ID: 1042246430

View in Genome Browser
Species Human (GRCh38)
Location 8:66712873-66712895
Sequence CTCCGACGGCGGCCCGGGGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042246409_1042246430 28 Left 1042246409 8:66712822-66712844 CCGCGGGGCCAGGTAGGTGCGGG 0: 1
1: 0
2: 0
3: 25
4: 200
Right 1042246430 8:66712873-66712895 CTCCGACGGCGGCCCGGGGCGGG No data
1042246418_1042246430 4 Left 1042246418 8:66712846-66712868 CCGGCGGGAGGGTCCGCGCGCCC 0: 1
1: 1
2: 1
3: 17
4: 127
Right 1042246430 8:66712873-66712895 CTCCGACGGCGGCCCGGGGCGGG No data
1042246421_1042246430 -9 Left 1042246421 8:66712859-66712881 CCGCGCGCCCGGGACTCCGACGG 0: 1
1: 0
2: 0
3: 5
4: 78
Right 1042246430 8:66712873-66712895 CTCCGACGGCGGCCCGGGGCGGG No data
1042246413_1042246430 20 Left 1042246413 8:66712830-66712852 CCAGGTAGGTGCGGGGCCGGCGG 0: 1
1: 0
2: 3
3: 17
4: 239
Right 1042246430 8:66712873-66712895 CTCCGACGGCGGCCCGGGGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042246430 Original CRISPR CTCCGACGGCGGCCCGGGGC GGG Intronic
No off target data available for this crispr