ID: 1042246406

View in Genome Browser
Species Human (GRCh38)
Location 8:66712812-66712834
Sequence GGGAGCAGCACCGCGGGGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 395
Summary {0: 1, 1: 0, 2: 1, 3: 34, 4: 359}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042246393_1042246406 28 Left 1042246393 8:66712761-66712783 CCTGCCGGGAAGGAGGAAGCGCA 0: 1
1: 0
2: 2
3: 16
4: 156
Right 1042246406 8:66712812-66712834 GGGAGCAGCACCGCGGGGCCAGG 0: 1
1: 0
2: 1
3: 34
4: 359
1042246394_1042246406 24 Left 1042246394 8:66712765-66712787 CCGGGAAGGAGGAAGCGCAGTGC 0: 1
1: 0
2: 2
3: 38
4: 269
Right 1042246406 8:66712812-66712834 GGGAGCAGCACCGCGGGGCCAGG 0: 1
1: 0
2: 1
3: 34
4: 359
1042246392_1042246406 29 Left 1042246392 8:66712760-66712782 CCCTGCCGGGAAGGAGGAAGCGC 0: 1
1: 0
2: 0
3: 18
4: 161
Right 1042246406 8:66712812-66712834 GGGAGCAGCACCGCGGGGCCAGG 0: 1
1: 0
2: 1
3: 34
4: 359
1042246398_1042246406 -7 Left 1042246398 8:66712796-66712818 CCGCGCCCGCCGCGCCGGGAGCA 0: 1
1: 0
2: 2
3: 26
4: 234
Right 1042246406 8:66712812-66712834 GGGAGCAGCACCGCGGGGCCAGG 0: 1
1: 0
2: 1
3: 34
4: 359

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042246406 Original CRISPR GGGAGCAGCACCGCGGGGCC AGG Intronic
900314159 1:2048801-2048823 GGGAGCTGGAACCCGGGGCCAGG + Intergenic
900466820 1:2829830-2829852 GAGAGGAGCACCGCAGAGCCTGG - Intergenic
900576803 1:3386799-3386821 GGCAGGGGCACCGCGGGGCTGGG + Intronic
900992179 1:6103200-6103222 GTGGCCAGCACCCCGGGGCCCGG - Exonic
901019838 1:6249979-6250001 GGGAGAAGCGCCGCGTGGGCGGG + Exonic
901075787 1:6554120-6554142 AGCAGCAGCAACGCGCGGCCGGG + Exonic
901317372 1:8318140-8318162 GGCAGCAGCCCAGCGGGGACAGG + Intronic
902214351 1:14924781-14924803 GGGGGCTGCACCGGGGGGCCAGG + Intronic
902230091 1:15022274-15022296 GGAAGCAGCACCCTGGGGCGGGG - Intronic
902309295 1:15568592-15568614 GGCAGCAGCACAGCAGGGCCGGG - Exonic
902337044 1:15759557-15759579 GGGAGAAGCAGCCCGGGGGCTGG - Intronic
902456097 1:16535011-16535033 GGGTGCAGCTCCACGGGGGCTGG + Intergenic
902496070 1:16872900-16872922 GGGTGCAGCTCCACGGGGGCTGG - Intronic
903183495 1:21617209-21617231 GGGAGCAGAACCCATGGGCCAGG - Intronic
903349828 1:22710938-22710960 GGCCGCGGCGCCGCGGGGCCCGG - Intronic
903628073 1:24745453-24745475 GCGAGCAGCACGGCGGGAACCGG + Exonic
905028369 1:34866037-34866059 GGGTGGAGAACCGCGGGCCCGGG + Exonic
906637094 1:47416898-47416920 GGCACCAGCAGCGCGGGGCCGGG - Exonic
906719953 1:47997341-47997363 CGGAGCAGCATGGCGGAGCCCGG - Intergenic
907269053 1:53279933-53279955 GGGAGCAGGCCAGCAGGGCCTGG - Intronic
907526540 1:55057140-55057162 GGGAGCACCAGGGCGGGGCAGGG + Intronic
908417195 1:63924750-63924772 GAGAGCAGCACAGGAGGGCCTGG + Intronic
908557041 1:65266152-65266174 GCGCGCAGCGCCGCGGGGCTTGG + Intronic
910876800 1:91885844-91885866 GGCTGCAGCGCCGCGGGGCTGGG + Intronic
910935086 1:92480818-92480840 GGGAGCTGCAGCGCAGGGGCCGG - Exonic
913369663 1:118083960-118083982 GGGAGGAGCACCAAGGGTCCAGG + Intronic
914250606 1:145918701-145918723 GGGAGCAGGGCCGCGGAGCCTGG - Exonic
914702812 1:150149933-150149955 GGGAGCGGCCGCGCTGGGCCGGG + Intronic
914984182 1:152442107-152442129 GGGGGCAGCACCTGGGGGCCAGG + Intergenic
919739245 1:200972452-200972474 TGGGGCAGAACCCCGGGGCCTGG + Intronic
919789719 1:201283423-201283445 AGCAGCAGCAGCGCGCGGCCCGG + Intergenic
920021325 1:202958431-202958453 CGGGGCAGCAGGGCGGGGCCCGG - Intronic
920685749 1:208107866-208107888 TGAAGCAGCACTGCGGGTCCTGG - Intronic
921051524 1:211515153-211515175 GGGAGGAGGAGCGCGGCGCCTGG + Intergenic
921220480 1:212970166-212970188 GGGAGCAGCAGCGCCAAGCCAGG - Intronic
922416621 1:225428095-225428117 GGGAGAAGCGCCGCGAGGCGGGG - Intronic
923400812 1:233614212-233614234 TGGAGCGGCACCGCTCGGCCTGG + Exonic
924940965 1:248812211-248812233 GGGAGGAGCGCCGAGGGCCCAGG + Exonic
1063418050 10:5889650-5889672 GGGATGAGCACGGAGGGGCCTGG + Exonic
1063511353 10:6647839-6647861 GAGGGCCGCAGCGCGGGGCCCGG + Intergenic
1065079156 10:22110779-22110801 CTGAGCAGCACTGCAGGGCCAGG + Intergenic
1066220849 10:33335466-33335488 GGGAGCCGCACCGCGAAGCCGGG + Intronic
1066513786 10:36132426-36132448 GGGTGCATCACCGCGGGGAGAGG - Intergenic
1069782590 10:70966079-70966101 GGGAGCAGGAGTGGGGGGCCTGG - Intergenic
1070828392 10:79404208-79404230 GGCAGCAGCGCCTCAGGGCCGGG - Intronic
1071495204 10:86163202-86163224 GGGAGCAGCACAGCCTGGCCTGG + Intronic
1072169926 10:92848905-92848927 CGGGGCCGCAGCGCGGGGCCCGG - Intronic
1072188074 10:93060929-93060951 GGGAGGTGCCCCGCGGAGCCGGG + Intergenic
1075343064 10:121662569-121662591 GTGAGCAGCATCGGGGGCCCGGG + Intergenic
1075705256 10:124496782-124496804 GGGACCAGCACCACAGAGCCGGG - Intronic
1075712963 10:124540526-124540548 GGGAGCAGGCCAGTGGGGCCAGG - Intronic
1076683150 10:132185655-132185677 GCGAGCAGCCACGCGTGGCCGGG + Intergenic
1076750114 10:132538118-132538140 ACCAGCAGCACCGCGGTGCCCGG - Exonic
1076878803 10:133230277-133230299 CGGAGCAGCATCCCGGGGCTGGG - Exonic
1076908131 10:133373352-133373374 GGGGGCGGCTCCGCGGGGCCGGG - Exonic
1077142600 11:1031072-1031094 GGGGTCAGCACCGTGGGGGCTGG + Intronic
1077185969 11:1235520-1235542 TGGAACAGCAGCCCGGGGCCAGG - Intronic
1077316427 11:1921299-1921321 GGGCACAGCAGGGCGGGGCCAGG + Intronic
1077325845 11:1963675-1963697 GCGAGCAGCATCGCGTGACCGGG - Intronic
1077334965 11:1999194-1999216 TGGAGCAGGAGCGAGGGGCCTGG - Intergenic
1077367433 11:2166847-2166869 GGGCGCAGAGCCGGGGGGCCGGG - Intronic
1077423654 11:2464545-2464567 GGGGGCAGCAGCCAGGGGCCAGG - Intronic
1077432166 11:2521226-2521248 GAGAGCAGGATGGCGGGGCCGGG - Intronic
1077460722 11:2708031-2708053 GGGAACAGCCCTGAGGGGCCTGG - Intronic
1078317433 11:10305010-10305032 GGGAGCGGCGGGGCGGGGCCTGG - Intronic
1078801061 11:14644273-14644295 GGGAGCAGCGCCGCGGCTGCTGG - Exonic
1083176131 11:60951510-60951532 GGGAGCAGCCCCGCGTGCCCGGG - Exonic
1083266068 11:61547387-61547409 GGGACCAGGACCCCGGGGCCGGG + Intronic
1083445625 11:62706376-62706398 GGGTCCAGCACGGCGGGGCGGGG + Intronic
1083686679 11:64380657-64380679 GGGAGAAGCACCGCAGGACTAGG + Intergenic
1083883059 11:65557933-65557955 GCCAGCAGCCCCTCGGGGCCCGG + Exonic
1083922326 11:65787540-65787562 GGGCGCAGGTCCGCGGAGCCAGG + Intronic
1083997216 11:66278409-66278431 GGGGGCGCCAGCGCGGGGCCCGG - Exonic
1084044176 11:66559562-66559584 GTGAGCAGCAGAGCGGGGTCCGG - Intronic
1084383414 11:68827887-68827909 GGGTGCAGGACAGCAGGGCCAGG - Intronic
1084393849 11:68896283-68896305 GGGAGCAGACCTGCTGGGCCAGG + Intronic
1084563309 11:69916015-69916037 GGGAGGAGCAGGGCAGGGCCGGG + Intergenic
1084662891 11:70557583-70557605 GCTGGCAGCACCGCGGGGCCAGG + Intronic
1089401355 11:118166427-118166449 GGGAGGAGCACAGCCGTGCCAGG + Exonic
1090137244 11:124210565-124210587 GGGAGCAGCACGGTTGGGCATGG - Intergenic
1090363598 11:126189327-126189349 CGCAGCAGCACAGTGGGGCCAGG - Intergenic
1202817948 11_KI270721v1_random:54376-54398 TGGAGCAGGAGCGAGGGGCCTGG - Intergenic
1091800233 12:3320451-3320473 GGGAGGAGCACCCAGGGCCCAGG - Intergenic
1092870839 12:12804502-12804524 AGGAGCAGCACAGAGGGGCTGGG - Intronic
1095559881 12:43552046-43552068 GGGAACAGCAGCGCGGGCCCTGG + Intergenic
1096121185 12:49090378-49090400 GGGAACTGCACCGCGGAGACTGG - Exonic
1096154974 12:49336684-49336706 GGGAGCGGCACCGCCGCGGCTGG - Exonic
1096231698 12:49900409-49900431 GGGAGCTTTACCTCGGGGCCAGG - Intronic
1102375646 12:112419126-112419148 GTGAGGAGCCCCGAGGGGCCCGG + Intronic
1104640385 12:130463278-130463300 AGGAGCAGCACCATGGGGCTGGG - Intronic
1104897407 12:132171199-132171221 GGGAGCAGCTCTGGGGGACCAGG + Intergenic
1105000650 12:132687837-132687859 GGCCGCAGCGGCGCGGGGCCTGG + Intronic
1105327333 13:19382396-19382418 GGGGCCCGCAGCGCGGGGCCCGG + Intergenic
1108689298 13:52847441-52847463 GGGCGCAGGACCGCGGACCCGGG - Exonic
1108783979 13:53872219-53872241 GGGAAAAGCACTGCAGGGCCTGG + Intergenic
1112752385 13:102596532-102596554 GTCAGCAGCACCCCGGGGCTGGG + Intergenic
1113660900 13:112105680-112105702 GGGTGCATCGCGGCGGGGCCTGG + Intergenic
1115800687 14:36990287-36990309 GGGAACAGCACTGCTGGGGCTGG - Intronic
1117315294 14:54566606-54566628 GGGAGCAGCGCTGCGGACCCCGG + Intergenic
1117963967 14:61188519-61188541 GGCAGCAGGACCCCGGAGCCGGG - Intronic
1118024071 14:61751180-61751202 GGGCGCAGCACCGCAGTCCCGGG + Intergenic
1118473251 14:66094248-66094270 GGGAGCAGCACAGTCGGGCATGG - Intergenic
1119480577 14:74955454-74955476 GGGAGCGGCCCGGCGGGGCGGGG + Exonic
1119539356 14:75428364-75428386 GGGAGCCTCCCCGCGGGGCTGGG - Intronic
1119841969 14:77800142-77800164 GGAAGCAGAGCCGCGGCGCCCGG - Exonic
1122244349 14:100391368-100391390 AGGAGCAGCGCCGCGGTCCCCGG + Intronic
1122419223 14:101564682-101564704 CGGAGGAGCAGCGCGGGGGCTGG - Intergenic
1122609799 14:102974040-102974062 AGAAGCAGCACCGCGTGGTCCGG - Exonic
1122815499 14:104310154-104310176 GGGTGCAGCTCCCTGGGGCCTGG - Intergenic
1122857168 14:104565530-104565552 GGGAGGAGCACGGAGGGGCCAGG - Intronic
1123003833 14:105311951-105311973 GGAAGCAGCCCCACGTGGCCAGG - Exonic
1123017208 14:105381105-105381127 GGGGGCTGCACGGCGGGGCGGGG + Intronic
1123991557 15:25687331-25687353 GGGAGCAGGACTGGGTGGCCTGG + Intronic
1124211807 15:27770321-27770343 GGGACGGGCAACGCGGGGCCGGG + Intronic
1125529884 15:40406097-40406119 GGGAGCGCCAGCGCGGGGGCGGG + Intronic
1125603826 15:40929135-40929157 GGGAGCGGCACGGAGGGGCGGGG + Intergenic
1126786192 15:52179623-52179645 GGGAGCAGGGCCCTGGGGCCCGG - Intronic
1128075145 15:64821169-64821191 GGAAGCAGAACCGTGGGGGCTGG + Exonic
1128456543 15:67834642-67834664 GGGAGCCGCCCCGCGGGTTCTGG + Intergenic
1128987509 15:72231640-72231662 GGGAGTGGCAGGGCGGGGCCGGG - Intronic
1129694380 15:77732394-77732416 GGGAGCAGAACCACGGGGGTGGG - Intronic
1130348055 15:83067072-83067094 GGCGGCGGCCCCGCGGGGCCCGG + Exonic
1131508567 15:93036473-93036495 GGGACCAGGTCTGCGGGGCCAGG - Intronic
1132092464 15:98957323-98957345 AGGACCAGCACCCCAGGGCCGGG - Exonic
1132092766 15:98959325-98959347 GGGAGCAGCAGAGCGTGGTCCGG + Exonic
1132517538 16:372820-372842 GGCAGCAGCTCCGAGGGGGCAGG - Intronic
1132560720 16:592374-592396 GGCAGCAGCACCGGGGGCTCTGG + Intronic
1133055725 16:3144592-3144614 TGGGGCAGCCCCGCAGGGCCCGG - Exonic
1134445898 16:14331262-14331284 GGGAGCAGCAAGACAGGGCCTGG - Intergenic
1135037342 16:19089344-19089366 GTGAGGAGGACCACGGGGCCGGG - Intergenic
1135115332 16:19718595-19718617 GGCAGCGGCTCCGCGGGCCCGGG + Intronic
1136026083 16:27469888-27469910 GGACGCAGCACAGCGGGGCAGGG - Intronic
1136348903 16:29694660-29694682 GGCAGCAGCAGCGCCAGGCCTGG - Exonic
1138181783 16:54945394-54945416 GGTAGCAGCACTGAGGGGCATGG - Intergenic
1138587174 16:57978124-57978146 GGGAGCAGCAGAGCTGGGACTGG - Intronic
1138607311 16:58097393-58097415 GGGGGCAGCACTGAGCGGCCAGG + Intergenic
1141089063 16:81117567-81117589 GGGAGCAGCCCTGTGGGGCGGGG - Intergenic
1141688725 16:85584796-85584818 GGGAGCAGCACGGCTGAGCAGGG + Intergenic
1141798000 16:86287364-86287386 GGGCCCAGCAGCGCGGGGCCCGG - Intergenic
1142148620 16:88503042-88503064 GGGCGCTGCTCCGCGGGGCAGGG + Intronic
1142150198 16:88509309-88509331 GGGAGCCACAGGGCGGGGCCGGG + Intronic
1142161725 16:88561278-88561300 GTGAGCAGCAGAGCTGGGCCTGG + Intergenic
1142345781 16:89553139-89553161 AGGAGCAGCGGCGCGGGCCCTGG + Intronic
1142474555 17:181315-181337 GGGTGCAGCGGCTCGGGGCCCGG + Exonic
1143537344 17:7549199-7549221 GGGACCAGCAGGGCGGTGCCCGG - Exonic
1143732360 17:8888352-8888374 GGGAGCGGGAGCGCTGGGCCCGG + Exonic
1143747288 17:9003626-9003648 GGGTGCAGCGCCGAGGGGGCCGG - Intergenic
1144010677 17:11145878-11145900 GGGAGCAGCCCGGGGAGGCCTGG - Intergenic
1144804684 17:17956753-17956775 GGGCCCAGCACCGCAGGCCCCGG - Intronic
1144958503 17:19031861-19031883 GGGAGCAGGACCCAGGAGCCTGG + Intronic
1144976656 17:19142663-19142685 GGGAGCAGGACCCAGGAGCCTGG - Intronic
1144991836 17:19238209-19238231 CCGAGCAGGACCGCCGGGCCGGG - Intronic
1146208274 17:30922652-30922674 GGGGGGCGCACCGCGGGGCTCGG - Intronic
1147313250 17:39607044-39607066 GGGAGCTGGGCCGGGGGGCCCGG - Intronic
1147723783 17:42554279-42554301 GCGAGCAGCACCGCTGCGCTGGG - Intronic
1148133087 17:45274093-45274115 GGGATCAGGGCCGTGGGGCCTGG + Intronic
1148157494 17:45432228-45432250 CGGAGCAGCCCGGCCGGGCCTGG + Intronic
1148440316 17:47708759-47708781 GGGAGGGGCACTGGGGGGCCGGG - Exonic
1148685028 17:49496264-49496286 GCGAGCAGGAGCGCGGGGACAGG - Intronic
1148899598 17:50866102-50866124 GGGAGCAGCGCGGCAGGGCGGGG + Exonic
1148986914 17:51630491-51630513 GGGAGCATCACAGGGGGGCATGG + Exonic
1149984379 17:61336076-61336098 CAGAGCAGCACCACTGGGCCAGG - Intronic
1150108219 17:62478004-62478026 GGCAGCATCCCCGCGGGGGCGGG + Intronic
1151327392 17:73387768-73387790 TGGAGGAGCACCGCTGGTCCCGG + Intronic
1151539447 17:74757777-74757799 GGGGGCAGGACGGCGGGGGCAGG - Intronic
1151559035 17:74861079-74861101 CGCGGCAGCACCGCGGGACCAGG - Intronic
1151693199 17:75700071-75700093 TGGAGCAGCACCACGGGACATGG - Intronic
1151819121 17:76487874-76487896 GGAAGCTGCACCGTGTGGCCTGG - Exonic
1151828789 17:76537918-76537940 CGGAGTTGCACCGCGGGGCGGGG + Intronic
1151905719 17:77047312-77047334 TGGGGCAGCACTGCGGGGCTGGG + Intergenic
1152154819 17:78625998-78626020 GGGAACAGCAGCCAGGGGCCTGG + Intergenic
1152345149 17:79746965-79746987 GGCAGCACCACCCCTGGGCCAGG + Intergenic
1152567387 17:81106387-81106409 GGGGGCAGCTCCTGGGGGCCAGG + Intronic
1152586399 17:81191370-81191392 CGGAGCCGGCCCGCGGGGCCAGG + Intronic
1152797431 17:82315134-82315156 CTGAGAAGCACCGTGGGGCCTGG + Exonic
1152809518 17:82374973-82374995 GCCACCAGCATCGCGGGGCCCGG + Exonic
1152942686 17:83181257-83181279 GTGAGCAGACCCGCTGGGCCAGG - Intergenic
1155263797 18:24072209-24072231 CGGGGCAGCACTGAGGGGCCAGG + Intronic
1156327202 18:36085334-36085356 GGGAGCAGCACAGTTGGGCATGG + Intergenic
1156345541 18:36253724-36253746 GGGAGCAGCATGGCAGGGCTTGG + Intronic
1160509185 18:79443815-79443837 CGGACCAGCACCTCGGGGCTGGG - Intronic
1160535706 18:79590236-79590258 GGGAGCAGAACCGGGGACCCGGG + Intergenic
1160930804 19:1568616-1568638 GGGAGCGGGACCTCGGGCCCTGG - Intergenic
1161080342 19:2307387-2307409 GGGAGCAGCACCTCGTGCCTTGG - Intronic
1161203576 19:3029020-3029042 GGGAGAAGCGGCGCGGGGCAAGG + Exonic
1161499360 19:4605030-4605052 GGGGGCAGCACCCAGGAGCCGGG + Intergenic
1161590337 19:5126572-5126594 GAGAGCAGCACTCCGGGGCGAGG - Intronic
1161951276 19:7469428-7469450 GGGATCAGCACAGCCGGGACAGG + Intronic
1162470864 19:10871461-10871483 GGGCGCTGCGCCACGGGGCCGGG + Intergenic
1162566726 19:11448765-11448787 GGGAGCAGAAGCCAGGGGCCAGG + Intronic
1163111024 19:15161065-15161087 GGCAGCAGGAACGAGGGGCCTGG + Exonic
1163418502 19:17201389-17201411 GGGAGCTGCACAGCGGGCACAGG + Intronic
1163544499 19:17933086-17933108 GGGAGCAGAGGCGCGGGGCGGGG + Intronic
1164258445 19:23549418-23549440 GAGGGCAGCAGCGCGGGTCCTGG - Intronic
1164457443 19:28420580-28420602 GTGGGCAGCACCGGGAGGCCGGG + Intergenic
1164554876 19:29243691-29243713 GGGAGCATCCCCACGTGGCCAGG + Intergenic
1165158607 19:33802973-33802995 GTGAGCAGCACAGTGGGGCTGGG - Intronic
1165396219 19:35565040-35565062 GGCAGCAGCAGCGAGGGGCTGGG + Intergenic
1165423250 19:35732589-35732611 GGGAGCAGCCACGGGGGCCCGGG + Exonic
1165775017 19:38399224-38399246 GGGAGCAGGACTGGGGGACCTGG - Intergenic
1166055326 19:40284996-40285018 GGGACCAGCCTCGGGGGGCCGGG - Intronic
1166502612 19:43353232-43353254 GGGAGGAGGGCCTCGGGGCCTGG + Intergenic
1166677561 19:44748866-44748888 CGGAGCGGCAGCGCGGCGCCCGG - Exonic
1166931424 19:46303806-46303828 GGGAGCTGCCACGTGGGGCCGGG - Intronic
1167614720 19:50526130-50526152 GGTGGCAGCACAGCGGGGCATGG - Intronic
1167642446 19:50689071-50689093 GGGACCAGCACCCCGGGGTGGGG + Intronic
1167792230 19:51689639-51689661 GGGAGGAGCACCCGGGGGCCTGG + Intergenic
1168346636 19:55653044-55653066 GGCAGCTCCTCCGCGGGGCCAGG - Exonic
1202706984 1_KI270713v1_random:31367-31389 GGGTGCAGCTCCACGGGGGCTGG + Intergenic
924998007 2:381677-381699 GGGAGCATCACAGCCTGGCCTGG + Intergenic
925172613 2:1759559-1759581 GCCAGCAGCACCGCCGGCCCCGG - Intergenic
926095807 2:10080147-10080169 GAGAGCCTCCCCGCGGGGCCCGG - Exonic
926133423 2:10319710-10319732 GGGAGCTCCACCAAGGGGCCAGG - Intronic
926802574 2:16672079-16672101 GGGAGCAGCACAGAGGGGATGGG + Intergenic
927754548 2:25698257-25698279 GTGAGCAGCACCGCAGGGGCAGG + Intergenic
929127619 2:38535695-38535717 GGGAGCAGCTCGGCAGGACCAGG + Intergenic
929460887 2:42101477-42101499 CCGAGCAGCACGGCGGAGCCGGG - Intergenic
930728850 2:54709036-54709058 GGGAGCAGTACGGTGGGGCATGG + Intergenic
932180537 2:69642949-69642971 GGGGGCAGCACCTCGGGCCTGGG - Exonic
932308033 2:70717599-70717621 GGGAGCTGATCCGTGGGGCCGGG - Intronic
932702746 2:74002520-74002542 GGGAGCGGCACGGCGGGCCTGGG + Intronic
933129078 2:78650862-78650884 GGGAGCAGCATCAAGGGGCCAGG - Intergenic
933355075 2:81199545-81199567 GGAAGCAGGACAGCAGGGCCCGG - Intergenic
935046839 2:99490158-99490180 GGGCGTAGCACCGCGGCGCCCGG + Intergenic
935196681 2:100820380-100820402 CGGAGCGGCCCCGCGGGGCCGGG - Exonic
935710381 2:105893203-105893225 GGCAGCTCCACCGTGGGGCCCGG - Exonic
936104563 2:109613865-109613887 GGGACCAGCCGCTCGGGGCCGGG - Exonic
937083929 2:119158409-119158431 GGGACCGGCTCCGCGGGTCCTGG + Exonic
938062049 2:128261940-128261962 GGGAGCAGGATGGCAGGGCCGGG + Intronic
938071281 2:128309778-128309800 GGGAGACTGACCGCGGGGCCAGG - Intronic
938071851 2:128312557-128312579 GGGTGCAGCTCCCAGGGGCCTGG - Intronic
938091152 2:128435701-128435723 GGGAGCAGGAGTGCGGGGCAGGG + Intergenic
938977607 2:136494739-136494761 GGAAGGTGCACCGAGGGGCCTGG + Intergenic
940258680 2:151758790-151758812 GGGAGCAGCACACAGGGGCAAGG - Intergenic
942325321 2:174771666-174771688 GGGTGCAGCTCCCTGGGGCCTGG + Intergenic
943342084 2:186693928-186693950 GGGCGCGGGACCGCGGGCCCCGG + Intergenic
946423000 2:219575396-219575418 GAGAGCAGCACAGCAGGGCTGGG - Exonic
947103850 2:226648345-226648367 GGGATCAGCACCGTGGAGCAGGG - Intergenic
948139722 2:235663355-235663377 GGGAGCAGCAGCGTGGGGTTGGG + Intronic
948373142 2:237503481-237503503 AGGAGCAGCACCGGGGACCCAGG - Intronic
948413439 2:237782706-237782728 GGCAGCAGCATCGAGGGGCATGG - Intronic
948813805 2:240499596-240499618 GGGAGCAGCACCCCAGGCCTCGG + Intronic
949032722 2:241804580-241804602 GGGACCAGCACCTCGTCGCCAGG - Intergenic
1168965334 20:1894979-1895001 GGGGGCGGCTCCGCGCGGCCGGG + Intronic
1169120554 20:3093175-3093197 GCGAGCGGCGCCGCTGGGCCTGG - Intergenic
1169557627 20:6767715-6767737 GGGCGCAGCGCGGCGGGGCGAGG - Exonic
1169941332 20:10941083-10941105 TGGCAGAGCACCGCGGGGCCAGG - Intergenic
1171391920 20:24807122-24807144 TGGAGCAGGGCCGTGGGGCCTGG - Intergenic
1172101112 20:32484224-32484246 GGGAGCCGAACCCCGAGGCCCGG - Intronic
1172134073 20:32675466-32675488 GGGAGAAGCACTGCTGGGCAAGG - Intergenic
1173322383 20:41999401-41999423 TGGAGCAGGTGCGCGGGGCCGGG + Intergenic
1174165609 20:48581558-48581580 GGGAGCACCACTGCGTGGCTGGG + Intergenic
1174475079 20:50790770-50790792 GGGAGCAGCAGCTCTGAGCCCGG + Intergenic
1175215881 20:57391534-57391556 GAGCGCAGCCCCGCGCGGCCCGG + Exonic
1175239765 20:57538490-57538512 GGAAGCAGCACCGAGAGTCCAGG + Intergenic
1175856450 20:62123091-62123113 GGGGGCGGCACCGCGGGGGCCGG - Intronic
1175966277 20:62661640-62661662 GGGGGCAGCATCCCAGGGCCCGG - Intronic
1176853249 21:13937428-13937450 GGGGGCAGCGCGGCGGGCCCTGG - Intergenic
1178467262 21:32859452-32859474 GAGAGCAGCAACTCGGAGCCAGG + Intergenic
1178485877 21:33020016-33020038 CTGCGCAGCCCCGCGGGGCCGGG + Intergenic
1178707886 21:34889713-34889735 GCCCGCAGCACCGCGGGGACCGG - Intronic
1179030960 21:37719092-37719114 AGGAGGAGCCCCGAGGGGCCAGG + Intronic
1179568276 21:42262650-42262672 GGGAACCGCTCTGCGGGGCCTGG + Intronic
1179576473 21:42311301-42311323 GGGAGCAGCACAGGAGGCCCAGG + Intergenic
1179729150 21:43357912-43357934 GGGAGCTGCCCCGAGGGTCCTGG - Intergenic
1180054890 21:45352648-45352670 GGGAGCAGGACAGCGTGGCCTGG - Intergenic
1180963344 22:19772845-19772867 GGGACCTTCACCGCGGGGCTGGG + Intronic
1180983006 22:19888147-19888169 GGGTGCTGCACTGCTGGGCCTGG - Intronic
1181038121 22:20179562-20179584 GGGTGAAGGACCACGGGGCCTGG - Intergenic
1181562469 22:23713944-23713966 GAGAGCAGCACCGTGGGGAAGGG + Intergenic
1182260913 22:29072875-29072897 GGCAGGAGCAGCGCGCGGCCGGG + Intergenic
1182278630 22:29205836-29205858 GGGGGCAGCGCAGAGGGGCCGGG + Exonic
1182352036 22:29704565-29704587 CTGAGCAGCACTGGGGGGCCCGG - Intergenic
1182476438 22:30579109-30579131 GGGAGCTGCAATGCGGGGCTTGG - Intronic
1183075930 22:35426701-35426723 GGGAGCACCTCCCCGGGGCCAGG - Intergenic
1183211633 22:36455021-36455043 AGGAGCAGGTGCGCGGGGCCGGG + Intergenic
1183281615 22:36935516-36935538 GGGAGCGGCAGAGCAGGGCCTGG - Intronic
1185341555 22:50293458-50293480 GGGCGCAGGGCCGAGGGGCCTGG - Intronic
952125138 3:30291052-30291074 GGGAGAAGCAGGGCAGGGCCAGG + Intergenic
953885928 3:46714374-46714396 AGGACCAGAACCGCTGGGCCCGG + Exonic
954363776 3:50135789-50135811 GGGAGCTGGACAGTGGGGCCAGG + Intergenic
954497838 3:50982572-50982594 GAGAGCAGCAACACAGGGCCAGG - Intronic
954540623 3:51391240-51391262 GGGAGCGGCGCCGAGGGGCCGGG - Intergenic
955348565 3:58178288-58178310 AGGATCAGCTCCGCGAGGCCAGG + Intergenic
955681492 3:61506032-61506054 AGGAGCAGCAACACGGAGCCAGG - Intergenic
956487760 3:69740024-69740046 GGGAGGAGGAGCGCCGGGCCGGG + Intronic
956867527 3:73384409-73384431 AGGAGCAGTACCGCGAGTCCTGG - Exonic
960691286 3:120349115-120349137 GGGAGGAGCGGCGCGGGGCGCGG - Exonic
960959825 3:123062431-123062453 AGCAGCAGCCCCGCGGGGCCAGG - Intergenic
961619965 3:128216428-128216450 GGGAGCAGCAGAGCTGTGCCTGG + Intronic
967055410 3:185825365-185825387 GGGCGCAGCGGCGCGGGGCGGGG - Intergenic
969073484 4:4558518-4558540 AGGAGCAGCCCAGTGGGGCCAGG - Intergenic
969128115 4:4969111-4969133 GGGAGGAGCAGAGCTGGGCCTGG - Intergenic
969339783 4:6532843-6532865 GGCAGCAGCACCGGGGGGCCAGG + Intronic
969490967 4:7499002-7499024 GGGGGCAGCACCGTGGAGACGGG + Intronic
973197624 4:47463548-47463570 GGGGGAAGCGGCGCGGGGCCTGG - Intronic
973613543 4:52658857-52658879 GGGCGCAGCAGCGCGGCCCCGGG + Intronic
974781762 4:66561751-66561773 GGGAGCAGCCCTGCCGGCCCCGG - Intergenic
975983586 4:80184240-80184262 GGCGCCAGCACCCCGGGGCCGGG + Intronic
976178126 4:82374323-82374345 GGGAGCAGCAGCGTTAGGCCGGG + Intronic
976700562 4:87965748-87965770 GACAGCAGCAACGCGGGGCCAGG - Intergenic
980701807 4:136442049-136442071 GGGAGCAGCACAGTTGGGCATGG + Intergenic
982746015 4:159104090-159104112 GGCAGCAGCGGCGCTGGGCCGGG + Intergenic
984762748 4:183376792-183376814 TGGGGCAGCACCGCAGGGGCCGG - Intergenic
985575897 5:673408-673430 GGGGGCAGCCCTGGGGGGCCAGG + Intronic
985657097 5:1137835-1137857 GGCACCAGCTCCCCGGGGCCTGG + Intergenic
985710359 5:1424369-1424391 GGGAGCAGAACGACGGGGACTGG - Intronic
985997116 5:3603039-3603061 CGGAGCTGCTCCCCGGGGCCCGG - Intergenic
988547650 5:32173764-32173786 GGGGGCGGCGGCGCGGGGCCCGG - Intronic
989011464 5:36876919-36876941 GGGGGCATCGCCGCGGGCCCGGG - Exonic
990448989 5:55917985-55918007 GGAAGCAGCAGGGCAGGGCCTGG + Intronic
992069851 5:73138276-73138298 GGGAGCAGCACGGAAGAGCCGGG + Intergenic
995724584 5:115169937-115169959 GGGCGGGGCACCGCGGGGCGTGG + Intronic
997120069 5:131164825-131164847 GAGTGCCGCACCGCGGGGCCTGG - Intronic
997214033 5:132095656-132095678 GGGAGCAGCACAGAGGTGCCCGG + Intergenic
997473240 5:134128379-134128401 GGCAGCAGCACCCCAGGGCCTGG + Intronic
998104477 5:139459706-139459728 GGGAGCAGCAGAGCCAGGCCAGG - Intronic
998173338 5:139885310-139885332 AGGAGGAGCACCACAGGGCCCGG + Intronic
1000369459 5:160520735-160520757 GGCAGCTGCTCCTCGGGGCCTGG + Intergenic
1001605739 5:172958750-172958772 GGGAGCGACCCGGCGGGGCCAGG + Intronic
1001683141 5:173573334-173573356 GGGAGCAGCAGCCCTGGGGCCGG + Intergenic
1001988045 5:176092562-176092584 GGGAGCAGCGAGGCGGGGCAAGG - Intronic
1002228823 5:177745578-177745600 GGGAGCAGCGAGGCGGGGCAAGG + Intronic
1002266523 5:178038205-178038227 GGGAGCAGCGAGGCGGGGCAAGG - Intronic
1002888315 6:1313913-1313935 CTGAGTAGCGCCGCGGGGCCCGG + Exonic
1004086321 6:12453019-12453041 GGCAGGAGCACCCCAGGGCCAGG - Intergenic
1005040314 6:21595051-21595073 GGGAGCAGCAACGCGGGGGGAGG + Exonic
1006460313 6:34154265-34154287 GGGAGCAGGACCGCGGTGAGGGG - Intronic
1007755386 6:44096052-44096074 GGGTGAAGCAGGGCGGGGCCTGG - Intergenic
1011622665 6:89257473-89257495 TGGAGCAGCCCCACGGGGTCTGG + Intronic
1011795367 6:90947242-90947264 GAGAGCAGCAACATGGGGCCAGG - Intergenic
1017012247 6:150070541-150070563 GGCAGCACCACCCCGAGGCCAGG + Intergenic
1017324561 6:153130902-153130924 GGGGGCCGCGCCGCGGGTCCGGG - Intronic
1018092434 6:160356556-160356578 GGGAGGAGCACTGAAGGGCCTGG + Intronic
1018705445 6:166460651-166460673 GGCAGCAGCAGGGCAGGGCCAGG + Intronic
1018774460 6:166999761-166999783 GGGGGCGGGACCGCGGGGCTTGG + Intronic
1018903636 6:168063304-168063326 GGGACCAGGACCCCGGGGCAGGG - Intronic
1018903687 6:168063452-168063474 GGGACCAGGACCCCGGGGCAGGG - Intronic
1019298807 7:292843-292865 GGGTGCATCACCACCGGGCCAGG - Intergenic
1019450159 7:1093485-1093507 AGGAGCAGCAGCGCTCGGCCCGG + Exonic
1019689902 7:2404525-2404547 GGGAACAGCACCGTAGGGCCTGG - Intronic
1020001172 7:4756824-4756846 GGGAGCAGCACCGAGGCACAGGG - Intronic
1020125066 7:5529096-5529118 GGGCGCAGCTCCGGGAGGCCAGG + Intronic
1020213550 7:6172205-6172227 AAGAGGAGCCCCGCGGGGCCAGG - Intronic
1020913178 7:14159144-14159166 GGGAGCAGAACAGCAGGACCTGG - Intronic
1023868941 7:44252446-44252468 GGGTGCAGCACAGAGGGGCAGGG + Intronic
1024628996 7:51231900-51231922 GGAAGCAGCACCTCGGGGGGAGG + Intronic
1025227327 7:57177115-57177137 GAGAGCAGCACCGTGGGGAAAGG + Intergenic
1029453689 7:100656393-100656415 GGGATCAGCACCGAGGCGGCCGG + Exonic
1031887123 7:127253976-127253998 GGGTGCAGGATCGGGGGGCCTGG - Intergenic
1032083067 7:128869665-128869687 TGGAGCTGCACAGCGCGGCCAGG - Intronic
1032844638 7:135742029-135742051 AGGGGCAGCACTGCTGGGCCTGG - Intronic
1034545315 7:151785328-151785350 GGGACCAGCCCCGCGGGCACTGG - Intronic
1035534866 8:383314-383336 GGAAGCAGGAACGCAGGGCCGGG + Intergenic
1035598722 8:882324-882346 GGGAGCGGTGCCGCTGGGCCAGG - Intergenic
1035672783 8:1432949-1432971 GTCAGCAGCACAGCGGGCCCTGG - Intergenic
1035928793 8:3758734-3758756 GAGAGCAGGACCTCGGGGCTTGG - Intronic
1037581076 8:20246418-20246440 GTGAGCAGCCCCGCTGGCCCAGG + Exonic
1037820022 8:22130921-22130943 GGGCGCAGCACCGCGCAGCGCGG + Exonic
1039527820 8:38231918-38231940 CGGCGCAGCGCTGCGGGGCCGGG + Intronic
1041307551 8:56478223-56478245 GGGACCAGCAGCTCCGGGCCGGG - Intergenic
1041466631 8:58163736-58163758 GAGAGCACCACAGCAGGGCCAGG + Intronic
1042246406 8:66712812-66712834 GGGAGCAGCACCGCGGGGCCAGG + Intronic
1042591598 8:70403040-70403062 GCGAGCTGCAGCGCGGGGCGGGG - Intronic
1042962915 8:74321643-74321665 GGCGGGAGCGCCGCGGGGCCGGG - Intronic
1049411136 8:142474508-142474530 GGCAGCAGCACCAGGGGGCCGGG - Intronic
1049585063 8:143429221-143429243 GGGGCCAGCACGGCCGGGCCGGG + Exonic
1054798682 9:69325568-69325590 GCGGGCAGCAGCGCGGAGCCCGG - Intronic
1056413468 9:86354548-86354570 GGGCGGGGCACCGCGGGGCGGGG - Intergenic
1056443367 9:86641754-86641776 GGCAGCAGCATCCCAGGGCCTGG - Intergenic
1057217380 9:93236600-93236622 AGAAGCAGCAGGGCGGGGCCAGG - Intronic
1057605778 9:96496892-96496914 GGCAGCAACAGCCCGGGGCCAGG + Intronic
1057704491 9:97387580-97387602 GGGAGGGGCAGGGCGGGGCCAGG - Intergenic
1060794271 9:126503887-126503909 GGGAGCAGCACCCCTGCCCCCGG + Exonic
1061015944 9:127980836-127980858 GGGACCCGCGCCGCGGGCCCCGG + Intergenic
1061128039 9:128689177-128689199 CGGAGCATCCGCGCGGGGCCTGG + Intronic
1061261438 9:129482816-129482838 GGGAGTCACCCCGCGGGGCCCGG + Intergenic
1061721823 9:132556653-132556675 AGGCGGTGCACCGCGGGGCCAGG - Intronic
1061898089 9:133658840-133658862 GGGAGCAGCGGGGCGGGGGCGGG - Exonic
1062084617 9:134642230-134642252 GGGGGCAGCAGCGGGGCGCCCGG - Exonic
1062284951 9:135768702-135768724 GGGAGGGGCACCGTGGGGCCGGG + Intronic
1062309386 9:135927665-135927687 GGGAGCATCACGGGGAGGCCAGG - Intergenic
1062402446 9:136378498-136378520 GCCAGCAGCCCTGCGGGGCCAGG + Exonic
1203759302 EBV:3738-3760 GGGAGGAGCCCCACCGGGCCTGG - Intergenic
1187226132 X:17376400-17376422 CGGAGCGGCGCCGCGGGGCTGGG - Intronic
1192363285 X:70452480-70452502 GGCAGCGGCTGCGCGGGGCCTGG + Intronic
1194869087 X:99105349-99105371 GGGAGCAGGACTGCGGGACAGGG - Intergenic
1195200825 X:102548337-102548359 GTGAGAAGCAACGCGGGGCCAGG - Intergenic
1195942125 X:110175333-110175355 GGGAGGAGCCCCTGGGGGCCTGG + Exonic
1198388049 X:136147420-136147442 GGAAGCAGGAGCGCGGGGGCGGG - Exonic
1198533455 X:137566293-137566315 GTGCACAGAACCGCGGGGCCAGG - Exonic
1199196904 X:145042222-145042244 GGCAGCAGCACAGCAGGGGCAGG - Intergenic
1199724597 X:150568450-150568472 GGGAGCAGCTCCGAAGGGCGGGG - Intergenic
1200084832 X:153599025-153599047 GGGGCCTGCAGCGCGGGGCCCGG - Exonic
1200122991 X:153800073-153800095 GAGAGCAGCACTGAGGGGCCGGG + Intergenic