ID: 1042253013

View in Genome Browser
Species Human (GRCh38)
Location 8:66775200-66775222
Sequence GCGCCAGCTGCGCTCCCTGC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 357
Summary {0: 1, 1: 0, 2: 2, 3: 27, 4: 327}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042253013_1042253021 4 Left 1042253013 8:66775200-66775222 CCCGCAGGGAGCGCAGCTGGCGC 0: 1
1: 0
2: 2
3: 27
4: 327
Right 1042253021 8:66775227-66775249 GGGAGCTGGTGGCGCGGCGCAGG 0: 1
1: 1
2: 3
3: 28
4: 403
1042253013_1042253023 20 Left 1042253013 8:66775200-66775222 CCCGCAGGGAGCGCAGCTGGCGC 0: 1
1: 0
2: 2
3: 27
4: 327
Right 1042253023 8:66775243-66775265 GCGCAGGTCCCGGCCGAGTGTGG 0: 1
1: 0
2: 1
3: 7
4: 88
1042253013_1042253019 -2 Left 1042253013 8:66775200-66775222 CCCGCAGGGAGCGCAGCTGGCGC 0: 1
1: 0
2: 2
3: 27
4: 327
Right 1042253019 8:66775221-66775243 GCCGCTGGGAGCTGGTGGCGCGG 0: 1
1: 0
2: 4
3: 34
4: 366
1042253013_1042253017 -10 Left 1042253013 8:66775200-66775222 CCCGCAGGGAGCGCAGCTGGCGC 0: 1
1: 0
2: 2
3: 27
4: 327
Right 1042253017 8:66775213-66775235 CAGCTGGCGCCGCTGGGAGCTGG 0: 1
1: 0
2: 3
3: 21
4: 310
1042253013_1042253022 10 Left 1042253013 8:66775200-66775222 CCCGCAGGGAGCGCAGCTGGCGC 0: 1
1: 0
2: 2
3: 27
4: 327
Right 1042253022 8:66775233-66775255 TGGTGGCGCGGCGCAGGTCCCGG 0: 1
1: 0
2: 1
3: 7
4: 134
1042253013_1042253018 -7 Left 1042253013 8:66775200-66775222 CCCGCAGGGAGCGCAGCTGGCGC 0: 1
1: 0
2: 2
3: 27
4: 327
Right 1042253018 8:66775216-66775238 CTGGCGCCGCTGGGAGCTGGTGG 0: 1
1: 0
2: 4
3: 29
4: 319

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042253013 Original CRISPR GCGCCAGCTGCGCTCCCTGC GGG (reversed) Exonic
900005994 1:51801-51823 GCGCCATCTCGGCTCACTGCAGG - Intergenic
900131077 1:1087545-1087567 GCGCCAGCTGCGTCCGCTGTGGG - Exonic
900241942 1:1621370-1621392 GAGCCAGCTGCCTTCCCTGATGG + Intronic
900319891 1:2077682-2077704 GCCCCAGCTCCACTCCCTGGAGG + Intronic
900771869 1:4551854-4551876 GTACCAGCTGAGCTCCCTGTGGG + Intergenic
901084477 1:6602259-6602281 GCGCCTGCTGCGCTACCTGCGGG - Exonic
901139729 1:7020826-7020848 GCCCCAGCTCCGGTCCCTCCAGG - Intronic
901878742 1:12181691-12181713 GCTCGAGCTGCCCTCCCTGGGGG + Intronic
901890576 1:12260085-12260107 GCGCCATCTCCACTCACTGCAGG + Intronic
902403829 1:16172468-16172490 GTGCCAGCTCTGCTCCCTTCTGG - Intergenic
902454356 1:16521312-16521334 CTGCCAGTTGCCCTCCCTGCCGG - Intergenic
902478388 1:16699753-16699775 GCGACGGCTGCGCCGCCTGCGGG + Intergenic
902509886 1:16960817-16960839 ACGCCTGCTGGGCTCCCTGGAGG + Exonic
902612767 1:17607015-17607037 GGGCCAGCTGCGCCCCCTACTGG + Intronic
902626022 1:17676818-17676840 GCACCCACTGCTCTCCCTGCTGG + Intronic
902629658 1:17697092-17697114 GGGCCCGCTGCTCTCCATGCGGG + Exonic
903177327 1:21588926-21588948 GGGCCAGCAGAGCTCCCTGGTGG + Intergenic
903239920 1:21975930-21975952 GCGCCATCTTGGCTCACTGCAGG + Intergenic
903422973 1:23231851-23231873 GCGCCATCTCGGCTCACTGCAGG - Intergenic
903862664 1:26374291-26374313 CTGCCAGCTGTGCTCCCTCCTGG + Intronic
906527900 1:46507082-46507104 GGGCCTGCTGGGCTGCCTGCTGG - Exonic
907960020 1:59270165-59270187 GCCTCAGCTGAGCTCCCAGCCGG + Intergenic
909236227 1:73155420-73155442 GCGCCATCTCGGCTCACTGCAGG + Intergenic
912355258 1:109049571-109049593 GCGCCATCTCAGCTCACTGCAGG - Intergenic
915714741 1:157934192-157934214 GCGCCATCTCAGCTCACTGCAGG - Intergenic
918998468 1:191794453-191794475 GCGCCATCTCGGCTCACTGCAGG - Intergenic
919732570 1:200922608-200922630 GTGCCAGCTCGGCTCCCTGGGGG - Intergenic
919846043 1:201642829-201642851 GCGCCATCTCGGCTCACTGCAGG + Intronic
920436473 1:205950139-205950161 GCCCCAGCTGAGGTCCCAGCAGG - Intergenic
922703307 1:227774966-227774988 GGGCCAGCTGAGCTCACTCCAGG - Intronic
922784303 1:228275564-228275586 GCCGCAGCTGCGCACCCTCCCGG - Intronic
922915373 1:229253019-229253041 GCCCCGGCTGCTGTCCCTGCAGG + Intergenic
923391118 1:233515239-233515261 GCCCCAGCTCCGCCCCCCGCCGG - Intergenic
1062764290 10:49070-49092 GCGGCCCCTGGGCTCCCTGCCGG - Intronic
1063302752 10:4866700-4866722 GCGCCATCTCGGCTCACTGCAGG + Intergenic
1063417928 10:5889285-5889307 GGGCCGGCTGCGCGCCCTGAAGG - Exonic
1063450021 10:6144974-6144996 GCGCCGGGGGCGCTCCCCGCGGG - Intronic
1064613111 10:17124488-17124510 GCGCGATCTCCGCTCACTGCAGG + Intronic
1065019989 10:21495848-21495870 GGGGCAGCAGCGCCCCCTGCAGG - Exonic
1065112431 10:22453145-22453167 GCGCCATCTGGGCTTACTGCAGG - Intronic
1067467676 10:46513256-46513278 GGGCCAGCTGCTCTCCAGGCCGG + Intergenic
1067619510 10:47871349-47871371 GGGCCAGCTGCTCTCCAGGCCGG - Intergenic
1068808411 10:61226705-61226727 GCGCCATCTCAGCTCACTGCAGG - Intergenic
1069993554 10:72329241-72329263 CTGCCAGCTGGGGTCCCTGCAGG + Intergenic
1070327752 10:75399504-75399526 CCGCCAGCTGCGCCCCCACCAGG + Exonic
1071863605 10:89701535-89701557 GAGCCGGCTACGCTCCCTGGCGG + Intergenic
1072520948 10:96229712-96229734 ACTGCAGCTGCGCCCCCTGCTGG - Intronic
1073110953 10:101062741-101062763 GCGAGGGCTGCGCTCCCTGCCGG + Exonic
1073250982 10:102120203-102120225 GCCCCCGCTGCGCTCGCCGCCGG + Exonic
1073323633 10:102630178-102630200 GGAGCAGCTGGGCTCCCTGCTGG - Exonic
1077292114 11:1802289-1802311 GCGCCATCTCGGCTCACTGCAGG - Intergenic
1077435932 11:2539193-2539215 CCGCCAGGTGCGCCCCCTGAAGG + Intronic
1077530049 11:3090802-3090824 CCAGCAGCTGCCCTCCCTGCTGG - Intronic
1078359276 11:10655937-10655959 GCCCCAGCAGCCCTGCCTGCAGG + Intronic
1079430785 11:20387165-20387187 TCGCCAGCTGCACCCCCTCCAGG + Intergenic
1080566620 11:33515487-33515509 GCCCCAGCTGCGCAGACTGCTGG - Intergenic
1080800321 11:35604072-35604094 GCGCCATCTCGGCTCACTGCAGG - Intergenic
1083610150 11:64000580-64000602 GGGCCGGGTGCGCCCCCTGCCGG - Intronic
1084269047 11:68019503-68019525 GCGCCAGCTGGACTCCAAGCTGG + Intronic
1084424854 11:69079068-69079090 GCGCCACCTGGGCTCTGTGCTGG + Intronic
1085454048 11:76655916-76655938 GGGCCTGCTGGGCTCCCTGCTGG + Intergenic
1087485712 11:98757898-98757920 GCGCGATCTGGGCTCACTGCAGG + Intergenic
1089509628 11:118988188-118988210 GCGCGATCTGGGCTCACTGCAGG - Intergenic
1090183157 11:124718433-124718455 CCCCCCGCTGCGCTCCCGGCTGG + Intergenic
1090191893 11:124777072-124777094 GCGCCCTCTGCCCTCCTTGCAGG + Intronic
1090285483 11:125495913-125495935 GTCCCAGCTGCGCTCCCTGAAGG + Intronic
1091064283 11:132493997-132494019 TTGCCAGCTGTGCTCCCTGTAGG + Intronic
1091279711 11:134374934-134374956 ACGTCAGCTGCCCTCCCAGCCGG + Intronic
1092231423 12:6777811-6777833 GCCCCAGGTGCCCTCCCAGCAGG + Exonic
1092630257 12:10368809-10368831 GCTCCTGCTGCGAGCCCTGCTGG - Intergenic
1093367756 12:18324157-18324179 GCGCGATCTCCGCTCACTGCAGG - Intronic
1093984906 12:25519524-25519546 GCGCCATCTCGGCTCACTGCAGG - Intronic
1094476982 12:30848205-30848227 GCGCGATCTCCGCTCACTGCAGG + Intergenic
1094814092 12:34166779-34166801 GCGGCCCCTGGGCTCCCTGCTGG - Intergenic
1095102987 12:38202434-38202456 GCCCCAGCTCAGCTCCCTGCAGG - Intergenic
1096749826 12:53751674-53751696 GCCCCCGCTCCGCACCCTGCAGG - Intergenic
1099958833 12:89377503-89377525 GCGCCATCTTGGCTCACTGCAGG + Intergenic
1100254056 12:92863484-92863506 GCCCCAGATGAGCTCCCAGCTGG + Intronic
1102157397 12:110742444-110742466 TCGCCAGCTGCGGACCCTCCAGG - Intronic
1104857110 12:131907546-131907568 GCGCCACCTGGGCTGCCAGCCGG + Intronic
1104957149 12:132472525-132472547 GCTCCAGCTGCTCTCCCTAAGGG - Intergenic
1105378500 13:19864748-19864770 GCACCCGCTGCGGCCCCTGCGGG + Intergenic
1107016580 13:35712234-35712256 GTGACAGCTCCTCTCCCTGCTGG - Intergenic
1112400059 13:99068518-99068540 GCGCGATCTGGGCTCACTGCAGG - Intronic
1113325011 13:109272375-109272397 GTGACAGCTGCTGTCCCTGCTGG - Intergenic
1113876428 13:113597576-113597598 CGGCCAGCTGCCCTCCCTACAGG + Intronic
1114648643 14:24269536-24269558 GCCCCAGCTGCACCCCCAGCCGG - Exonic
1115752123 14:36504212-36504234 GCGCCCGCTGAGCTGCCCGCGGG - Intronic
1117029281 14:51652063-51652085 ACGCCCGCTGTGCCCCCTGCCGG + Intronic
1117580416 14:57145660-57145682 GCGCAATCTCCGCTCACTGCAGG - Intergenic
1122117461 14:99535043-99535065 GTGGGAGCTGTGCTCCCTGCTGG + Intronic
1122226835 14:100285389-100285411 GCGGCGGCGGCGCACCCTGCGGG - Intergenic
1122296698 14:100709873-100709895 GAGCCCGCCGCGCCCCCTGCCGG - Intergenic
1122879538 14:104683975-104683997 GCACCAGATGGGCTCCCTGGAGG - Intergenic
1123061504 14:105596810-105596832 TCGGCAGCTGCTGTCCCTGCAGG + Intergenic
1123085953 14:105717721-105717743 TCGGCAGCTGCTGTCCCTGCAGG + Intergenic
1123837120 15:24206320-24206342 GCGCGATCTGGGCTCACTGCAGG - Intergenic
1124370528 15:29102402-29102424 TCACCAGCAGCGCCCCCTGCTGG - Intronic
1124507874 15:30294546-30294568 GCCCCAGCTGCTTTCCCTGATGG + Intergenic
1124527469 15:30470853-30470875 GCACCGGCTGCGCTTCCTGGTGG + Intergenic
1124735681 15:32244111-32244133 GCCCCAGCTGCTTTCCCTGATGG - Intergenic
1124771184 15:32536830-32536852 GCACCGGCTGCGCTTCCTGGTGG - Intergenic
1126150866 15:45522714-45522736 GCGCCCGCCGCGCCCGCTGCTGG + Exonic
1128089790 15:64911790-64911812 GGGGCAGCTGCGCTCCTAGCAGG + Intronic
1128496611 15:68201826-68201848 GACCCAGCTGGGCTTCCTGCTGG + Intronic
1128706000 15:69837818-69837840 ACGCCTGCTCTGCTCCCTGCTGG + Intergenic
1129533649 15:76291687-76291709 GCGCCATCTCGGCTCACTGCAGG - Intronic
1129880365 15:79002801-79002823 GCCCCAGCTGTGCCCTCTGCTGG + Intronic
1129996009 15:80006843-80006865 GCACCTGTTGGGCTCCCTGCTGG + Intergenic
1130317591 15:82809801-82809823 GCACCGGCTGCGCTTCCTGGTGG + Exonic
1131044476 15:89302633-89302655 GCGCCATCTCAGCTCACTGCAGG + Intronic
1131514000 15:93065663-93065685 GGGCCTGCTGCCCTCTCTGCTGG + Intronic
1132017165 15:98328245-98328267 GCGCCATCTCGGCTCACTGCAGG - Intergenic
1132228975 15:100167911-100167933 GCCCGAGCTGCTCTCCCTTCTGG + Intronic
1132447521 15:101939122-101939144 GCGCCATCTCGGCTCACTGCAGG + Intergenic
1132581086 16:684936-684958 GGGGCTGCTGCGCTGCCTGCAGG + Intronic
1132602383 16:779470-779492 GAGCCACCTGAGCTCCCGGCCGG - Intronic
1132657771 16:1048513-1048535 TCCCCAGCTGCGCTCCCTCCCGG + Intergenic
1132695897 16:1201889-1201911 GCGCCAGCGGCTCTGCCAGCGGG - Exonic
1132987726 16:2776822-2776844 GCGCGAGCTGCGCTCGCCGCGGG - Intronic
1133003926 16:2867178-2867200 GCGCGATCTCCGCTCACTGCAGG + Intergenic
1133046334 16:3090320-3090342 GCACCAGCTGCGCTCGCACCCGG - Exonic
1133254602 16:4508953-4508975 GCGGCAGCTGCACTGCCTGATGG - Intronic
1136394840 16:29987224-29987246 GGGCCAGCAGCGCTGCCTGCAGG - Exonic
1136536379 16:30902281-30902303 GCGCCTGCTGCGCCGCCTGGAGG + Exonic
1139504789 16:67393461-67393483 TCCGCAGCTCCGCTCCCTGCCGG + Intronic
1141079132 16:81035743-81035765 GCGGCCGCGGCGCCCCCTGCCGG - Intergenic
1141206606 16:81937933-81937955 GAGCCAGCCGCCCTCCCTGGGGG + Intronic
1141344498 16:83232480-83232502 GCGCCAGCTGCACTCCAGCCTGG + Intronic
1141802110 16:86317151-86317173 CCAACAGCAGCGCTCCCTGCAGG + Intergenic
1142129085 16:88424612-88424634 GGGCCAGCTGAGCTGCCCGCTGG + Intergenic
1142300522 16:89255286-89255308 GCGCCATCTCGGCTCACTGCAGG + Intergenic
1142355923 16:89602027-89602049 ACCCCAGCTGAGCTCCCGGCTGG + Intergenic
1142440360 16:90094169-90094191 GCGGCCCCTGGGCTCCCTGCCGG + Intergenic
1142440545 16:90094849-90094871 GCCCCAGCTCAGCTCCCGGCAGG - Intergenic
1142638266 17:1270928-1270950 GCGCCAGCCCCGCGCCCCGCGGG + Exonic
1142967806 17:3592018-3592040 TGGCCAGCTGGGCTCCCAGCAGG + Intronic
1144144106 17:12380773-12380795 GCGCCATCTCAGCTCACTGCAGG + Intergenic
1144682698 17:17206022-17206044 CCGCCTGCTGCGTGCCCTGCTGG - Exonic
1144790005 17:17852399-17852421 GGGCCAGCTGAGCTCACTGAGGG - Intronic
1145267473 17:21387092-21387114 GCGCGATCTCCGCTCACTGCAGG - Intronic
1145992601 17:29088113-29088135 GCGCGATCTCCGCTCACTGCAGG + Intronic
1147879278 17:43643472-43643494 GCGCCAGGTGCGCCCCCGGTGGG - Exonic
1149263129 17:54900624-54900646 GCACCTGCAGCGCGCCCTGCGGG - Exonic
1150301237 17:64048930-64048952 GCCCCAGCTGCTCACCCCGCAGG - Intronic
1151478532 17:74356821-74356843 GCGCCAGCAGGGCCGCCTGCTGG - Exonic
1151481378 17:74371859-74371881 GGGCCAGCACTGCTCCCTGCAGG - Exonic
1151668422 17:75558511-75558533 GTGCCAGCTGGTCACCCTGCTGG + Exonic
1151674938 17:75592490-75592512 GCGGGAGCGGCTCTCCCTGCAGG + Intergenic
1151704961 17:75762653-75762675 GAGGCGGCTGTGCTCCCTGCTGG - Intronic
1151955108 17:77376273-77376295 GGACCAGCTGCACTCCCGGCGGG - Intronic
1152079014 17:78175024-78175046 GCTCCACCTGCCTTCCCTGCAGG - Intronic
1152439172 17:80295016-80295038 CCACCAGCTGCTCTACCTGCTGG + Intronic
1152656828 17:81523722-81523744 GTGCCTGCAGCCCTCCCTGCAGG - Intronic
1152669616 17:81594711-81594733 GCGCGATCTCGGCTCCCTGCAGG - Intronic
1152754330 17:82080848-82080870 GCTGAACCTGCGCTCCCTGCTGG - Exonic
1152957017 18:48711-48733 GCCCCAGCTCAGCTCCCGGCAGG + Intronic
1152957201 18:49389-49411 GCGGCCCCTGGGCTCCCTGCCGG - Intronic
1153107375 18:1542901-1542923 GCGCTATCTCCGCTCACTGCAGG - Intergenic
1155258005 18:24014949-24014971 GGGCCAGCTCCGCGTCCTGCAGG - Exonic
1155439037 18:25842282-25842304 GGGCCTGCTGCAGTCCCTGCTGG + Intergenic
1156236676 18:35212225-35212247 GCGCCACCTCGGCTCACTGCAGG + Intergenic
1157564090 18:48668133-48668155 GGGACAGCAGCCCTCCCTGCAGG + Intronic
1159392758 18:67814835-67814857 GCGCCATCTCGGCTCACTGCAGG - Intergenic
1159829991 18:73264522-73264544 GCGCGATCTTCGCTCACTGCAGG - Intergenic
1160193004 18:76730569-76730591 GCGCAATCTTGGCTCCCTGCAGG - Intergenic
1160248927 18:77184370-77184392 GCGCCATCTTGGCTCACTGCAGG + Intergenic
1160297456 18:77650963-77650985 GCGCCAGCACTGCCCCCTGCTGG + Intergenic
1160583165 18:79899111-79899133 GTTCCTGCTGCGCTCCCTGCAGG + Exonic
1160619299 18:80159842-80159864 GCGGCTGCTCAGCTCCCTGCGGG - Exonic
1160729167 19:632923-632945 ACGCCACCGGCGGTCCCTGCGGG + Exonic
1160748141 19:720922-720944 GCCCCAGCTCTGCTCCCTCCGGG + Intronic
1160780785 19:877099-877121 GCGGCACCTGCTCTTCCTGCTGG - Exonic
1160810021 19:1009263-1009285 GCGCCGCGTGCGCTTCCTGCTGG + Exonic
1160861236 19:1237979-1238001 GCCCCCGCTGCGCTCGCCGCTGG + Exonic
1161063545 19:2226925-2226947 GCGCGAACTGCGGTCCCGGCGGG - Exonic
1161233186 19:3185843-3185865 CCGCCAGCCGCGCTGCCTGTCGG - Exonic
1161264986 19:3359869-3359891 GCGCCAGCTCCGCCCCCAGCCGG - Intronic
1162477850 19:10911724-10911746 GGGCCGGCTGGGCTCCCCGCAGG - Intronic
1162534517 19:11254860-11254882 GCACCTGCTGTGCCCCCTGCTGG - Intronic
1162614491 19:11786405-11786427 GCGCCATCTCGGCTCACTGCAGG - Intergenic
1162968860 19:14168206-14168228 GCCCCTGCGGAGCTCCCTGCTGG - Intronic
1163574333 19:18101710-18101732 GCGCCATCTTGGCTCACTGCAGG + Intronic
1163703859 19:18800996-18801018 GCCCCAGCTGCGTCCCCTCCGGG + Intergenic
1164249563 19:23465244-23465266 GCGCCATCTCGGCTCCCTGCAGG - Intergenic
1164868856 19:31626785-31626807 CCCCCAGCTGCGCTCCTTCCAGG + Intergenic
1165450405 19:35879052-35879074 GCCCCATCTCCTCTCCCTGCAGG + Exonic
1165784244 19:38451888-38451910 GAGCAACCTGCCCTCCCTGCTGG + Intronic
1166043613 19:40217211-40217233 ACGCGCGCTGCGCTACCTGCAGG - Exonic
1166364651 19:42272380-42272402 GCGGCAGCTGCGGTCCCAGCGGG + Intronic
1167245818 19:48372587-48372609 GCGCCATCTCGGCTCACTGCAGG - Intronic
1167592090 19:50409567-50409589 GCGCCAGCTGCCGTCCATCCAGG - Exonic
1168293443 19:55368248-55368270 GCCCGAGCTGGGCACCCTGCAGG - Exonic
1168307356 19:55442752-55442774 GGGCCCGCTGCCCGCCCTGCTGG - Exonic
925370282 2:3339886-3339908 GCGCCATCTCGGCTCACTGCAGG - Intronic
925926788 2:8676702-8676724 GCACCACGTGCGCTCCCAGCTGG - Intergenic
926171560 2:10555961-10555983 GGGCCAGCTGGCCTCCCTCCGGG + Intergenic
931908290 2:66866859-66866881 GCACCAGCTGTGTTCCCTGATGG + Intergenic
933761974 2:85678816-85678838 GCACCAGCTGCCATTCCTGCAGG + Intergenic
937025354 2:118692969-118692991 GCCCCCGCTCCTCTCCCTGCAGG - Intergenic
940536151 2:154947584-154947606 GCACGAGCTGGGCTCACTGCAGG + Intergenic
943147983 2:184069718-184069740 GCGCCATCTCGGCTCACTGCAGG - Intergenic
945245206 2:207711545-207711567 GCTCCAGCCGCGCTCTCTCCCGG + Intronic
946414026 2:219530344-219530366 GCGCCATCTGCTGTCCATGCAGG + Intronic
947699440 2:232220245-232220267 GCGCCATCTTGGCTCACTGCAGG - Intronic
948798023 2:240414961-240414983 GCGCGATCTGGGCTCACTGCAGG - Intergenic
948887160 2:240890103-240890125 GGGGGAGCTGGGCTCCCTGCAGG - Exonic
949003660 2:241633067-241633089 GAGCCAGGTGTGCTGCCTGCGGG - Exonic
1168957749 20:1846456-1846478 GGGCCAGCTTGGCTCTCTGCAGG + Intergenic
1169170554 20:3461310-3461332 GCCCCAGCTGCTCCCCCTCCGGG + Intergenic
1170865513 20:20151766-20151788 GCGCCATCTCAGCTCACTGCAGG - Intronic
1171452931 20:25248482-25248504 GCGCCAGCGGGGGTCTCTGCGGG + Intronic
1172110674 20:32543102-32543124 GAGCCAGCTGAGCTCCGTGGTGG - Intronic
1172138206 20:32702346-32702368 GCGGCATCTCGGCTCCCTGCAGG - Intergenic
1172197500 20:33102116-33102138 GCCCATGCTGCTCTCCCTGCAGG - Intronic
1172661673 20:36573262-36573284 GCGCCTACTGTGCTCCTTGCCGG - Intergenic
1172859681 20:38038350-38038372 GCGCCAACTGCACTCCCACCTGG - Intronic
1172962087 20:38806475-38806497 GCGCCAGGAGCGCTCCCCTCTGG + Intronic
1174364307 20:50047186-50047208 GCCCCAGCTGGTGTCCCTGCCGG + Intergenic
1174497238 20:50956462-50956484 GCGCCATCTTGGCTCACTGCAGG - Intronic
1175222364 20:57424803-57424825 GCGCCATCTCAGCTCACTGCAGG + Intergenic
1175978938 20:62727459-62727481 GCGCCAGCTGGACTGCCGGCGGG + Intronic
1175990596 20:62786579-62786601 GGGCCACCTGGGCTCCCAGCAGG - Intergenic
1176030532 20:63009153-63009175 GCCCCTGCTGCGGCCCCTGCGGG + Intergenic
1176304974 21:5118556-5118578 GCACCTGCTGCTCTCCCTGTGGG - Intronic
1177200313 21:17946356-17946378 GCGCCATCTCGGCTCACTGCAGG - Intronic
1178486553 21:33023230-33023252 GCCCCAGCTGCGCGCGCTGGTGG + Intergenic
1178922487 21:36747783-36747805 GCGCCAGCCGCGCCCCGTCCCGG - Exonic
1179480746 21:41676753-41676775 GCGCCATCTCGGCTCACTGCAGG + Intergenic
1179852081 21:44143474-44143496 GCACCTGCTGCTCTCCCTGTGGG + Intronic
1180167305 21:46036763-46036785 GCTCCAGCTGCTCACCCAGCTGG - Intergenic
1182047276 22:27285093-27285115 GTGCAAGCTGCTCTCTCTGCTGG + Intergenic
1182702549 22:32252166-32252188 GCGCGATCTCCGCTCACTGCAGG - Intronic
1182820722 22:33213888-33213910 GCGCAATCTCCGCTCACTGCAGG + Intronic
1183042880 22:35196387-35196409 GCGCGATCTCCGCTCACTGCAGG - Intergenic
1183441378 22:37824978-37825000 GCGCACGCTGCGCTTCCTGTGGG + Exonic
1184745195 22:46452036-46452058 GGGCCGGCTGCGCTTCCTGGAGG - Intronic
1185141780 22:49106647-49106669 GAGCCAGCTGCAGTCCCTGGTGG + Intergenic
949111891 3:270822-270844 GCTCCAGCTGAGCTCCCAGTTGG - Intronic
950227780 3:11250102-11250124 GCGCGATCTCCGCTCACTGCAGG + Intronic
951708649 3:25568424-25568446 TCCCCAGCTGCCCTCCCTCCTGG + Intronic
953393433 3:42547599-42547621 CCGGCAGCTGCGCCCCCTGGTGG + Intergenic
953818432 3:46182967-46182989 GTGTAAGCTGTGCTCCCTGCTGG + Intronic
956149058 3:66222240-66222262 GCGCCATCTCGGCTCACTGCAGG + Intronic
956742092 3:72283123-72283145 GCCCCAGCTGAGCTCACAGCTGG + Intergenic
957203614 3:77166618-77166640 GCGCCATCTTGGCTCACTGCAGG + Intronic
958766412 3:98373333-98373355 GCGCGATCTCCGCTCACTGCAGG + Intergenic
960226541 3:115175801-115175823 GCGCGATCTCCGCTCACTGCAGG - Intergenic
961759374 3:129154179-129154201 GCGCCATCTCAGCTCACTGCAGG - Intronic
962318529 3:134373527-134373549 TCGCCCGCTGCGCTCTCTGAAGG + Intronic
963183342 3:142384208-142384230 GCGCCATCTCGGCTCACTGCAGG - Intronic
965780419 3:172279973-172279995 GCGCCATCTCAGCTCACTGCAGG + Intronic
968235034 3:197026428-197026450 GGGGCTGCTGGGCTCCCTGCGGG + Intronic
968756501 4:2418761-2418783 GCCCGAGGCGCGCTCCCTGCCGG + Intergenic
968783750 4:2603028-2603050 GCGCCATCTCAGCTCACTGCAGG + Intronic
969100584 4:4765320-4765342 GAGCAAGCTGAGGTCCCTGCTGG - Intergenic
970195084 4:13544436-13544458 GCCCCAGCTGCCCGCCCCGCCGG - Exonic
970536570 4:17036273-17036295 GCGCAATCTCCGCTCACTGCAGG + Intergenic
971944054 4:33251356-33251378 GCGCGATCTCTGCTCCCTGCGGG - Intergenic
972738255 4:41866132-41866154 GCGACACCTGCGCTGTCTGCTGG + Intergenic
973760404 4:54109786-54109808 GCGACCCCTGCGCTCCCAGCAGG + Intronic
974069365 4:57110201-57110223 GCCCCCGCTGGGCTGCCTGCTGG - Exonic
974783738 4:66589949-66589971 GCGCCATTTCCGCTCACTGCAGG + Intergenic
975892838 4:79049995-79050017 ACGCCAGCTTGGCACCCTGCCGG - Intergenic
978748471 4:112221777-112221799 GCTCCAGCTGAGCTCTCAGCTGG - Intergenic
982349599 4:154400239-154400261 GCGCAATCTCGGCTCCCTGCAGG - Intronic
983418122 4:167484095-167484117 GCGCCATCTTGGCTCACTGCAGG + Intergenic
983484619 4:168318653-168318675 CCGCGAGCTGCGCGCCCCGCGGG + Exonic
984221066 4:176976387-176976409 GCTCCAGCTGCTCTACATGCTGG - Intergenic
984930783 4:184845282-184845304 GGGCCAGATGCGCTCCCAGCTGG + Intergenic
985068335 4:186144681-186144703 GCGCCTTCCCCGCTCCCTGCCGG - Intronic
985441472 4:189984703-189984725 GCGGCCCCTGGGCTCCCTGCCGG - Intergenic
985493345 5:191724-191746 GACCCAGCAGCGCTCCCAGCCGG - Exonic
985770829 5:1809611-1809633 GCGTCAGCAGCCCTCCCTGCAGG + Intronic
987706811 5:21469278-21469300 GCGCCATCTCCACTCACTGCAGG + Intergenic
992656289 5:78913184-78913206 GCGCGATCTCCGCTCACTGCAGG + Intronic
994194948 5:96912127-96912149 GCGCGATCTGGGCTCACTGCAGG - Intronic
994514989 5:100760166-100760188 GTGCCATCTGGGCTCACTGCAGG + Intergenic
995279977 5:110323262-110323284 GCGCCAACTGAGCTACCAGCTGG - Intronic
995853909 5:116573819-116573841 GGGCCCGCTCTGCTCCCTGCTGG + Intronic
997353748 5:133249042-133249064 GAGCCTGCTGCTCTCTCTGCTGG + Intronic
998137385 5:139681311-139681333 GCGGCATGTGCGCGCCCTGCCGG + Exonic
998287485 5:140877177-140877199 GCGCCTCCTGCGCTGCCAGCCGG - Exonic
999881057 5:155864228-155864250 CCGCCTACTGCGCTCCCTCCTGG - Intergenic
1000463339 5:161547916-161547938 GCGCCAGCTCCGCACGCCGCGGG - Intronic
1001463874 5:171944513-171944535 GCGCGATCTCCGCTCACTGCAGG - Intronic
1001694448 5:173659651-173659673 GCTCCAGCTGAGCTCCCAGCTGG + Intergenic
1001928718 5:175658076-175658098 GCGCCGGCTGCGCTCCGGGCAGG - Exonic
1001954361 5:175838221-175838243 GCTACAGCTGCCCTCCATGCAGG - Intronic
1002279402 5:178121860-178121882 GCGCGTGCTGCGCTACCAGCGGG + Exonic
1002347936 5:178561073-178561095 GCCCCAGCCTCCCTCCCTGCAGG - Intronic
1002440846 5:179263576-179263598 GCGTGAGCTGCGCTCCTGGCCGG + Intronic
1002683724 5:180990483-180990505 GCCCCAGCGGAGCTCCGTGCTGG - Intronic
1003874179 6:10422218-10422240 GAGCCAGCTGCTCTCAGTGCGGG + Intergenic
1004811485 6:19268899-19268921 GCAGCAGCTGGGCTCCCAGCAGG - Intergenic
1004957431 6:20745037-20745059 GTGCCAGCTGTGAGCCCTGCAGG + Intronic
1007460446 6:42014304-42014326 GCGCCATCTCGGCTCACTGCAGG - Intronic
1007586839 6:42995920-42995942 GCGCCATCTCGGCTCACTGCAGG + Intronic
1011692910 6:89886586-89886608 GCGCCTGGTGCGCTCCTTGGTGG - Intergenic
1012991458 6:105930647-105930669 GCGCCATCTCAGCTCACTGCAGG + Intergenic
1014610629 6:123540579-123540601 GCGCCACCTGGGCTCACCGCAGG + Intronic
1015064961 6:129013373-129013395 GCGCGATCTCGGCTCCCTGCAGG - Intronic
1018172263 6:161152343-161152365 GCGCCAGCCCCGCTCCCTTCTGG - Intronic
1019514111 7:1432303-1432325 GTGCCAGGTGCGCTCCAGGCTGG - Intronic
1019533629 7:1516257-1516279 GCGCAATCTCCGCTCACTGCAGG + Intergenic
1019579182 7:1751601-1751623 TCTCCTGCTGGGCTCCCTGCTGG + Intergenic
1021860518 7:24901288-24901310 GCGCCATCTGGGCTCACTGCAGG - Intronic
1022172540 7:27843700-27843722 GCCCCAGCTGCGCTCCCTCCTGG - Intronic
1022360872 7:29655931-29655953 GCGCGATCTGGGCTCACTGCAGG - Intergenic
1022469790 7:30675114-30675136 GCCCCAGCTGCTCTCCTGGCAGG + Intronic
1023601203 7:41883324-41883346 GGGTCAGCGGCGCTCCCTGCAGG - Intergenic
1025091152 7:56065129-56065151 GCGCTATCTCCGCTCACTGCAGG - Intronic
1031372885 7:120988718-120988740 GCGCCCGCTGCACGCCCGGCGGG - Exonic
1032160080 7:129502988-129503010 GCGGCTGCTGCGCCCCCAGCAGG - Intronic
1034274797 7:149819400-149819422 GGGCCAGCAGCGCCGCCTGCGGG + Intergenic
1036479676 8:9128269-9128291 GCGCCATCTCGGCTCACTGCAGG + Intergenic
1037781130 8:21869799-21869821 GCGCCATCTCGGCTCACTGCAGG - Intergenic
1038575812 8:28702182-28702204 TCGCCTGCTGCCCTCCCCGCTGG + Intronic
1039746257 8:40430870-40430892 GCGCCATCTCGGCTCACTGCAGG + Intergenic
1040386424 8:46917830-46917852 GCGCCTGGCGCGCCCCCTGCTGG - Intergenic
1041071889 8:54133494-54133516 GCGCCATCTCGGCTCACTGCAGG - Intergenic
1042253013 8:66775200-66775222 GCGCCAGCTGCGCTCCCTGCGGG - Exonic
1042503745 8:69538020-69538042 GCGCCATCTCGGCTCACTGCAGG + Intronic
1043413926 8:80029734-80029756 TCCCCAGCAGCGCTCCCCGCTGG + Intronic
1046857455 8:119049474-119049496 GCGCAATCTGGGCTCACTGCAGG + Intronic
1049434242 8:142579169-142579191 GCCTCAGGTGGGCTCCCTGCCGG - Intergenic
1049509847 8:143021966-143021988 GGGCCAGCTGCCCTCACTTCTGG + Exonic
1049612990 8:143564252-143564274 GCGCCATCTCGGCTCACTGCAGG + Intergenic
1049629529 8:143645368-143645390 GCGCCATCTCAGCTCACTGCAGG - Intronic
1049688473 8:143948722-143948744 CCGCCAGCTGCCCGCCCTGCAGG + Intronic
1050028719 9:1363052-1363074 GCCCCAGCTGAGTTCCCTTCTGG - Intergenic
1050169183 9:2797606-2797628 GCGCCATCTCGGCTCACTGCAGG - Intronic
1052837681 9:33264190-33264212 GCGCCAGGTGGGCTCCATGCAGG - Intronic
1056457935 9:86781421-86781443 GGGCCAGGTGGTCTCCCTGCAGG + Intergenic
1057452302 9:95175666-95175688 CTGCCAGCTGCGCTTACTGCTGG + Intronic
1058397254 9:104568701-104568723 GCGCCATCTCGGCTCACTGCAGG - Intergenic
1058562692 9:106246658-106246680 GCGCCATCTCTGCTCACTGCAGG + Intergenic
1058705884 9:107637672-107637694 CCGCAGGCTGCGCTGCCTGCCGG + Intergenic
1059339906 9:113591828-113591850 GGGCCAGCAGCGCCCCCTCCTGG - Intronic
1060829373 9:126704157-126704179 CCGCCAGCTGACCACCCTGCAGG - Intergenic
1061492869 9:130955978-130956000 GTGACAGCTGCGCTCACTGCAGG - Intergenic
1061501992 9:131009304-131009326 GCGCCCGCAGCGCTGCCTGCCGG + Exonic
1062464074 9:136673548-136673570 GGTCCAGCTGAGCCCCCTGCAGG + Exonic
1062471932 9:136709947-136709969 CCTCCAGCTGAGCTCCCTGCAGG + Intergenic
1062584359 9:137242218-137242240 GCCCCAGCTCAGCTCCCTGCAGG - Intronic
1062740949 9:138175189-138175211 GCGGCCCCTGGGCTCCCTGCCGG + Intergenic
1062741146 9:138175921-138175943 GCCCCAGCTCAGCTCCCGGCAGG - Intergenic
1187008624 X:15256714-15256736 GCGCCATCTCGGCTCACTGCAGG - Intronic
1187163823 X:16786819-16786841 GCGCCCCCTGCCCTCCCTCCCGG - Intronic
1190076699 X:47322286-47322308 CCCCCAGCTGCTCTCCCAGCAGG - Intergenic
1194162498 X:90471686-90471708 GCGCCATCTCGGCTCACTGCAGG + Intergenic
1196925842 X:120632057-120632079 GCGCTATCTGGGCTCACTGCAGG - Intergenic
1198493088 X:137163411-137163433 GCCCCAGCTGAGCTCCCAGATGG + Intergenic
1199779162 X:151042429-151042451 GCGCCATCTCGGCTCACTGCAGG - Intergenic
1200593589 Y:5108683-5108705 GCGCCATCTCGGCTCACTGCAGG - Intronic
1201759001 Y:17518148-17518170 GCCCCAGCTCAGCTCCCTGCAGG + Intergenic
1201842554 Y:18387842-18387864 GCCCCAGCTCAGCTCCCTGCAGG - Intergenic