ID: 1042250761

View in Genome Browser
Species Human (GRCh38)
Location 8:66754000-66754022
Sequence TCAGGGGCCTAGAGGGCAAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 156
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 143}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042250761_1042250768 -5 Left 1042250761 8:66754000-66754022 CCAATTGCCCTCTAGGCCCCTGA 0: 1
1: 0
2: 0
3: 12
4: 143
Right 1042250768 8:66754018-66754040 CCTGAGTCTTTTGGCAGTGCTGG No data
1042250761_1042250769 -2 Left 1042250761 8:66754000-66754022 CCAATTGCCCTCTAGGCCCCTGA 0: 1
1: 0
2: 0
3: 12
4: 143
Right 1042250769 8:66754021-66754043 GAGTCTTTTGGCAGTGCTGGAGG No data
1042250761_1042250770 6 Left 1042250761 8:66754000-66754022 CCAATTGCCCTCTAGGCCCCTGA 0: 1
1: 0
2: 0
3: 12
4: 143
Right 1042250770 8:66754029-66754051 TGGCAGTGCTGGAGGCTCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042250761 Original CRISPR TCAGGGGCCTAGAGGGCAAT TGG (reversed) Intronic
900286196 1:1901759-1901781 GCAGGGCCCAAGAGGGCAGTGGG - Intergenic
900302893 1:1986749-1986771 GCTGGGGCCTGGAGGGCACTGGG - Intronic
900602608 1:3509508-3509530 TCTGGGGCCTAGAGGGGTAGGGG + Intronic
901052478 1:6432272-6432294 TCAGGGGCTTAGTGGGGAAAGGG - Intronic
904975044 1:34449484-34449506 GCAGGGGACTAGTGAGCAATTGG + Intergenic
905894519 1:41536500-41536522 TCAGGGCACTAGAGGGGGATGGG + Intronic
907239777 1:53074971-53074993 GCAGGGGCATGGAGGGTAATAGG + Intronic
907707376 1:56844603-56844625 TCAGGGGGGTAGAGAGCATTAGG - Intergenic
914204766 1:145517511-145517533 TCAGGGGGCTGGTGGGGAATGGG - Intergenic
914483889 1:148090698-148090720 TCAGGGGGCTGGTGGGGAATGGG - Intergenic
915308359 1:154993938-154993960 TCAGGAGTCTTGATGGCAATTGG - Exonic
919098261 1:193062229-193062251 TCAGTGGTTTAGAAGGCAATTGG - Intronic
919939323 1:202275639-202275661 TCAAGGGCCCAGGGGGCAAGGGG - Intronic
922208592 1:223469924-223469946 ACAGGGGCCTGGAGGGCTGTTGG + Intergenic
923295100 1:232586955-232586977 TCATGGGCCTTGATGGTAATAGG + Intergenic
1064646536 10:17465387-17465409 TCGGGACCCTATAGGGCAATAGG - Intergenic
1067088561 10:43255231-43255253 TGAGGGGCCTGGAGGGCGCTGGG - Intronic
1067779027 10:49185392-49185414 TCAGGGGACTTGGGGGCTATGGG - Intronic
1070792173 10:79196054-79196076 TCAAAGGCCTAGAGAGCAAAGGG - Intronic
1072452855 10:95552817-95552839 CCACAGGCCTAGAGGTCAATGGG + Intronic
1073053941 10:100687202-100687224 CCAGGGGACCAGAGGGCAGTTGG - Intergenic
1073304003 10:102488521-102488543 TCAGGTGCCTCTAGGGCAAGTGG + Intronic
1077582125 11:3423241-3423263 TCAGGGGCCGAGAGGGAGCTGGG + Intergenic
1077779343 11:5308531-5308553 GCAGGGGCCCAAAGTGCAATTGG - Intronic
1079398590 11:20087027-20087049 TCAGAGGGCAAGAGGGCAAGAGG + Intronic
1080496179 11:32822446-32822468 TCAAGGGCCTAGATAGCATTAGG - Intergenic
1083476913 11:62921062-62921084 GGAGGGGTCTAGAGGGCAAGGGG - Intronic
1083953566 11:65970474-65970496 GCTGGGGCCTAGAGTGCAAGTGG + Intronic
1084239040 11:67806058-67806080 TCAGGGGCCGAGAGGGAGCTGGG + Intergenic
1086471227 11:87113670-87113692 TCAGGGGCCTAGGAGTCAAATGG - Intronic
1087495898 11:98890542-98890564 TCTGGGGTCTGGAGGACAATGGG + Intergenic
1087732321 11:101792925-101792947 TCAGGGACCTAGAGTACAGTGGG - Intronic
1087946153 11:104163237-104163259 TAGGGGACCTAAAGGGCAATAGG + Intronic
1090472810 11:126995518-126995540 TAAGGGGGCTAGAGGGGCATAGG - Intronic
1100741439 12:97597612-97597634 ACAGGGGCCTTGAGGTAAATCGG + Intergenic
1103335164 12:120183915-120183937 TTAGGGGCCTGGTGGGCAACTGG + Intronic
1108554976 13:51583757-51583779 TCAGCGGCCTCCAGGGCCATTGG - Intergenic
1109536535 13:63729460-63729482 TCAGAGACCTACAGGGAAATGGG - Intergenic
1110709131 13:78630580-78630602 TCTGGGGCCTATAGGTCAAAAGG + Intronic
1112033227 13:95475599-95475621 CCAGGGGCCCAGAGGCCATTGGG - Intronic
1113278077 13:108757122-108757144 TCAGGAACCTAGAGTGCAAAAGG + Intronic
1113504522 13:110806044-110806066 TCAGGGGCCTTGCAGGCATTTGG + Intergenic
1114198332 14:20499162-20499184 TCATGGACCTAGAGAACAATTGG - Intergenic
1118762691 14:68890341-68890363 TCAGGGGTCTAGGGGGCTAGGGG - Intronic
1119702872 14:76767349-76767371 AGTGTGGCCTAGAGGGCAATAGG - Intronic
1122811899 14:104293354-104293376 CCAGGGGCCTGGAGGGCCAGGGG + Intergenic
1122981922 14:105195946-105195968 TCAGTGGCCTCGAGTGCCATGGG + Intergenic
1126202135 15:45998645-45998667 TCAGGGGACTAGGTGGCAAGGGG - Intergenic
1126851840 15:52801831-52801853 ACAGGGGCCCGCAGGGCAATAGG - Intergenic
1127643027 15:60933148-60933170 TCATGGCACTAGAGGACAATTGG - Intronic
1129332794 15:74836427-74836449 TGGGTGGCCTAGAGGGCACTGGG + Exonic
1129426170 15:75464671-75464693 TCAGAGACCTAGAGGGAATTGGG - Exonic
1129960025 15:79675753-79675775 TCTGGGGCCTTGAGGGAACTGGG - Intergenic
1131080242 15:89528666-89528688 TCTGGGGCCTGGAGGACCATTGG - Intergenic
1132250561 15:100332845-100332867 TCGGGGCCCAAGAGGGCAAGTGG - Intronic
1133269106 16:4601993-4602015 CCAGGGACCTTGAGGACAATAGG - Intergenic
1136135636 16:28255411-28255433 TCAGGGGCCAGGAGGGCCTTGGG + Intergenic
1137308143 16:47225615-47225637 CCAGGAGGCTAGAAGGCAATAGG + Intronic
1137624686 16:49900192-49900214 CCAGGGGCCCAGAGGGCACCTGG - Intergenic
1139421058 16:66849793-66849815 ACAGGGGTCTAGGGGGCAGTGGG + Intronic
1139559794 16:67734790-67734812 ACAGGGGCCTAGAGTGAAGTGGG + Intronic
1141743818 16:85912817-85912839 TCCAGGGCGTTGAGGGCAATTGG + Intronic
1143412116 17:6715594-6715616 TCAGGGGGTTGGAGGGCAAGGGG - Intergenic
1143474410 17:7194488-7194510 ACAGGGCCCTGGAGGGCAAGTGG + Exonic
1143514425 17:7412284-7412306 TGAGGGGCCTTGAGGGCTGTGGG - Intronic
1147132106 17:38415637-38415659 TCAGGGGCGGGGAGGGCAGTGGG - Intergenic
1147458838 17:40555648-40555670 TCGTGGGCCTACTGGGCAATGGG - Exonic
1149278270 17:55070526-55070548 TCAAGGGCATAGAAGGCAATTGG + Intronic
1149896582 17:60433086-60433108 TCTGGGGTCTGGAGGGCAGTGGG + Intergenic
1151536964 17:74744630-74744652 TCAGGGGCTAAGAGTGCAAAGGG + Intronic
1151570385 17:74922873-74922895 TCAGGGGCCTCAAGGGCACTGGG + Intronic
1152558184 17:81065048-81065070 TCAGGGGCTTTGAGAGCAGTGGG - Intronic
1156538694 18:37888711-37888733 TCAGAGGACAAGAGGGCAAAGGG + Intergenic
1156563620 18:38158571-38158593 TAAGGTGCCTAGAAGGCAACTGG + Intergenic
1159970238 18:74642247-74642269 TCAGGGGACTTTAGGGCAAAGGG - Intronic
1160010748 18:75105717-75105739 TCAGGGGCCTGCAGGGGAACTGG - Intergenic
1161106188 19:2445201-2445223 TCAGGGGCCCAGAGGGGTCTGGG - Intronic
1161984341 19:7645458-7645480 TCTGGGGCCCAGAGGACACTGGG + Intronic
1166747374 19:45147703-45147725 GCAGGGGCCTGGGGGGCCATGGG + Intronic
1167373995 19:49101719-49101741 TCAGGGGCAAAGAGGGAACTGGG + Intronic
927864989 2:26582513-26582535 TCAGGAGCCTAGTGGGCTTTGGG + Intronic
929568158 2:43003126-43003148 TCAGGGCTCTAGGGAGCAATGGG + Intergenic
929758184 2:44785327-44785349 TCGGGGGCCAAGAAGGCAATGGG - Intergenic
931994765 2:67829286-67829308 GCATGGGCCTAGAGGCCAATTGG - Intergenic
934162866 2:89268996-89269018 TGAGGGGCATAGATGGCCATTGG - Intergenic
934204407 2:89913528-89913550 TGAGGGGCATAGATGGCCATTGG + Intergenic
936285565 2:111178736-111178758 TCAGGGGTCTGGAGGGAGATGGG - Intergenic
937098573 2:119251248-119251270 CCAAGGGCCTAGTGGGCAGTTGG - Intronic
943283832 2:185972017-185972039 TCATGGGCCTGGAGGGCATGGGG + Intergenic
945381899 2:209150280-209150302 TCAGTGGCCAAGAAGGTAATGGG + Intergenic
945948579 2:216017597-216017619 TCAGGTGCCCAGAGGGCTCTTGG - Intronic
946418902 2:219553941-219553963 GCTGGGGGCCAGAGGGCAATGGG + Intronic
949010781 2:241677179-241677201 CCAGGGGCGTAGAAGGCACTTGG + Intronic
1170298227 20:14852696-14852718 GCATAGGACTAGAGGGCAATGGG + Intronic
1172124152 20:32615176-32615198 ACAGGGGCCTAGCGGGGAATGGG - Intergenic
1172946788 20:38695576-38695598 TCAGGGGCACAGAGGGTAAGGGG + Intergenic
1175814458 20:61876280-61876302 ACAGGGGCCAAAAGGGCAGTGGG + Intronic
1175826151 20:61937671-61937693 GCAGGGGCCTGGAGGGGAACAGG + Exonic
1178604831 21:34027000-34027022 TCAGGGGCTGAGGGGGCAGTGGG - Intergenic
1179469908 21:41603553-41603575 ACAGGGGCCAAGGGGCCAATAGG + Intergenic
1179793851 21:43771030-43771052 TCAGGGGTCTGGAGGGGAAGTGG + Intergenic
1180917669 22:19500062-19500084 TCAGGGCCCAACAGGGCAGTGGG - Intronic
1183516590 22:38270455-38270477 AAAGGGGCCCAGAGGACAATAGG - Intronic
1185382822 22:50517997-50518019 TCAGGGGCCACCAGGGCCATGGG - Exonic
957846885 3:85748528-85748550 TCAGGGCCCTAGATGCAAATAGG + Intronic
960785996 3:121373328-121373350 TCAGGGCCCAAGAGGGCCAAAGG - Intronic
961299872 3:125915857-125915879 TCAGGGGCCGAGAGGGAGCTGGG - Intergenic
962418891 3:135209863-135209885 TCAGGAGGCTACGGGGCAATGGG + Intronic
962988888 3:140560609-140560631 TCAGGGACCCAGAGGCAAATCGG - Intronic
963017334 3:140838392-140838414 TGAGGGGCTTGGAGGGAAATGGG + Intergenic
963506474 3:146191163-146191185 TAAGAGGCCTAGAGGAAAATGGG + Intergenic
968614457 4:1571097-1571119 TCAGGGGCCAGGAGGGCCACAGG + Intergenic
968997784 4:3956123-3956145 TCAGGGGCCGAGAGGGAGCTGGG + Intergenic
969393877 4:6908664-6908686 TCTGGGGACTTGAGGGCAAGAGG - Intergenic
972455888 4:39254778-39254800 TCTGGGGGAAAGAGGGCAATGGG - Intronic
973338061 4:48976314-48976336 TCCGGTGCCTAGAGGGGCATAGG + Intergenic
976636007 4:87287037-87287059 TCTGGGGTCTGGAGGACAATGGG - Intergenic
980457805 4:133068788-133068810 TCAGTGGCTTAGGGTGCAATTGG + Intergenic
991247606 5:64524810-64524832 TAAGGGGCCTCGTGGGCAGTGGG - Intronic
999772791 5:154788172-154788194 TCAGGGGACTAGATGGTATTAGG + Intronic
1002644816 5:180647969-180647991 GGAGGGGCCCAGAGGGCAAGGGG - Intronic
1002718982 5:181246625-181246647 TATGGGGCCTTGGGGGCAATTGG + Intronic
1003965361 6:11247595-11247617 TCTGGGGCCTGGGGGGAAATGGG - Intronic
1004424491 6:15498117-15498139 ACAGGACCCTAGAGGGCTATGGG - Intronic
1004632414 6:17434633-17434655 TCAGGGGTATGGAGGGAAATGGG - Intronic
1005988218 6:30887088-30887110 CCCTGGGCCTAGAGGGCTATAGG + Intronic
1007694717 6:43724934-43724956 TGAGGGGCGCAGAGGGCAATTGG + Intergenic
1008311826 6:49985687-49985709 TCTGGGGCGTAGGGGGCAAGGGG - Intergenic
1009484295 6:64200162-64200184 TCAGGGGCTTACAGGGAAATGGG + Intronic
1011080513 6:83485749-83485771 TCAGGGGGCTGGGGGGCAATGGG + Intergenic
1011305625 6:85923208-85923230 TCAGGAGCATATAGGACAATTGG + Intergenic
1017823558 6:158065383-158065405 TCAGGGGCCAAGAGAGAAACTGG - Intronic
1019341745 7:511775-511797 TCAGGGGGCTGGAGGGCCATGGG + Intronic
1019607985 7:1919569-1919591 GCACGGGCCCAGAGGCCAATGGG + Intronic
1019773264 7:2896951-2896973 GGAGGGGCCGAGAGGGCAAGTGG - Intergenic
1019862338 7:3671049-3671071 CCAAGGGCCTAGAGCCCAATAGG - Intronic
1022018626 7:26376901-26376923 TCGGGGGCCTAGAAGGGAAAGGG - Intergenic
1026579161 7:71599600-71599622 TGAGGACCCTAGAGGGCACTTGG + Intronic
1028362690 7:89987959-89987981 TCAGGGGTCTAGAGGTCGGTCGG + Intergenic
1029202692 7:98849587-98849609 TCAGGGGCCCAGAGTGGGATTGG + Intronic
1031345366 7:120659103-120659125 TCAGGGGTCAAGAGTGCAAAAGG + Intronic
1031984554 7:128155115-128155137 TCAGGGGCTGACAGGGCCATCGG + Intergenic
1039909493 8:41813186-41813208 TAAGTGGCCCACAGGGCAATAGG + Intronic
1042250761 8:66754000-66754022 TCAGGGGCCTAGAGGGCAATTGG - Intronic
1047116000 8:121842504-121842526 TCTGGGGTCTGGAGGACAATGGG - Intergenic
1049337099 8:142092388-142092410 CCAGGAGGCTAGAGGGCAGTGGG - Intergenic
1056050234 9:82760931-82760953 TCAAGAGCCTAGAGGGCAACAGG - Intergenic
1057890358 9:98865224-98865246 CCAGAGGCCTAGAGAGCAAAGGG + Intergenic
1059624820 9:116051747-116051769 TCAGTGACCAAGAGGACAATCGG - Intergenic
1060157016 9:121327018-121327040 TGAGCAGCCTAGAGGGGAATGGG + Intronic
1060198803 9:121640039-121640061 ACAGGGGCCCAGAGGGCATGGGG + Intronic
1060207864 9:121693209-121693231 TCTGAGGCCCAGAGGGCAGTGGG - Intronic
1190065792 X:47240957-47240979 TGAGGGGACTACAGGGCAAGGGG + Intronic
1190107481 X:47570520-47570542 TCTGGGGCCTAGAGGGTTCTAGG - Intronic
1191663841 X:63677678-63677700 TCAGGGACCTAGATGGCAAGAGG + Intronic
1192070628 X:67936720-67936742 TCAGGGGCCCAGCTGGCAATTGG - Intergenic