ID: 1042241295 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 8:66666924-66666946 |
Sequence | GGCAACGGAGGCGGCGGCGG CGG |
Strand | + |
Crispr in exon? | Yes |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 4595 | |||
Summary | {0: 1, 1: 2, 2: 117, 3: 1516, 4: 2959} |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1042241279_1042241295 | 24 | Left | 1042241279 | 8:66666877-66666899 | CCAAGGACGACGGAGTCTGTGGA | 0: 1 1: 0 2: 0 3: 4 4: 56 |
||
Right | 1042241295 | 8:66666924-66666946 | GGCAACGGAGGCGGCGGCGGCGG | 0: 1 1: 2 2: 117 3: 1516 4: 2959 |
||||
1042241288_1042241295 | 0 | Left | 1042241288 | 8:66666901-66666923 | CCTCAGGGGGAGGAGGTGGCGGC | 0: 1 1: 0 2: 2 3: 42 4: 536 |
||
Right | 1042241295 | 8:66666924-66666946 | GGCAACGGAGGCGGCGGCGGCGG | 0: 1 1: 2 2: 117 3: 1516 4: 2959 |
||||
1042241277_1042241295 | 30 | Left | 1042241277 | 8:66666871-66666893 | CCGACGCCAAGGACGACGGAGTC | 0: 1 1: 0 2: 0 3: 1 4: 25 |
||
Right | 1042241295 | 8:66666924-66666946 | GGCAACGGAGGCGGCGGCGGCGG | 0: 1 1: 2 2: 117 3: 1516 4: 2959 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1042241295 | Original CRISPR | GGCAACGGAGGCGGCGGCGG CGG | Exonic | ||