ID: 1042238076

View in Genome Browser
Species Human (GRCh38)
Location 8:66635714-66635736
Sequence TTTCACCACGTTGGCCAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 595862
Summary {0: 4389, 1: 97729, 2: 164785, 3: 171879, 4: 157080}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042238076_1042238082 12 Left 1042238076 8:66635714-66635736 CCAGCCTGGCCAACGTGGTGAAA 0: 4389
1: 97729
2: 164785
3: 171879
4: 157080
Right 1042238082 8:66635749-66635771 TGAGAATACACAAAATTAGCTGG No data
1042238076_1042238085 25 Left 1042238076 8:66635714-66635736 CCAGCCTGGCCAACGTGGTGAAA 0: 4389
1: 97729
2: 164785
3: 171879
4: 157080
Right 1042238085 8:66635762-66635784 AATTAGCTGGGCATGGCAGCAGG 0: 59
1: 576
2: 10267
3: 35037
4: 65750
1042238076_1042238084 18 Left 1042238076 8:66635714-66635736 CCAGCCTGGCCAACGTGGTGAAA 0: 4389
1: 97729
2: 164785
3: 171879
4: 157080
Right 1042238084 8:66635755-66635777 TACACAAAATTAGCTGGGCATGG 0: 36
1: 6614
2: 24685
3: 57166
4: 73088
1042238076_1042238083 13 Left 1042238076 8:66635714-66635736 CCAGCCTGGCCAACGTGGTGAAA 0: 4389
1: 97729
2: 164785
3: 171879
4: 157080
Right 1042238083 8:66635750-66635772 GAGAATACACAAAATTAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042238076 Original CRISPR TTTCACCACGTTGGCCAGGC TGG (reversed) Intronic
Too many off-targets to display for this crispr