ID: 1042238079

View in Genome Browser
Species Human (GRCh38)
Location 8:66635737-66635759
Sequence GTGTATTCTCAGTAGAGTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042238079_1042238083 -10 Left 1042238079 8:66635737-66635759 CCCCAACTCTACTGAGAATACAC No data
Right 1042238083 8:66635750-66635772 GAGAATACACAAAATTAGCTGGG No data
1042238079_1042238089 29 Left 1042238079 8:66635737-66635759 CCCCAACTCTACTGAGAATACAC No data
Right 1042238089 8:66635789-66635811 TGTAATCCCAGCTACTTGGGAGG No data
1042238079_1042238087 26 Left 1042238079 8:66635737-66635759 CCCCAACTCTACTGAGAATACAC No data
Right 1042238087 8:66635786-66635808 GCCTGTAATCCCAGCTACTTGGG No data
1042238079_1042238085 2 Left 1042238079 8:66635737-66635759 CCCCAACTCTACTGAGAATACAC No data
Right 1042238085 8:66635762-66635784 AATTAGCTGGGCATGGCAGCAGG No data
1042238079_1042238084 -5 Left 1042238079 8:66635737-66635759 CCCCAACTCTACTGAGAATACAC No data
Right 1042238084 8:66635755-66635777 TACACAAAATTAGCTGGGCATGG No data
1042238079_1042238086 25 Left 1042238079 8:66635737-66635759 CCCCAACTCTACTGAGAATACAC No data
Right 1042238086 8:66635785-66635807 CGCCTGTAATCCCAGCTACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042238079 Original CRISPR GTGTATTCTCAGTAGAGTTG GGG (reversed) Intronic