ID: 1042235866

View in Genome Browser
Species Human (GRCh38)
Location 8:66613025-66613047
Sequence GGCGCTGCGGGCCGGGGTCG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 675
Summary {0: 1, 1: 1, 2: 9, 3: 63, 4: 601}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042235866_1042235878 6 Left 1042235866 8:66613025-66613047 CCCCGACCCCGGCCCGCAGCGCC 0: 1
1: 1
2: 9
3: 63
4: 601
Right 1042235878 8:66613054-66613076 AGCCCCGGCCCGGCCCGGCCAGG 0: 1
1: 24
2: 99
3: 186
4: 852
1042235866_1042235889 29 Left 1042235866 8:66613025-66613047 CCCCGACCCCGGCCCGCAGCGCC 0: 1
1: 1
2: 9
3: 63
4: 601
Right 1042235889 8:66613077-66613099 GATACCCCCAACATGTCAGGAGG 0: 1
1: 0
2: 0
3: 4
4: 78
1042235866_1042235875 -4 Left 1042235866 8:66613025-66613047 CCCCGACCCCGGCCCGCAGCGCC 0: 1
1: 1
2: 9
3: 63
4: 601
Right 1042235875 8:66613044-66613066 CGCCGCTCTTAGCCCCGGCCCGG 0: 1
1: 0
2: 0
3: 5
4: 77
1042235866_1042235874 -9 Left 1042235866 8:66613025-66613047 CCCCGACCCCGGCCCGCAGCGCC 0: 1
1: 1
2: 9
3: 63
4: 601
Right 1042235874 8:66613039-66613061 CGCAGCGCCGCTCTTAGCCCCGG 0: 1
1: 0
2: 0
3: 3
4: 72
1042235866_1042235888 26 Left 1042235866 8:66613025-66613047 CCCCGACCCCGGCCCGCAGCGCC 0: 1
1: 1
2: 9
3: 63
4: 601
Right 1042235888 8:66613074-66613096 AGGGATACCCCCAACATGTCAGG 0: 1
1: 0
2: 0
3: 6
4: 68
1042235866_1042235877 1 Left 1042235866 8:66613025-66613047 CCCCGACCCCGGCCCGCAGCGCC 0: 1
1: 1
2: 9
3: 63
4: 601
Right 1042235877 8:66613049-66613071 CTCTTAGCCCCGGCCCGGCCCGG 0: 1
1: 0
2: 0
3: 20
4: 189
1042235866_1042235879 7 Left 1042235866 8:66613025-66613047 CCCCGACCCCGGCCCGCAGCGCC 0: 1
1: 1
2: 9
3: 63
4: 601
Right 1042235879 8:66613055-66613077 GCCCCGGCCCGGCCCGGCCAGGG 0: 1
1: 1
2: 11
3: 101
4: 666

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042235866 Original CRISPR GGCGCTGCGGGCCGGGGTCG GGG (reversed) Exonic