGTAGGGG - Intergenic
926914339 2:17878501-17878523 GGCGCCCCGGGCCGAGGGCGCGG - Intronic
927156685 2:20224911-20224933 GCGGCTGCGGGCCGGCTTCGCGG + Exonic
927937913 2:27085889-27085911 GCCGCTGCAGGCCGGGGACACGG + Exonic
927956768 2:27212305-27212327 CGCGCTGCGGGGCGGGGCCGCGG + Exonic
928186427 2:29115305-29115327 GACGCTGTCAGCCGGGGTCGCGG + Intronic
928515330 2:32039568-32039590 GGGGGTGAGGGGCGGGGTCGGGG - Intronic
929494171 2:42425045-42425067 GGCGCTGCGGGCCTGCTTCCTGG + Intronic
929775386 2:44928354-44928376 GGAGCGGCGGCCGGGGGTCGGGG - Intergenic
930700838 2:54456702-54456724 GGCGCGGGGAGCCCGGGTCGCGG + Intronic
932725751 2:74178612-74178634 GGGCCTGCGGGCCGAGGTTGTGG - Intronic
933354742 2:81197078-81197100 GGTGCTGCAGGACGGGGTCCTGG + Intergenic
933728182 2:85437979-85438001 GGGGCTGGGGGCGGGGGGCGGGG + Intergenic
933791711 2:85888700-85888722 GGCGCTGCCCGCGGGGTTCGAGG + Intronic
934746190 2:96761092-96761114 GGCGCTGGGGGCCCGGGGCCAGG + Exonic
935904642 2:107828408-107828430 GCCGCCGCGGGGCCGGGTCGAGG - Intronic
935904769 2:107828908-107828930 GCCGCCGCGGGGCCGGGTCGAGG - Intronic
936203118 2:110424968-110424990 GTCGCTGCCGGCTGGGGTGGTGG - Intronic
937018932 2:118633074-118633096 GGCGGGGCGGGGCGGGGGCGGGG - Intergenic
938639786 2:133266532-133266554 GCTGCTGCGGGCTGGGGGCGGGG + Intronic
939612925 2:144332279-144332301 GGCGCGGGGAGCCGGGGGCGGGG - Intronic
940954375 2:159712228-159712250 GGCGCTGGAGGCCCGGGCCGGGG - Intergenic
941029111 2:160492739-160492761 GGCGCTCAGGGCCGGAGGCGGGG + Intronic
941929969 2:170929427-170929449 GGAGCTGCGGGCTGGAGGCGGGG + Intronic
942444152 2:176067210-176067232 GGCGCTGCTGGCCTCGTTCGCGG + Intergenic
945033604 2:205686040-205686062 GGCGCTGGGGGGCGGGGAAGGGG - Intronic
945102565 2:206275138-206275160 GCGGCTCCGGGCCGGGATCGAGG + Intronic
945251084 2:207767254-207767276 CGCGCGGCTGGCCGGTGTCGTGG + Exonic
946747481 2:222860882-222860904 GGCGCTGGCGGCCCGGGGCGGGG - Intergenic
946865676 2:224039355-224039377 GGCAAGGCGGGCCGGGGGCGGGG - Intergenic
948140764 2:235670449-235670471 GGCGCTGCCGGCCAGGTCCGCGG - Intronic
948209241 2:236179785-236179807 GGCGCTGCGGGTAGGGGGAGCGG + Intergenic
949039787 2:241842921-241842943 GACGGTGGGGCCCGGGGTCGGGG - Intergenic
949079864 2:242088460-242088482 GGCGCGGGGGGGCGGGGGCGGGG - Intergenic
1168804324 20:663597-663619 GGCGCTGCGGGCGCAGGTAGGGG + Exonic
1169367269 20:5001516-5001538 GGAGGGGCGGGCCGGGGGCGGGG + Intronic
1171447758 20:25216816-25216838 GGTGCTGCGGGGTGGGGTGGGGG + Intronic
1172293362 20:33791445-33791467 GGAGCTGCAGGCTGGGGCCGAGG + Exonic
1172320892 20:33994331-33994353 GGCGCGGAGGGCTGGGGCCGGGG - Intronic
1172528664 20:35616360-35616382 GGCGGTGCTGGGCGGGGACGGGG + Intronic
1172596612 20:36154797-36154819 GGCGGGGCGGCGCGGGGTCGCGG - Exonic
1172639541 20:36432516-36432538 GGGGGTGCGGGCGGGGGTGGTGG - Exonic
1174134848 20:48372487-48372509 GGGGCTGGGGGGCGGGGGCGAGG - Intergenic
1174843520 20:53921522-53921544 GGAGCTGGGGGGTGGGGTCGGGG + Intergenic
1175047652 20:56122451-56122473 GGCGCTGGGGGTGGGGGTCGGGG - Intergenic
1175280946 20:57803763-57803785 GGCGCTGCCTGCCGGGGTTGGGG - Intergenic
1175517302 20:59577625-59577647 CGCGCTGCGGGGAGGGGACGCGG + Intronic
1175831525 20:61967515-61967537 GGTGCTGAGGGGCGGGGTGGGGG - Intronic
1175944718 20:62553358-62553380 GACGCTGCGAGGCGGGGACGGGG + Intronic
1176030049 20:63007378-63007400 GCCGCTTCGGGTCGGGGTCAGGG + Intergenic
1176030335 20:63008464-63008486 GTGGCCACGGGCCGGGGTCGGGG + Intergenic
1176143211 20:63554093-63554115 GACGCTGCGGCCCGGGGGCGGGG - Exonic
1176233328 20:64042738-64042760 CGCGCTGGCGGGCGGGGTCGTGG + Intronic
1176281587 20:64316644-64316666 GGCGCTCCGCGCGGGGGTTGGGG + Intergenic
1178951582 21:36990126-36990148 GGCGCTGCGGGCCGGGACAGGGG - Intronic
1179156528 21:38856482-38856504 GGTGGTGAGGGCCGGGGTGGAGG - Intergenic
1179533816 21:42038632-42038654 GGGGCTGAGGGCAGGGGCCGGGG - Intergenic
1179675038 21:42975105-42975127 CGCGCGGCGGGGCGGGGCCGGGG + Intronic
1179988050 21:44932136-44932158 GGCGGTGGGGGTCTGGGTCGGGG - Intergenic
1179988371 21:44933102-44933124 GGCGCTGCTAGCCAGGGGCGGGG + Intronic
1180064374 21:45405250-45405272 GGGGCTGCGGGCAGGGGTTGGGG + Intronic
1180099096 21:45576076-45576098 GGCCCAGGGGGCCGGGGTGGAGG - Intergenic
1180782602 22:18529356-18529378 GGCACTGAGGGCCGGGGGCGGGG + Intronic
1180796120 22:18606628-18606650 GGCGCTGAGGGCAGGAGACGTGG - Exonic
1181024009 22:20117483-20117505 GCCGCTGGGGTCAGGGGTCGAGG + Intronic
1181121678 22:20671213-20671235 GGCCCTGGGGCCCGGGGGCGCGG - Intergenic
1181126159 22:20703383-20703405 GGCACTGAGGGCCGGGGGCGGGG + Intergenic
1181225602 22:21388643-21388665 GGCGCTGAGGGCAGGAGACGTGG + Exonic
1181239492 22:21468694-21468716 GGCACTGAGGGCCGGGGGCGGGG + Intergenic
1181253032 22:21546170-21546192 GGCGCTGAGGGCAGGAGACGTGG - Exonic
1181281822 22:21726086-21726108 GTCTCTGCGGGCAGGGGCCGTGG + Intronic
1181334646 22:22118253-22118275 GGCCCTGGGGCCCGGGGGCGCGG - Intergenic
1181813709 22:25421138-25421160 GGCGCGGCGGGCGGCGGCCGCGG + Intergenic
1181934475 22:26429186-26429208 GGGCCTGCGGGGCGGGGCCGGGG - Intergenic
1182603907 22:31489311-31489333 GGGGCTGCGGGTTGGGGTCGCGG - Intronic
1182904017 22:33920928-33920950 GGCGCTGGGGTCCGGGCTCCGGG + Intronic
1183270091 22:36856520-36856542 GGCGCTGCGGAGCGGGGACTCGG + Intergenic
1183589004 22:38769249-38769271 GGAGGTGAGGGCCTGGGTCGGGG - Intronic
1183720134 22:39557777-39557799 GGCGCTCCGGGCCGGGGCGGGGG - Intergenic
1184034050 22:41910243-41910265 GCCGGGGCGGGCCGGGGGCGGGG + Intronic
1184086839 22:42270476-42270498 GGCGGGGCGGGCCGGGGCCGCGG + Intronic
1184101599 22:42344000-42344022 GGCGCGCCGGGCTGGGGTAGGGG + Intergenic
1184663523 22:45976278-45976300 GGTGCGCCGGGGCGGGGTCGGGG - Intronic
1185037927 22:48489446-48489468 GGCGCGGTGGGCCGGGGCCCGGG + Exonic
1185055245 22:48575827-48575849 GGGGCTGCGCGCCGGGCGCGGGG - Intronic
1185055256 22:48575852-48575874 GCCGCGGCGGGCCAGGCTCGGGG - Intronic
1185259499 22:49853793-49853815 GGCGGGGCTGGCCGGGGGCGGGG - Intergenic
1185317721 22:50186096-50186118 GGGGGTGGGGGCCGGGGGCGGGG + Intronic
1185368316 22:50446981-50447003 GGCGGGGCGGGGCGGGGACGGGG + Exonic
1185374159 22:50474595-50474617 GGCGCTGAGGGCCGGGGTCGGGG - Intronic
1185374173 22:50474623-50474645 GGCGCTGAGGGCCGAGGACCGGG - Intronic
1185417999 22:50720549-50720571 GTGGCCGCGGGCGGGGGTCGAGG - Intergenic
950345410 3:12288089-12288111 GGCGCGGAGGGCTGGGGCCGAGG + Intronic
950400954 3:12768900-12768922 GGCAGGGCGGGCCGGGGCCGGGG + Intronic
950487703 3:13282748-13282770 GCGGCTGCGGGCCGGGGCCGGGG + Intergenic
950518716 3:13483585-13483607 GGGGCTGCGGGCCTGGGGCAGGG + Intronic
950940382 3:16885089-16885111 GGCGCCGAGGGCCGGGCCCGGGG - Intronic
951140128 3:19148484-19148506 GGAGGTGCGGGGCGGGCTCGGGG + Exonic
952816626 3:37452578-37452600 GGCCGCGCGGGCCAGGGTCGCGG - Intronic
953404653 3:42654465-42654487 GGCGCGGCGGGCGGGGGGCGCGG - Intronic
954384244 3:50236147-50236169 GGCGGGGCGGGCCGGGGGTGGGG - Exonic
954540742 3:51391664-51391686 GGCGCTGGCGGCGGGGGACGCGG + Exonic
954796074 3:53161867-53161889 GGGGCGGCGGGCGGGGGTAGGGG - Intronic
955356589 3:58237465-58237487 GGCGGGGCGGGGCGGGGGCGGGG + Intergenic
956596522 3:70973234-70973256 GGCGGGGCGGGGCGGGGGCGGGG - Intronic
956813619 3:72888347-72888369 GGCGCTGCGGGGCGGACGCGGGG - Exonic
959398371 3:105869050-105869072 GGCGGGGCGGGGCGGGGGCGGGG + Intronic
962247269 3:133806064-133806086 ACCGCTGCAGGCCGGGGACGCGG + Intronic
966743391 3:183254067-183254089 GGCGCGGCGGGGCGGGGGCGGGG - Intronic
966912911 3:184569270-184569292 CGCGCTGCCGGCTGGGGACGAGG + Intronic
967859717 3:194141658-194141680 GGCGCTGGGGCCCGGGGCGGGGG - Intergenic
968040472 3:195584708-195584730 GGGGGTGGGGGCCGGGGTGGTGG + Intergenic
968574042 4:1356737-1356759 GGGGCTGCCGGCTGGGGTCACGG + Intronic
968653055 4:1767529-1767551 GGCGCCGAGGGCTGGGGTCCCGG + Intergenic
968653182 4:1767918-1767940 GGCGGGGTGGGCCGGGGTGGGGG - Intergenic
968729152 4:2261621-2261643 GGCGCTGAGGGCCGCGGGCCGGG + Intronic
968879895 4:3293308-3293330 GGCGGGGCGGGGCGGGGGCGGGG + Intronic
968981523 4:3852566-3852588 GGCGGGGCGGGGCGGGGTGGGGG - Intergenic
969112153 4:4850991-4851013 GGCTCTGCGGGAGGGGGTGGGGG - Intergenic
969248882 4:5954351-5954373 AGGGCTGAGGGCAGGGGTCGGGG - Intronic
969413369 4:7043516-7043538 GGCGCTGACGGCCGGGGGCGCGG + Exonic
969690361 4:8700857-8700879 GGCGCTGCCGGGAGGGGTCCTGG + Intergenic
969691414 4:8706121-8706143 GGGACTGAGGGCCGGGGTAGAGG - Intergenic
969912186 4:10457147-10457169 CGCGCTGAGGGCTGGCGTCGTGG - Intronic
976002098 4:80386228-80386250 GGGGCTGCAGGCCGGGGCCGAGG - Intronic
976431364 4:84966345-84966367 CGCGCCGCGGGCCGGGGGCCGGG + Exonic
979829325 4:125280970-125280992 GGGGCTGCGCGCCAGGCTCGCGG + Intergenic
980075218 4:128287535-128287557 GGGTCTGGGGGCCGGGGCCGGGG - Exonic
982257586 4:153466078-153466100 CGCGCTGCGGGGCGGGCCCGCGG + Intergenic
984762649 4:183376483-183376505 GGGGCGGGGAGCCGGGGTCGGGG - Intergenic
985580428 5:693074-693096 GGCGCTGCGGGCTCGGTGCGAGG - Intronic
985595090 5:784464-784486 GGCGCTGCGGGCTCGGTGCGAGG - Intergenic
986330721 5:6714253-6714275 GGCGCTGGGGCCCGCGGCCGAGG + Intergenic
986540592 5:8840472-8840494 GGCGCTGCGCGCGGCGCTCGCGG + Intergenic
989379341 5:40798190-40798212 GGCGCTGCGGGAGGGGGCGGAGG + Exonic
991371569 5:65925588-65925610 GGGGCAGCGGGCCGGGGGCCGGG - Intergenic
991769266 5:70025513-70025535 GGCGCGGCGGGCGGGGGAGGCGG + Intronic
991848561 5:70900931-70900953 GGCGCGGCGGGCGGGGGAGGCGG + Intronic
992529408 5:77640527-77640549 GGGACTGGGCGCCGGGGTCGTGG + Intergenic
992530252 5:77645763-77645785 GGCGGAGCGGGCCGGGCTGGCGG - Intergenic
995462631 5:112419557-112419579 GGGGCTGCGGGGCGGGGTCGCGG - Intergenic
998142734 5:139709341-139709363 GGCGCGGCGTGGCGGGGGCGGGG + Intergenic
998142782 5:139709519-139709541 GGCGCTGAGGGGAGGGGTTGTGG + Intergenic
998903718 5:146881050-146881072 GGAGCTGGGGGGCGGGGTGGGGG + Intronic
999188512 5:149730433-149730455 GGGGCTGCGGGCCCGGGGCCAGG + Intronic
1000296404 5:159916624-159916646 GGCGCGCCTGGCCGGGCTCGCGG - Intergenic
1000305073 5:159987322-159987344 GGCTCAGCGGGCCGGCGCCGCGG + Intergenic
1001529969 5:172454637-172454659 CGCGCGGTGGGCGGGGGTCGGGG - Intergenic
1002006539 5:176238777-176238799 AGCGCGGCGGGCCGGGGCAGGGG + Intronic
1002219839 5:177671859-177671881 AGCGCGGCGGGCCGGGGCAGGGG - Intergenic
1002400067 5:178986673-178986695 TGCCCTGCGGGCCGGGGGAGCGG - Exonic
1002401696 5:178994772-178994794 GGCGCGGCGGGCCGGGCGTGCGG - Exonic
1002719078 5:181246970-181246992 TGCGCTCTGGGCCGGGGCCGGGG + Intronic
1003345203 6:5260614-5260636 GGCACCGGGGGCCGGGGGCGGGG - Intronic
1003872901 6:10415782-10415804 GGCGCTGCGGCCCGAGGGGGTGG - Intronic
1003911496 6:10747777-10747799 CGCGCTGCGCCCCGGGGCCGCGG - Exonic
1004627874 6:17393771-17393793 GGCGAGGCGGGGAGGGGTCGGGG + Intronic
1005912965 6:30326903-30326925 CGCGCCGCGGGGCGGGGGCGAGG + Exonic
1005965099 6:30721416-30721438 GGCCCTGCGGGGCGGGGCCGGGG + Intronic
1005968711 6:30744450-30744472 GGTGGAGGGGGCCGGGGTCGGGG + Exonic
1006155046 6:32009364-32009386 GGACCTGCGGGCTGGGGACGAGG - Intergenic
1006161357 6:32042099-32042121 GGACCTGCGGGCTGGGGACGAGG - Exonic
1006313432 6:33277240-33277262 GCAGCTGCGGACCGCGGTCGAGG - Exonic
1006797814 6:36742335-36742357 GGTGCTGCGGGTGGGGGACGCGG + Exonic
1006814253 6:36839822-36839844 GGCGCTGGCGGCGGGGGTGGCGG + Exonic
1006829033 6:36957905-36957927 GGCGCTGGGGGCCAGGGTCAGGG - Intronic
1007111131 6:39314036-39314058 GGCGCGGCGGGATGGGGTAGCGG - Intronic
1007431467 6:41779784-41779806 GGCGCGGCGGGGCGGGGACGAGG - Intronic
1007448003 6:41921643-41921665 TGCGGTGCGGGCGGGGGTCCGGG + Exonic
1007521292 6:42453040-42453062 GGCGCAGCAGGCCGGGGAGGGGG + Intergenic
1007625424 6:43243718-43243740 GGCGGGGCGGGCCGGGGTCGGGG + Intronic
1007902270 6:45422976-45422998 GCCGCTCCCGGCCGGGGGCGGGG - Intronic
1007927739 6:45663549-45663571 GCAGCGGCGGGCCGGGCTCGGGG - Intronic
1011518554 6:88179548-88179570 TGCGTTGCGGGCCGGGGGCGGGG - Intergenic
1013220694 6:108074781-108074803 GGCGCCGCGCGCAGGGGGCGGGG - Intronic
1013459067 6:110358138-110358160 GGCGCTGCGGGTGGGGGACCCGG + Exonic
1015880664 6:137867417-137867439 CGCGCCGCAGGCGGGGGTCGGGG - Exonic
1016340905 6:143060794-143060816 GGCGGGGCGGGGCGGGGGCGGGG - Intronic
1016937251 6:149456605-149456627 GGGGCGGGGGGCCGGGGTCGAGG - Intronic
1017103203 6:150866095-150866117 GGCGCTCCGCCCCTGGGTCGGGG - Intronic
1017842239 6:158231906-158231928 CGCGGTGCGGGCCGGGGGCGGGG + Intergenic
1017842428 6:158232437-158232459 GGCGCGGCGGGCGGGGGTCGGGG + Intronic
1018013605 6:159693346-159693368 GGCGCGGCGGGCGCGGGGCGGGG - Intronic
1018282287 6:162199895-162199917 GGAGCTGTGGGCCAGGGTCAAGG - Intronic
1018757497 6:166862760-166862782 GGCGCGGCGGGCTGGGGAGGTGG - Intronic
1019112002 6:169724184-169724206 GGGGCTGCGGGCCGGAATGGAGG + Intronic
1019379266 7:712617-712639 GGGGGTGGGGGCCGGGGTTGGGG - Intronic
1019473392 7:1232958-1232980 GGGGGCGCGGGCCGGGGCCGGGG - Exonic
1020284847 7:6671456-6671478 GGGGCGGCTGGCCGGGGGCGGGG + Intergenic
1020727289 7:11831885-11831907 GGCGCTGCGGGGCCGCGCCGGGG - Exonic
1021365563 7:19773523-19773545 GTTGCTGCGGTCCGGGGGCGGGG - Intronic
1021450339 7:20778274-20778296 GGAGCGGCGGGCCCGGGCCGGGG + Intergenic
1021510494 7:21427985-21428007 GGCGGCGCGGGTCGGGGGCGGGG - Intergenic
1022207548 7:28179647-28179669 GGCGCTGCGGGCTGAGGTCTTGG - Intronic
1022396245 7:29989873-29989895 GGCCCCGGGGGCCGGGGTGGGGG - Intronic
1023000310 7:35801404-35801426 GCCACTGCGGGCCCGGGGCGCGG + Intronic
1023169337 7:37375493-37375515 GGCTCTGGGGTCCGGGGCCGGGG - Intronic
1023287035 7:38631159-38631181 CGCGCTGCGGAGCGGGGCCGGGG - Intronic
1023638789 7:42237901-42237923 CGCGTCGCGGGCCGGGGTCGGGG + Intergenic
1023805454 7:43869607-43869629 GCCTCTGCGGGGCGGGGCCGCGG + Intronic
1023888952 7:44379369-44379391 GGCGGGGCGGGGCGGGGTGGGGG + Exonic
1024305169 7:47922762-47922784 GGGGCGGCTGGCCGGGGTGGGGG - Intronic
1027218895 7:76201824-76201846 GGCGCTGCGGGCGCGGGGCTGGG + Intergenic
1027592542 7:80134707-80134729 GGCGCCGGGGTCCGGGGCCGGGG + Intronic
1029449503 7:100633057-100633079 GGACCTGCGGGCCAGGGGCGTGG - Exonic
1029461080 7:100694149-100694171 CGCGCGGCGGGCGGGGGCCGGGG + Intergenic
1029543085 7:101196071-101196093 GGCGCTGGGGGACGGGGATGGGG + Exonic
1029549981 7:101232512-101232534 GGCGCTGCGGGGAGGGCCCGGGG + Exonic
1030055840 7:105583160-105583182 GGCGCTGAGGGCGGGGGCGGCGG + Intronic
1031361802 7:120857322-120857344 CGAGCTGCGGGACGGGGTAGAGG - Intronic
1031361825 7:120857364-120857386 GGGGCGGCGGGGCGGGGGCGGGG + Intronic
1032020715 7:128405977-128405999 GGCCGGGCGGGCCGGGGGCGGGG + Intronic
1032117015 7:129126360-129126382 GGCGCTGCGGGCCTGGTCCGAGG - Intergenic
1032274242 7:130440771-130440793 GGCGGGGCGGGCCGGGCTTGGGG - Intronic
1032697864 7:134353348-134353370 GGCGCTGGGGGCAGGGGTTTAGG - Intergenic
1034228035 7:149497860-149497882 GGCGGGGCGGGGCGGGGCCGCGG - Intergenic
1034234237 7:149554932-149554954 GGGGCGGCTGGCCGGGCTCGGGG - Intergenic
1034475105 7:151277085-151277107 CGCGCTCCGGGCCGGGGTCCCGG - Intronic
1034931725 7:155168486-155168508 GGGGTTGGGGGCCGGGGGCGGGG - Intergenic
1035127144 7:156616785-156616807 GGCGCAGGGGCGCGGGGTCGGGG - Intergenic
1035223094 7:157418397-157418419 CGCCTTGCGGGCCGGGGTCGGGG + Intergenic
1035359412 7:158300566-158300588 GGCGCTGCGGGACTGGGTGGCGG - Intronic
1035593469 8:836183-836205 GCAGCTGCGGGCCGGGGACTCGG + Intergenic
1036578814 8:10054364-10054386 GGCGCTGCTGGCGGGGCTGGAGG - Exonic
1036708077 8:11059735-11059757 GGAGCCGCGGGGCGGGGTCCGGG - Intronic
1036899246 8:12659095-12659117 GGCGCGGGGGTCCGGGGGCGCGG - Intergenic
1037273806 8:17156731-17156753 GGCGCTGCTGCCCGGGCCCGAGG - Exonic
1037879432 8:22565775-22565797 GCCGCTGGGTCCCGGGGTCGCGG + Intronic
1038205051 8:25458158-25458180 GGCGCGGCGGGCCGGGGGTCGGG - Intronic
1038828713 8:31033715-31033737 GGCGAGCCGGGCCGGGGGCGGGG + Exonic
1039554778 8:38468051-38468073 GGGGCGGCGGGCCGGAGCCGGGG - Intronic
1040389835 8:46940489-46940511 GGTGCTGGGGGCTGGGGTGGAGG + Intergenic
1040850727 8:51898736-51898758 GGCGCTGCGGGGCAGGTTGGGGG - Intronic
1041066278 8:54085774-54085796 GGGGCGGCTGGCCGGGGTGGGGG - Intronic
1041167135 8:55101909-55101931 GGAGCGGCGGGCGGGGGTTGGGG - Intergenic
1041690015 8:60679144-60679166 ATCGCTCCGGGCCGGGGCCGGGG + Intronic
1042235866 8:66613025-66613047 GGCGCTGCGGGCCGGGGTCGGGG - Exonic
1042859037 8:73295001-73295023 GGCGCTGCGGGACGGGCGGGCGG + Exonic
1043037984 8:75222199-75222221 GGCGGTGCGGGGTGGGGTGGGGG + Intergenic
1045277581 8:100721649-100721671 GGGGCTGGGGGCCGGAGCCGGGG + Exonic
1045305013 8:100951315-100951337 GGCGCGGCGGGGAGGGGCCGGGG - Intronic
1045336267 8:101206179-101206201 CTCGCTGGGGGCCGGGGCCGCGG - Intronic
1045489100 8:102655760-102655782 CGCGCCGCGGGCGGGGGTGGGGG + Exonic
1047182625 8:122604092-122604114 AGCGCTGGGGGCCGGGGTCAGGG - Intergenic
1049419567 8:142510812-142510834 GGGGCGGCGGGCCGGGGCCGGGG + Intronic
1049442132 8:142614384-142614406 GTCGCTGCGGGCCGGCGGCGGGG + Exonic
1049658960 8:143811255-143811277 GGCGCTGCCGCCCGAGATCGGGG - Exonic
1049732442 8:144185623-144185645 GGCGGTGAGGGCCGGGGGGGGGG + Intronic
1049746896 8:144266784-144266806 GGGCCGGCGGGCCGGGGGCGGGG + Exonic
1049749705 8:144277387-144277409 GGGGCTTGGGGCCGGGGTCACGG - Intronic
1049801101 8:144517872-144517894 TGCGCGGCGGGCCGGGGGCGGGG + Intergenic
1049803974 8:144530637-144530659 GGCGCGGAGGGGCGGGGGCGGGG + Intronic
1050113827 9:2242676-2242698 GGAGGTGCGGGCGGGGGTCAGGG - Intergenic
1050351088 9:4741512-4741534 GGCGCGGGGTTCCGGGGTCGCGG - Intronic
1051697913 9:19788920-19788942 GGAGCGGCGGGCCGCGCTCGGGG - Intergenic
1052362250 9:27573531-27573553 CGCGCTAGGGGCCGGGGCCGGGG - Intronic
1053230079 9:36400847-36400869 GGTGTTGCGGGACGGGGCCGAGG - Intronic
1055254297 9:74348939-74348961 GTTGCTTGGGGCCGGGGTCGAGG - Intergenic
1057716839 9:97502118-97502140 GGCGCCCCGGGCTGGGGTCCTGG + Intronic
1057882999 9:98807593-98807615 GGTGGGGCGGGCCGGGGGCGGGG + Intergenic
1058005142 9:99906581-99906603 GGCCCTGCGGGGCGGGGGCGGGG + Intergenic
1058058545 9:100473229-100473251 CGCGCGGCGGGCGGGGGTCGCGG - Exonic
1058170848 9:101679463-101679485 GTCACTGCGGGGCGGGGTCGGGG - Intronic
1058431701 9:104926616-104926638 GGCGCTGCGGGCCAGTCTCCGGG + Intronic
1058908069 9:109497832-109497854 GGAGCCCCGAGCCGGGGTCGCGG + Intronic
1059375237 9:113876178-113876200 GCCGGTGCGGGCCGGGGGTGGGG + Intergenic
1059492630 9:114681820-114681842 GGCGCTGCGGGCGGGGGTGGGGG + Intergenic
1060479125 9:124007828-124007850 GGTGCTGGGGACTGGGGTCGGGG - Intronic
1060742465 9:126108585-126108607 GGGGCGGCGGGGCGGGGTGGGGG - Intergenic
1060996344 9:127876647-127876669 GGCGGGGCAGGGCGGGGTCGAGG - Intronic
1061248424 9:129413387-129413409 GCCGCGGCGGGCGGGGGCCGGGG - Intergenic
1061275845 9:129569075-129569097 GGGGCTGCGCGCCGGGCTGGGGG - Intergenic
1061453402 9:130681150-130681172 GGCGCTGAGGGCCCGGGCTGCGG + Intronic
1061727634 9:132590155-132590177 GAGGCTGGGGGCTGGGGTCGGGG - Exonic
1061828487 9:133275707-133275729 GGGGCCGCGAGCCGGGGCCGGGG - Intergenic
1061898088 9:133658839-133658861 GGAGCAGCGGGGCGGGGGCGGGG - Exonic
1061919031 9:133772145-133772167 GGCCCTGGGGGCCAGGGACGAGG - Intronic
1061996606 9:134189329-134189351 GGCGCTGCAGTGCGGGGTGGAGG + Intergenic
1062341276 9:136094918-136094940 GGCGTCCCGGCCCGGGGTCGCGG + Intronic
1062412093 9:136430753-136430775 GGCTCTGCAGGCCGGAGGCGAGG + Intronic
1062454295 9:136628512-136628534 GGGGCTGCGGGCGGGGCGCGTGG + Intergenic
1062461917 9:136665832-136665854 AGCGGGGCGCGCCGGGGTCGGGG + Intronic
1062499531 9:136846309-136846331 GGCGCTGCCGGCCGAGGCGGGGG - Exonic
1062556093 9:137114085-137114107 GGGGTCGCGGGCGGGGGTCGCGG - Intronic
1062556110 9:137114126-137114148 GGGGTCGCGGGCGGGGGTCGCGG - Intronic
1062556127 9:137114167-137114189 GGGGTCGCGGGCGGGGGTCGCGG - Intronic
1062574552 9:137200191-137200213 GGGGCCGCGGGCGGGGGCCGGGG + Exonic
1062579363 9:137222600-137222622 GGGGCGGGGGGCCGGGGACGGGG - Intergenic
1203780238 EBV:96634-96656 GGAGGTGGAGGCCGGGGTCGAGG + Intergenic
1203780246 EBV:96658-96680 GGCAGTGGAGGCCGGGGTCGAGG + Intergenic
1185779220 X:2830159-2830181 GGCGCCGCGGGCAGTGGGCGCGG - Exonic
1186426172 X:9465460-9465482 GGCTCGGCGGGCCGGGCGCGGGG + Intronic
1186463428 X:9765921-9765943 GGCGCTGGGGGTTGGGGTGGGGG - Exonic
1186973038 X:14870434-14870456 GGCGGTGCGGGGCAGGGTGGCGG + Intronic
1187172999 X:16869999-16870021 GGCGGCGCGCGCCGGGGCCGCGG - Intronic
1187181466 X:16947000-16947022 GGCGCCGCGGGCGGGGGCCCCGG + Exonic
1187768182 X:22666510-22666532 GGCGGGGCGGGGCGGGGGCGGGG - Intergenic
1188004138 X:25005690-25005712 TGCGCCGCGCGCCAGGGTCGTGG - Intronic
1188005710 X:25014442-25014464 ACCGCTGCGGGGCGGGGTGGGGG + Intronic
1189323014 X:40097537-40097559 GGCGGGGCGGGGCGGGCTCGGGG + Intronic
1189659344 X:43279770-43279792 GGCCGGGCGGGCCGGGGGCGGGG + Intergenic
1190870816 X:54423281-54423303 GGCGGTGGGGTCAGGGGTCGGGG + Intergenic
1192212608 X:69137306-69137328 GGAGCTGCGGGCCCGGGCAGCGG - Intergenic
1193221770 X:78934979-78935001 GGGGCTGCGGGAGGGGGTTGGGG + Intergenic
1196443299 X:115732817-115732839 GCCGCTGCTGGCCGGCGCCGGGG + Intergenic
1196444223 X:115737120-115737142 GCCGCTGCTGGCCGGCGCCGGGG - Intergenic
1196445620 X:115844732-115844754 GCCGCTGCTGGCCGGCGCCGGGG + Intergenic
1196446291 X:115847713-115847735 GCCGCTGCTGGCCGGCGCCGGGG + Intergenic
1196446962 X:115850694-115850716 GCCGCTGCTGGCCGGCGCCGGGG + Intergenic
1196447631 X:115853677-115853699 GCCGCTGCTGGCCGGCGCCGGGG + Intergenic
1196448301 X:115856656-115856678 GCCGCTGCTGGCCGGCGCCGGGG + Intergenic
1196448970 X:115859647-115859669 GCCGCTGCTGGCCGGCGCCGGGG + Intergenic
1196449641 X:115862638-115862660 GCCGCTGCTGGCCGGCGCCGGGG + Intergenic
1196450310 X:115865621-115865643 GCCGCTGCTGGCCGGCGCCGGGG + Intergenic
1196450980 X:115868606-115868628 GCCGCTGCTGGCCGGCGCCGGGG + Intergenic
1196451651 X:115871585-115871607 GCCGCTGCTGGCCGGCGCCGGGG + Intergenic
1196452322 X:115874572-115874594 GCCGCTGCTGGCCGGCGCCGGGG + Intergenic
1196452992 X:115877541-115877563 GCCGCTGCTGGCCGGCGCCGGGG + Intergenic
1196453662 X:115880534-115880556 GCCGCTGCTGGCCGGCGCCGGGG + Intergenic
1196454331 X:115883543-115883565 GCCGCTGCTGGCCGGCGCCGGGG + Intergenic
1196455411 X:115888615-115888637 GCCGCTGCTGGCCGGCGCCGGGG + Intergenic
1198871016 X:141177141-141177163 GGCGGTGTGCGCCGGGGTCCGGG + Intergenic
1198963716 X:142207130-142207152 GGGGCTGAGGGCTGGGGTTGGGG - Intergenic
1199600795 X:149540162-149540184 GGGGCTGCGGGCGGGGCTCGGGG - Intergenic
1199772721 X:150984329-150984351 GGCGGGGCGGGGCGGGGTGGGGG + Intronic
1200003257 X:153072698-153072720 GGGGCAGCGGTCCGGGGTCCGGG + Intronic
1200004466 X:153077311-153077333 GGGGCAGCGGTCCGGGGTCCGGG - Intergenic
1200068895 X:153518168-153518190 GGGGCTGCGGGCCGGGGCTCAGG + Intronic
1200224882 X:154411890-154411912 GACGCTGCTGGCCAGGGTCCAGG - Exonic