ID: 1042238077

View in Genome Browser
Species Human (GRCh38)
Location 8:66635718-66635740
Sequence GGGGTTTCACCACGTTGGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 589294
Summary {0: 3177, 1: 73324, 2: 158390, 3: 197727, 4: 156676}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042238077_1042238085 21 Left 1042238077 8:66635718-66635740 CCTGGCCAACGTGGTGAAACCCC 0: 3177
1: 73324
2: 158390
3: 197727
4: 156676
Right 1042238085 8:66635762-66635784 AATTAGCTGGGCATGGCAGCAGG 0: 59
1: 576
2: 10267
3: 35037
4: 65750
1042238077_1042238082 8 Left 1042238077 8:66635718-66635740 CCTGGCCAACGTGGTGAAACCCC 0: 3177
1: 73324
2: 158390
3: 197727
4: 156676
Right 1042238082 8:66635749-66635771 TGAGAATACACAAAATTAGCTGG No data
1042238077_1042238084 14 Left 1042238077 8:66635718-66635740 CCTGGCCAACGTGGTGAAACCCC 0: 3177
1: 73324
2: 158390
3: 197727
4: 156676
Right 1042238084 8:66635755-66635777 TACACAAAATTAGCTGGGCATGG 0: 36
1: 6614
2: 24685
3: 57166
4: 73088
1042238077_1042238083 9 Left 1042238077 8:66635718-66635740 CCTGGCCAACGTGGTGAAACCCC 0: 3177
1: 73324
2: 158390
3: 197727
4: 156676
Right 1042238083 8:66635750-66635772 GAGAATACACAAAATTAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042238077 Original CRISPR GGGGTTTCACCACGTTGGCC AGG (reversed) Intronic
Too many off-targets to display for this crispr