ID: 1042238083

View in Genome Browser
Species Human (GRCh38)
Location 8:66635750-66635772
Sequence GAGAATACACAAAATTAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042238077_1042238083 9 Left 1042238077 8:66635718-66635740 CCTGGCCAACGTGGTGAAACCCC 0: 3177
1: 73324
2: 158390
3: 197727
4: 156676
Right 1042238083 8:66635750-66635772 GAGAATACACAAAATTAGCTGGG No data
1042238076_1042238083 13 Left 1042238076 8:66635714-66635736 CCAGCCTGGCCAACGTGGTGAAA 0: 4389
1: 97729
2: 164785
3: 171879
4: 157080
Right 1042238083 8:66635750-66635772 GAGAATACACAAAATTAGCTGGG No data
1042238078_1042238083 4 Left 1042238078 8:66635723-66635745 CCAACGTGGTGAAACCCCAACTC 0: 16
1: 2515
2: 48033
3: 104603
4: 134304
Right 1042238083 8:66635750-66635772 GAGAATACACAAAATTAGCTGGG No data
1042238079_1042238083 -10 Left 1042238079 8:66635737-66635759 CCCCAACTCTACTGAGAATACAC 0: 1
1: 0
2: 75
3: 5324
4: 98458
Right 1042238083 8:66635750-66635772 GAGAATACACAAAATTAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042238083 Original CRISPR GAGAATACACAAAATTAGCT GGG Intronic
No off target data available for this crispr