ID: 1042238079

View in Genome Browser
Species Human (GRCh38)
Location 8:66635737-66635759
Sequence GTGTATTCTCAGTAGAGTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 103858
Summary {0: 1, 1: 0, 2: 75, 3: 5324, 4: 98458}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042238079_1042238085 2 Left 1042238079 8:66635737-66635759 CCCCAACTCTACTGAGAATACAC 0: 1
1: 0
2: 75
3: 5324
4: 98458
Right 1042238085 8:66635762-66635784 AATTAGCTGGGCATGGCAGCAGG 0: 59
1: 576
2: 10267
3: 35037
4: 65750
1042238079_1042238084 -5 Left 1042238079 8:66635737-66635759 CCCCAACTCTACTGAGAATACAC 0: 1
1: 0
2: 75
3: 5324
4: 98458
Right 1042238084 8:66635755-66635777 TACACAAAATTAGCTGGGCATGG 0: 36
1: 6614
2: 24685
3: 57166
4: 73088
1042238079_1042238083 -10 Left 1042238079 8:66635737-66635759 CCCCAACTCTACTGAGAATACAC 0: 1
1: 0
2: 75
3: 5324
4: 98458
Right 1042238083 8:66635750-66635772 GAGAATACACAAAATTAGCTGGG No data
1042238079_1042238089 29 Left 1042238079 8:66635737-66635759 CCCCAACTCTACTGAGAATACAC 0: 1
1: 0
2: 75
3: 5324
4: 98458
Right 1042238089 8:66635789-66635811 TGTAATCCCAGCTACTTGGGAGG 0: 48952
1: 142577
2: 242332
3: 522592
4: 386712
1042238079_1042238087 26 Left 1042238079 8:66635737-66635759 CCCCAACTCTACTGAGAATACAC 0: 1
1: 0
2: 75
3: 5324
4: 98458
Right 1042238087 8:66635786-66635808 GCCTGTAATCCCAGCTACTTGGG 0: 35616
1: 158937
2: 257753
3: 440394
4: 391946
1042238079_1042238086 25 Left 1042238079 8:66635737-66635759 CCCCAACTCTACTGAGAATACAC 0: 1
1: 0
2: 75
3: 5324
4: 98458
Right 1042238086 8:66635785-66635807 CGCCTGTAATCCCAGCTACTTGG 0: 19859
1: 144299
2: 173844
3: 251438
4: 351339

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042238079 Original CRISPR GTGTATTCTCAGTAGAGTTG GGG (reversed) Intronic
Too many off-targets to display for this crispr