ID: 1042241295

View in Genome Browser
Species Human (GRCh38)
Location 8:66666924-66666946
Sequence GGCAACGGAGGCGGCGGCGG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 4595
Summary {0: 1, 1: 2, 2: 117, 3: 1516, 4: 2959}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042241279_1042241295 24 Left 1042241279 8:66666877-66666899 CCAAGGACGACGGAGTCTGTGGA 0: 1
1: 0
2: 0
3: 4
4: 56
Right 1042241295 8:66666924-66666946 GGCAACGGAGGCGGCGGCGGCGG 0: 1
1: 2
2: 117
3: 1516
4: 2959
1042241288_1042241295 0 Left 1042241288 8:66666901-66666923 CCTCAGGGGGAGGAGGTGGCGGC 0: 1
1: 0
2: 2
3: 42
4: 536
Right 1042241295 8:66666924-66666946 GGCAACGGAGGCGGCGGCGGCGG 0: 1
1: 2
2: 117
3: 1516
4: 2959
1042241277_1042241295 30 Left 1042241277 8:66666871-66666893 CCGACGCCAAGGACGACGGAGTC 0: 1
1: 0
2: 0
3: 1
4: 25
Right 1042241295 8:66666924-66666946 GGCAACGGAGGCGGCGGCGGCGG 0: 1
1: 2
2: 117
3: 1516
4: 2959

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042241295 Original CRISPR GGCAACGGAGGCGGCGGCGG CGG Exonic