ID: 1042252992

View in Genome Browser
Species Human (GRCh38)
Location 8:66775141-66775163
Sequence CCGCCCTCACCAATCACCAC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 198
Summary {0: 1, 1: 0, 2: 8, 3: 9, 4: 180}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042252992_1042252999 -7 Left 1042252992 8:66775141-66775163 CCGGTGGTGATTGGTGAGGGCGG 0: 1
1: 0
2: 8
3: 9
4: 180
Right 1042252999 8:66775157-66775179 AGGGCGGGGCCTGCCGCAGGGGG 0: 1
1: 1
2: 2
3: 49
4: 421
1042252992_1042252998 -8 Left 1042252992 8:66775141-66775163 CCGGTGGTGATTGGTGAGGGCGG 0: 1
1: 0
2: 8
3: 9
4: 180
Right 1042252998 8:66775156-66775178 GAGGGCGGGGCCTGCCGCAGGGG 0: 1
1: 1
2: 0
3: 59
4: 567
1042252992_1042253008 21 Left 1042252992 8:66775141-66775163 CCGGTGGTGATTGGTGAGGGCGG 0: 1
1: 0
2: 8
3: 9
4: 180
Right 1042253008 8:66775185-66775207 CCTGCAGGTTTGGCCCCCGCAGG 0: 1
1: 0
2: 0
3: 14
4: 184
1042252992_1042253005 6 Left 1042252992 8:66775141-66775163 CCGGTGGTGATTGGTGAGGGCGG 0: 1
1: 0
2: 8
3: 9
4: 180
Right 1042253005 8:66775170-66775192 CCGCAGGGGGCGGGGCCTGCAGG 0: 1
1: 1
2: 11
3: 82
4: 698
1042252992_1042253009 22 Left 1042252992 8:66775141-66775163 CCGGTGGTGATTGGTGAGGGCGG 0: 1
1: 0
2: 8
3: 9
4: 180
Right 1042253009 8:66775186-66775208 CTGCAGGTTTGGCCCCCGCAGGG 0: 1
1: 0
2: 1
3: 10
4: 158
1042252992_1042252996 -10 Left 1042252992 8:66775141-66775163 CCGGTGGTGATTGGTGAGGGCGG 0: 1
1: 0
2: 8
3: 9
4: 180
Right 1042252996 8:66775154-66775176 GTGAGGGCGGGGCCTGCCGCAGG 0: 1
1: 1
2: 2
3: 53
4: 427
1042252992_1042252997 -9 Left 1042252992 8:66775141-66775163 CCGGTGGTGATTGGTGAGGGCGG 0: 1
1: 0
2: 8
3: 9
4: 180
Right 1042252997 8:66775155-66775177 TGAGGGCGGGGCCTGCCGCAGGG 0: 1
1: 1
2: 1
3: 20
4: 289
1042252992_1042253000 -4 Left 1042252992 8:66775141-66775163 CCGGTGGTGATTGGTGAGGGCGG 0: 1
1: 0
2: 8
3: 9
4: 180
Right 1042253000 8:66775160-66775182 GCGGGGCCTGCCGCAGGGGGCGG 0: 1
1: 1
2: 5
3: 64
4: 634
1042252992_1042253006 11 Left 1042252992 8:66775141-66775163 CCGGTGGTGATTGGTGAGGGCGG 0: 1
1: 0
2: 8
3: 9
4: 180
Right 1042253006 8:66775175-66775197 GGGGGCGGGGCCTGCAGGTTTGG 0: 1
1: 0
2: 8
3: 76
4: 530
1042252992_1042253002 -2 Left 1042252992 8:66775141-66775163 CCGGTGGTGATTGGTGAGGGCGG 0: 1
1: 0
2: 8
3: 9
4: 180
Right 1042253002 8:66775162-66775184 GGGGCCTGCCGCAGGGGGCGGGG 0: 1
1: 0
2: 4
3: 78
4: 715
1042252992_1042253001 -3 Left 1042252992 8:66775141-66775163 CCGGTGGTGATTGGTGAGGGCGG 0: 1
1: 0
2: 8
3: 9
4: 180
Right 1042253001 8:66775161-66775183 CGGGGCCTGCCGCAGGGGGCGGG 0: 1
1: 0
2: 1
3: 61
4: 578

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042252992 Original CRISPR CCGCCCTCACCAATCACCAC CGG (reversed) Intronic
900995704 1:6122179-6122201 CTGGCCTCACCCATCACCATGGG + Intronic
901479276 1:9513446-9513468 CTGACCTGACCAATCAGCACTGG + Intergenic
902800930 1:18829566-18829588 ACTCCCTCACCCATCAACACTGG + Intergenic
910035722 1:82785167-82785189 CCTCCCCCATCACTCACCACAGG - Intergenic
915244974 1:154550397-154550419 CCTCCCTCCCCAGGCACCACTGG - Exonic
916854167 1:168733060-168733082 GCGCCCACACAATTCACCACTGG + Intergenic
920927857 1:210359577-210359599 CCGACCTGACCAATCAGCCCTGG + Intronic
924800805 1:247328826-247328848 TCCCCATCATCAATCACCACAGG + Exonic
1064939939 10:20723011-20723033 CAGCCCTCACCAGACACCAGAGG + Intergenic
1065918904 10:30374096-30374118 CTGCCCTCAGCAGTCACCCCTGG - Intronic
1069552685 10:69375565-69375587 CGGCCCTCAACCATCAGCACAGG - Intronic
1070131125 10:73656042-73656064 CCCCCCACACCACACACCACAGG + Exonic
1075715896 10:124555179-124555201 CACCCCTCACCCATCCCCACTGG - Intronic
1076856546 10:133118075-133118097 CCACCGTCCCCAATCAGCACTGG + Intronic
1083142465 11:60733417-60733439 CCCCCAACACCAATCACCCCTGG + Intronic
1083275446 11:61594564-61594586 CTGCCCTCACCCACCACCCCAGG - Intergenic
1084434329 11:69129996-69130018 CCGCCATAACCAATTACCACAGG - Intergenic
1085786475 11:79456062-79456084 CCGTCATCACAAATCACCAGGGG + Intergenic
1088315165 11:108499156-108499178 CGTCCCACAACAATCACCACCGG - Intergenic
1091884012 12:4003027-4003049 CCGCCCCCACATAGCACCACAGG + Intergenic
1095085389 12:38053903-38053925 CCCCCCTCCCCAACCTCCACCGG - Intergenic
1097196237 12:57243738-57243760 CCCCCCTCCCCAAACTCCACTGG + Exonic
1097291769 12:57922634-57922656 CCTCCCTCCCCAATAACTACTGG - Intergenic
1098363677 12:69680154-69680176 CCTCCCTCCCCAAACACCAAGGG + Intronic
1101736756 12:107469043-107469065 CAGCCCTCACCCATCAACAAGGG - Intronic
1102002390 12:109565540-109565562 TCCCACTCACCTATCACCACAGG - Intronic
1103123071 12:118396888-118396910 ACCCCCTCACCCCTCACCACAGG - Intronic
1104943979 12:132407468-132407490 CCGCCCACACCAAGCATCAGTGG - Intergenic
1105510383 13:21047189-21047211 CCGCCCTCAGCAGCCAGCACAGG + Intronic
1108459109 13:50647353-50647375 CTGCCCTCCCCTCTCACCACAGG - Intronic
1120172560 14:81260205-81260227 CAACTCTCACCAAACACCACAGG + Intergenic
1123469728 15:20541206-20541228 CTGCCCTCACCAGTTGCCACAGG - Intronic
1123472046 15:20562705-20562727 CTGCCCTCACCAATCACCCCAGG + Intergenic
1123472094 15:20562861-20562883 CCACCCTCACCAGTCATCCCTGG + Intergenic
1123645909 15:22437492-22437514 CCACCCTCACCAGTCATCCCTGG - Intergenic
1123645957 15:22437648-22437670 CTGCCCTCACCAATCACCCCAGG - Intergenic
1123648335 15:22459493-22459515 CTGCCCTCACCAGTTGCCACAGG + Intronic
1123667226 15:22617361-22617383 CCACCCTCGCCAATCATCCCTGG - Intergenic
1123667266 15:22617502-22617524 TTGCCCTCGCCAATCACCCCAGG - Intergenic
1123682924 15:22775624-22775646 CTGCCCTCACCAGTCACCCCAGG - Intronic
1123682961 15:22775773-22775795 CTGCCCTCACCGGTCACCCCAGG - Intronic
1123730006 15:23136192-23136214 CTGCCCTCACCAGTTGCCACAGG - Intronic
1123732350 15:23157696-23157718 CTGCCCTCACCAATCACCCCAGG + Intergenic
1123732398 15:23157852-23157874 CCACCCTCACCAGTCATCCCTGG + Intergenic
1123748176 15:23333674-23333696 CTGCCCTCACCAGTTGCCACAGG - Intergenic
1123750485 15:23355078-23355100 CTGCCCTCACCAATCACCCCAGG + Intronic
1123750533 15:23355234-23355256 CCACCCTCACCAGTCATCCCTGG + Intronic
1123762946 15:23446746-23446768 CTGCCCTCACCAGTCGCCCCAGG - Intronic
1124280540 15:28357526-28357548 CTGCCCTCACCAGTTGCCACAGG - Intergenic
1124282854 15:28378994-28379016 CTGCCCTCACCAATCACCCCAGG + Intronic
1124282902 15:28379150-28379172 CCACCCTCACCAGTCATCCCTGG + Intronic
1124299797 15:28532463-28532485 CCACCCTCACCAGTCATCCCTGG - Intronic
1124299845 15:28532619-28532641 CTGCCCTCACCAATCACCCCAGG - Intronic
1124302158 15:28554086-28554108 CTGCCCTCACCAGTTGCCACAGG + Intergenic
1124321067 15:28711928-28711950 CCACCCTCGCCAATCATCCCTGG - Intronic
1124321107 15:28712069-28712091 TTGCCCTCGCCAATCACCCCAGG - Intronic
1124334670 15:28848147-28848169 CTGCCCTCACCAGTCACCCCAGG - Intergenic
1124334708 15:28848296-28848318 CTGCCCTCACCGGTCACCCCAGG - Intergenic
1124481391 15:30083286-30083308 TTGCCCTCGCCAATCACCCCAGG + Intronic
1124487846 15:30135382-30135404 TTGCCCTCGCCAATCACCCCAGG + Intronic
1124522203 15:30413908-30413930 TTGCCCTCGCCAATCACCCCAGG - Intronic
1124536462 15:30552310-30552332 TTGCCCTCGCCAATCACCCCAGG + Intronic
1124542935 15:30604359-30604381 TTGCCCTCGCCAATCACCCCAGG + Intronic
1124562936 15:30791943-30791965 CCGCCCTCGCCAGTCATCCCTGG + Intergenic
1124592157 15:31063172-31063194 CTGCCATCACAAATCACCACAGG + Exonic
1124755683 15:32402939-32402961 TTGCCCTCGCCAATCACCCCAGG - Intronic
1124762189 15:32455282-32455304 TTGCCCTCGCCAATCACCCCAGG - Intronic
1124776440 15:32593786-32593808 TTGCCCTCGCCAATCACCCCAGG + Intronic
1124960419 15:34389436-34389458 CTGCCCTCGCCGATCACCCCGGG - Intronic
1124977048 15:34535657-34535679 CTGCCCTCGCCGATCACCCCGGG - Intronic
1126300988 15:47195956-47195978 CTGCCTTCACCCACCACCACTGG + Intronic
1129029062 15:72605441-72605463 CTGCCCTCAACAGTCACCCCAGG + Intergenic
1129474505 15:75775862-75775884 CTGCCCTCACCAACCACCCCAGG + Intergenic
1129838269 15:78727447-78727469 CTGCCCTCACCAATCACCCCAGG + Intronic
1129838316 15:78727602-78727624 CCACCCTCACCAGTCATCCCTGG + Intronic
1130260263 15:82348931-82348953 CTGCCCTCACCAGTCATCCCTGG - Intronic
1130260314 15:82349086-82349108 CTGCCCTTGCCAATCACCCCAGG - Intronic
1130268416 15:82430347-82430369 CTGCCCTTGCCAATCACCCCAGG + Intronic
1130268467 15:82430502-82430524 CTGCCCTCACCAGTCATCCCTGG + Intronic
1130280919 15:82519921-82519943 CTGCCCTTGCCAATCACCCCAGG + Intergenic
1130280970 15:82520076-82520098 CTGCCCTCACCAGTCATCCCTGG + Intergenic
1130472289 15:84236102-84236124 CTGCCCTTGCCAATCACCCCAGG + Intronic
1130472340 15:84236257-84236279 CTGCCCTCACCAGTCATCCCTGG + Intronic
1130479782 15:84350673-84350695 CTGCCCTTGCCAATCACCCCAGG + Intergenic
1130479831 15:84350828-84350850 CTGCCCTCACCAGTCATCCCTGG + Intergenic
1130483914 15:84387106-84387128 CTGCCCTTGCCAATCACCCCAGG + Intergenic
1130491939 15:84437301-84437323 CTGCCCTCACCAGTCATCCCTGG - Intergenic
1130491988 15:84437456-84437478 CTGCCCTTGCCAATCACCCCAGG - Intergenic
1130503553 15:84516341-84516363 CTGCCCTCACCAGTCATCCCTGG - Intergenic
1130503604 15:84516496-84516518 CTGCCCTTGCCAATCACCCCAGG - Intergenic
1130594587 15:85240738-85240760 CTGCCCTTGCCAATCACCCCAGG + Intergenic
1130594638 15:85240893-85240915 CTGCCCTCACCAGTCATCCCTGG + Intergenic
1131895646 15:97026619-97026641 TTGCCCTCAGCAATCACCTCTGG + Intergenic
1131915041 15:97255917-97255939 CAGCCATCACCCATCACCAGTGG - Intergenic
1132433958 15:101781734-101781756 CTGCCCTCACCAATTGCCCCAGG - Intergenic
1132910332 16:2307183-2307205 CTGCCATCACCAATCAATACAGG + Intronic
1135550894 16:23397481-23397503 CTGCCCTCCCCATTCACCCCTGG - Intronic
1135615561 16:23908178-23908200 CAGCTCTCACCAATCTCCAGAGG - Intronic
1135644741 16:24152069-24152091 TCTCCCTGACCCATCACCACCGG - Intronic
1135666610 16:24340860-24340882 CCTCCCTCACCTGTAACCACCGG + Intronic
1135993399 16:27230930-27230952 CCGCCCTCTCCAGACACCAAGGG + Intronic
1136458894 16:30397948-30397970 CCGCCCGCATCAAGCACCAGCGG + Exonic
1136518737 16:30783230-30783252 CCACCCTCATCAAGCACCAGCGG - Exonic
1138090977 16:54174456-54174478 CCACCGCCACCAATCAGCACTGG + Intergenic
1141863596 16:86734635-86734657 CCGCCCTCCCCCACCCCCACTGG + Intergenic
1143452234 17:7043010-7043032 ACGCCCCCAACCATCACCACGGG + Exonic
1144583144 17:16471369-16471391 CTGCCGTAACCAATGACCACTGG - Intronic
1148835926 17:50465739-50465761 TCGCCCTTACCAATAACCCCTGG - Exonic
1151821610 17:76499954-76499976 CCGCCTTTCCCAATCTCCACTGG - Intronic
1152432047 17:80253898-80253920 CCGCCGTCACAGATCACCCCAGG - Intergenic
1152892522 17:82890622-82890644 CCGCCCACACCACTCACGCCAGG - Intronic
1152929395 17:83102142-83102164 CCGCCCTCAGCAAACACCACAGG - Intergenic
1158156435 18:54430711-54430733 CCACCCTCACCTCTCACCACTGG - Intergenic
1162042585 19:7979653-7979675 CTGCCCTCACCAGCCCCCACCGG + Intronic
1162509813 19:11111324-11111346 CTGACCTCATCATTCACCACGGG - Intronic
1163264112 19:16207997-16208019 CCTCCCTCCCCAACCGCCACAGG + Exonic
1163667600 19:18610593-18610615 CAACCCTCAGCAACCACCACCGG + Intronic
1166014759 19:39971498-39971520 CCGACCTCACTAAGCACTACCGG - Intronic
1166496250 19:43305238-43305260 CCCCACTGACCAATCAGCACAGG - Intergenic
1166719994 19:44991153-44991175 CCGCCCTCACCCACCACACCTGG - Intronic
1166835953 19:45668174-45668196 CCGCCCCCTCCCATCACCCCGGG + Intergenic
926628325 2:15114184-15114206 CTGCCATCACCAAGTACCACAGG + Intergenic
930032993 2:47069613-47069635 CCTCCCACTCCCATCACCACAGG - Intronic
934904131 2:98184521-98184543 TCGTTCTCACCAGTCACCACTGG + Intronic
937221295 2:120344525-120344547 CCGCCCTCCCCAACCAGCAGAGG - Intergenic
941157804 2:162000414-162000436 CAGGCCTCACCAAGCAACACTGG + Intronic
944471191 2:200055313-200055335 CCGCCCCCACCACTCCTCACTGG + Intergenic
945065001 2:205940929-205940951 CTGCCGTCACAAAACACCACAGG + Intergenic
1170637587 20:18121929-18121951 CAGCCCTCACCAGACACCAGTGG + Intergenic
1173405083 20:42757410-42757432 CTGCCCTAAGCTATCACCACAGG + Intronic
1173885603 20:46456003-46456025 CAGCCCTCACCAAACATCAAAGG - Intergenic
1173979515 20:47212344-47212366 CTGCCATAGCCAATCACCACAGG + Intronic
1175856444 20:62123065-62123087 CGCCCCTCACCAAACACCGCCGG - Intronic
1178884393 21:36473846-36473868 CCTCCCTCACCAGTCTCCTCTGG - Intronic
1179146774 21:38774954-38774976 CCCCCATCACAAATCACCTCAGG + Intergenic
1180953360 22:19730679-19730701 CAGCCCTCACTGACCACCACTGG - Intergenic
1184697635 22:46149102-46149124 CTTCCCTCACCAAACACAACAGG + Intergenic
1184802182 22:46768116-46768138 CCGCCACCACCAGTGACCACTGG - Intronic
1184972757 22:48038363-48038385 CAACCCTCACTTATCACCACTGG + Intergenic
1185364692 22:50432089-50432111 CGGTCCTCACCAAACACCAGAGG - Intronic
950040377 3:9916028-9916050 CCGCCCTCCCCCATCAGAACAGG - Exonic
954622773 3:52005358-52005380 CTGCCCTCCCCAATCTCCCCTGG + Intergenic
956765779 3:72483054-72483076 CCGCCCCCACCCCTCACCTCGGG - Intergenic
957281427 3:78155361-78155383 CCCCCCTTACCCAACACCACTGG + Intergenic
961306321 3:125960706-125960728 ACACCTTCACCATTCACCACTGG - Intergenic
961330644 3:126135966-126135988 CTGCCCTCACCACACCCCACCGG - Intronic
961353501 3:126318961-126318983 CCTCCCTCTCCCATAACCACTGG + Intergenic
961515281 3:127428508-127428530 CTGCCTCCACCACTCACCACTGG + Intergenic
965495178 3:169389413-169389435 CCACCGTCACCAATATCCACTGG + Intronic
968597311 4:1492121-1492143 CCGCACTCACAAAGCATCACGGG - Intergenic
976412915 4:84737842-84737864 CGGCCCTCAGCAATCACCTGAGG + Intronic
979767852 4:124483460-124483482 CCTCCATCACCAATAAACACAGG + Intergenic
986000749 5:3628897-3628919 CGGCCCTCACCAGACACTACCGG + Intergenic
986393524 5:7306158-7306180 CTGCCCTCACCAGTCACCCCAGG - Intergenic
986393561 5:7306307-7306329 CTGCCCTCACCGGTCACCCCAGG - Intergenic
988214819 5:28258127-28258149 CCACACTCAACTATCACCACAGG - Intergenic
990604656 5:57396489-57396511 CCACCCACACCGATCACCCCAGG + Intergenic
993110140 5:83646692-83646714 CTTCCCTCACCCCTCACCACAGG - Intronic
996587538 5:125107345-125107367 CTGCCCTCTCCACTCCCCACAGG - Intergenic
1003538742 6:6999885-6999907 CCCCCCTCACTAAGCAGCACTGG + Intergenic
1006396911 6:33793485-33793507 CCGCCTTCCCCTATCACCAGAGG - Intergenic
1010794812 6:80106678-80106700 CCGCCATCCCCGCTCACCACCGG - Exonic
1011545461 6:88477837-88477859 CCGCCCTCAGCCATCAACAAGGG - Intergenic
1012802630 6:103851622-103851644 ACTCCCTCACCAATCTCCTCTGG - Intergenic
1014482174 6:121952282-121952304 CCTCGCTCACGAATTACCACGGG + Intergenic
1015448737 6:133339655-133339677 CTGCCCTGACCACTTACCACAGG - Intronic
1017242844 6:152189832-152189854 TAGCCTTCATCAATCACCACTGG - Intronic
1019157026 6:170046014-170046036 CCGCCCACACCATCCACCGCAGG - Intergenic
1019157038 6:170046054-170046076 CCGCCCACACCACCCACCGCAGG - Intergenic
1019157050 6:170046094-170046116 CCGCCCACACCACCCACCGCAGG - Intergenic
1019157062 6:170046134-170046156 CCGCCCACACCACCCACCACAGG - Intergenic
1024324856 7:48101626-48101648 CCACCCTGACCACTCACCAGGGG + Intronic
1024623375 7:51182959-51182981 CCTCCCTTCCCAAACACCACAGG + Intronic
1028971748 7:96867184-96867206 CCTCCCTTACCACTGACCACGGG - Intergenic
1029289847 7:99493997-99494019 CTGCCCTGACCAAGCACCAGAGG - Exonic
1031530044 7:122865069-122865091 ACTCCCTCACCACCCACCACAGG - Intronic
1033456924 7:141511470-141511492 CCCCCCTCCCCGATCCCCACCGG + Intergenic
1035037163 7:155902851-155902873 CAGCCCTCCCCAGTCACTACTGG - Intergenic
1042252992 8:66775141-66775163 CCGCCCTCACCAATCACCACCGG - Intronic
1044670310 8:94673729-94673751 CAGCTCTCACAAATCATCACTGG + Intronic
1045181168 8:99784455-99784477 GCGCTCTCACAAATCCCCACAGG + Exonic
1047308972 8:123676458-123676480 CCCCCATCACCACCCACCACAGG + Intergenic
1049297578 8:141851003-141851025 CTGCCATCATCAAGCACCACAGG - Intergenic
1052027792 9:23593180-23593202 CCGCCCTCACCAAACAACTGTGG + Intergenic
1053363139 9:37503759-37503781 CCACCCTCCCAAATCCCCACAGG - Intergenic
1060174335 9:121486394-121486416 CCACCATCCCCAATCACCAGGGG - Intergenic
1061065560 9:128275694-128275716 CCGCCCTCGCCAGTCGCCCCCGG - Intronic
1062393762 9:136344329-136344351 CTGCCCTCACAAAGCACCGCAGG + Intronic
1062451992 9:136619693-136619715 CCGGCCTCACCAGTGAACACAGG - Intergenic
1185880348 X:3734674-3734696 CTGCCTTCACCAAGTACCACAGG - Intergenic
1190232146 X:48590485-48590507 CTGACCTCACCACCCACCACTGG - Intronic
1190811007 X:53883396-53883418 CCGCCCTCCCCAACCAGCCCTGG + Intergenic
1199159080 X:144586652-144586674 CCCACCCCACCAACCACCACAGG + Intergenic
1200308836 X:155056833-155056855 CTGCCCTCACCAATAATCACAGG - Exonic
1202374116 Y:24218035-24218057 CTGCCCTCACCAGTCATCCCTGG - Intergenic
1202374163 Y:24218190-24218212 TTGCCCTTGCCAATCACCACAGG - Intergenic
1202496618 Y:25451930-25451952 TTGCCCTTGCCAATCACCACAGG + Intergenic
1202496665 Y:25452085-25452107 CTGCCCTCACCAGTCATCCCTGG + Intergenic