ID: 1042238078

View in Genome Browser
Species Human (GRCh38)
Location 8:66635723-66635745
Sequence GAGTTGGGGTTTCACCACGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 289471
Summary {0: 16, 1: 2515, 2: 48033, 3: 104603, 4: 134304}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042238078_1042238085 16 Left 1042238078 8:66635723-66635745 CCAACGTGGTGAAACCCCAACTC 0: 16
1: 2515
2: 48033
3: 104603
4: 134304
Right 1042238085 8:66635762-66635784 AATTAGCTGGGCATGGCAGCAGG 0: 59
1: 576
2: 10267
3: 35037
4: 65750
1042238078_1042238082 3 Left 1042238078 8:66635723-66635745 CCAACGTGGTGAAACCCCAACTC 0: 16
1: 2515
2: 48033
3: 104603
4: 134304
Right 1042238082 8:66635749-66635771 TGAGAATACACAAAATTAGCTGG No data
1042238078_1042238083 4 Left 1042238078 8:66635723-66635745 CCAACGTGGTGAAACCCCAACTC 0: 16
1: 2515
2: 48033
3: 104603
4: 134304
Right 1042238083 8:66635750-66635772 GAGAATACACAAAATTAGCTGGG No data
1042238078_1042238084 9 Left 1042238078 8:66635723-66635745 CCAACGTGGTGAAACCCCAACTC 0: 16
1: 2515
2: 48033
3: 104603
4: 134304
Right 1042238084 8:66635755-66635777 TACACAAAATTAGCTGGGCATGG 0: 36
1: 6614
2: 24685
3: 57166
4: 73088

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042238078 Original CRISPR GAGTTGGGGTTTCACCACGT TGG (reversed) Intronic
Too many off-targets to display for this crispr