ID: 1042259762

View in Genome Browser
Species Human (GRCh38)
Location 8:66846271-66846293
Sequence TGTACAGGTTTCTGTACTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 171
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 158}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042259762_1042259765 23 Left 1042259762 8:66846271-66846293 CCCAGAGTACAGAAACCTGTACA 0: 1
1: 0
2: 0
3: 12
4: 158
Right 1042259765 8:66846317-66846339 GTTACTTTATTTATTTGAGATGG No data
1042259762_1042259767 25 Left 1042259762 8:66846271-66846293 CCCAGAGTACAGAAACCTGTACA 0: 1
1: 0
2: 0
3: 12
4: 158
Right 1042259767 8:66846319-66846341 TACTTTATTTATTTGAGATGGGG No data
1042259762_1042259766 24 Left 1042259762 8:66846271-66846293 CCCAGAGTACAGAAACCTGTACA 0: 1
1: 0
2: 0
3: 12
4: 158
Right 1042259766 8:66846318-66846340 TTACTTTATTTATTTGAGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042259762 Original CRISPR TGTACAGGTTTCTGTACTCT GGG (reversed) Intronic
905155889 1:35981360-35981382 TTTCCAGGTTTCTGTGCTCAAGG + Intronic
905376877 1:37527912-37527934 TTAACTGGATTCTGTACTCTTGG + Intergenic
909283637 1:73788504-73788526 TGTAAAGGTGTCTGTGATCTGGG + Intergenic
909505996 1:76390717-76390739 TAGACAGGTTTCTGTTTTCTTGG - Intronic
911135710 1:94437768-94437790 TGGAAAGGATTCAGTACTCTAGG + Intronic
911953334 1:104204854-104204876 TGCACAGGTTTCTTTAGTTTTGG + Intergenic
913131448 1:115841213-115841235 TGTCCAGGTTTCTGTCCAATAGG - Exonic
913132931 1:115859206-115859228 TGTAGATGTTTCTGTAGTGTTGG + Intergenic
915047095 1:153027104-153027126 TGTCCAACTTTCTGTGCTCTGGG + Intergenic
918385807 1:184006092-184006114 TGTACAGTTTTCTATGCTCTAGG + Intronic
921075647 1:211698533-211698555 GGTCCAGGTTTCTGTAATTTGGG + Intergenic
921949804 1:220917544-220917566 TGTAAAGGTATGTTTACTCTGGG - Intergenic
923513156 1:234670886-234670908 TGTGGAGGTTTCTTTTCTCTTGG + Intergenic
924377399 1:243427452-243427474 TGAATAGGTTTCTGTAGACTTGG + Intronic
1063470258 10:6278729-6278751 TGTACACATTTCTATCCTCTAGG + Intergenic
1069669712 10:70191466-70191488 TTTAAAAGCTTCTGTACTCTTGG - Intergenic
1071720651 10:88141232-88141254 TGTGCAAGTTTCTGTAGTCTAGG + Intergenic
1072578010 10:96718093-96718115 TCTATAGATTTCTCTACTCTGGG - Intronic
1073724920 10:106219312-106219334 TAGACAGGTTCCTGCACTCTGGG + Intergenic
1073901856 10:108231697-108231719 TTCACAGCTTTCTGTGCTCTGGG + Intergenic
1076080341 10:127574739-127574761 TGTATAGGATTCTGAACTTTAGG + Intergenic
1076294036 10:129370113-129370135 TGCACAGGTTTCTGTTTTGTTGG + Intergenic
1079001226 11:16758531-16758553 TGGACAAGATTCTGTGCTCTAGG + Intergenic
1082834380 11:57640785-57640807 AGTAGAGGGTTCTGTAGTCTTGG + Intergenic
1084009972 11:66342224-66342246 TGGACAGGCATCTGGACTCTGGG + Exonic
1084798060 11:71521941-71521963 AGTACATGTTGCTGTATTCTTGG + Intronic
1084798070 11:71522107-71522129 AGTACATGTTGCTGTATTCTTGG + Intronic
1084798082 11:71522273-71522295 AGTACATGTTGCTGTATTCTTGG + Intronic
1084798093 11:71522439-71522461 AGTACATGTTGCTGTATTCTTGG + Intronic
1084988950 11:72904853-72904875 TGTAGAGTTTCCTGTAGTCTGGG + Intronic
1086470629 11:87105760-87105782 TTTACAGATTTCTGTAGTGTTGG + Intronic
1087227186 11:95614385-95614407 TGTACAGGTTTGTGGAATATGGG - Intergenic
1089445103 11:118545713-118545735 TGGACAGGCTTGTTTACTCTGGG - Intronic
1089544275 11:119210908-119210930 TGTACACGGTTCAGTACTATTGG - Intronic
1092018475 12:5180112-5180134 TGTTCAGTTTTCAGGACTCTGGG - Intergenic
1092594918 12:9991468-9991490 TGTACAGTTTTCTGAATTATTGG + Intronic
1093337717 12:17928216-17928238 TGTACAGTTTTGTGTTTTCTAGG - Intergenic
1094281313 12:28742752-28742774 TTTAGAGGTTTCTCTAGTCTAGG + Intergenic
1094347565 12:29487522-29487544 TTGACAGATTTCTGTACTCAGGG + Intronic
1098135665 12:67399144-67399166 TGTTCAAGTGTCTGTACTCAGGG - Intergenic
1098576708 12:72050996-72051018 TATATAGGTTTTTGTAGTCTGGG - Intronic
1099765957 12:86984607-86984629 TGTAAAGTTTTCTGGACTGTAGG - Intergenic
1099774703 12:87110436-87110458 TGTACAGCTTTCTGTCTTTTGGG + Intergenic
1099844809 12:88016590-88016612 TTGACACATTTCTGTACTCTAGG - Intronic
1100403900 12:94256253-94256275 TGTCTGGGTTTCTGAACTCTAGG - Intronic
1100756625 12:97758296-97758318 TGTTCAGATTTCTGGAGTCTTGG - Intergenic
1102717806 12:114989291-114989313 TGGACAGCTGGCTGTACTCTAGG - Intergenic
1103430626 12:120882218-120882240 TATACAGGGTTCAGTACTATCGG + Intronic
1103454039 12:121050707-121050729 TGTGCAAGTTTCTGTCCTTTGGG - Intergenic
1105276673 13:18935140-18935162 TGCCCACGTTTCTGTACACTTGG + Intergenic
1107363813 13:39648426-39648448 TGGAAAGGTTTCTTTAGTCTTGG + Intergenic
1107906379 13:45065015-45065037 TCAACAGGTTTCTGTACTGCAGG + Intergenic
1109707931 13:66123400-66123422 TGTAAATGTTTCACTACTCTGGG + Intergenic
1110312347 13:74065582-74065604 TGTACTGTTTTCTGTAATATGGG + Intronic
1111524893 13:89455841-89455863 TGATCATGTTTCTGTCCTCTGGG + Intergenic
1118584447 14:67339531-67339553 TGTACAGGGATCTGTATACTCGG - Intronic
1118939963 14:70324705-70324727 TTTACAGAGTTCTTTACTCTAGG + Intergenic
1121515125 14:94544627-94544649 AGTACAGGTTTGTGTACGTTCGG - Intergenic
1122850374 14:104524956-104524978 TGGACAGGTTTCGTTTCTCTTGG - Intronic
1124654229 15:31495557-31495579 TCTTCAGGGTTCTGTGCTCTGGG + Intronic
1126591588 15:50345688-50345710 TGTACAGACATCTGTACTTTGGG - Intronic
1126835618 15:52661449-52661471 TGGACAGGTTGCTTTTCTCTGGG + Intronic
1130150936 15:81311010-81311032 TGCCCAGGTTTCTGGTCTCTAGG + Exonic
1130623576 15:85489809-85489831 TGTACAGGTGGCAGTACTGTTGG + Intronic
1130681533 15:86001250-86001272 TGTAGAGGTTGCTAAACTCTAGG - Intergenic
1135248106 16:20874872-20874894 TGCACATGTTAATGTACTCTGGG - Intronic
1137426169 16:48383290-48383312 GATACAGATTTCTGTAATCTTGG - Intronic
1144957026 17:19023825-19023847 TGAACTGGTCTCTGTACTCTGGG - Intronic
1145803512 17:27708089-27708111 TGTACAGGTTTCTTTGTCCTTGG + Intergenic
1147321442 17:39648586-39648608 GGTACAGGTTCCTTAACTCTGGG + Intronic
1149899393 17:60459867-60459889 TTTACAGATTTCTGTAACCTTGG - Intronic
1150011798 17:61511660-61511682 TGTCCAGCTTTCTTTACTTTGGG + Intergenic
1152504165 17:80736339-80736361 CGGACAGGTTTCTGTGCTTTGGG - Intronic
1155200664 18:23514914-23514936 TGTACAGTGTTCTGTAATATCGG + Intronic
1155412646 18:25563461-25563483 TGTACAGGTTTCTGAACTGGGGG - Intergenic
1155603962 18:27582268-27582290 TGCTCAGTTTTCTTTACTCTGGG - Intergenic
1155619568 18:27761982-27762004 TGTACATATTTATTTACTCTAGG + Intergenic
1156571556 18:38259911-38259933 TGTACAGTTTTCAGTCTTCTAGG + Intergenic
1157070427 18:44401146-44401168 TCCACAGGTGTCTGGACTCTTGG - Intergenic
1157482638 18:48065376-48065398 TAAACAGGTTTCTATACTATGGG - Intronic
1157560050 18:48639444-48639466 TGCCCAGGTTTCTGAACTCCAGG - Intronic
1158939900 18:62397944-62397966 TGTAAAGATTCCTGTGCTCTGGG + Intergenic
1159855412 18:73582108-73582130 TGTACTGGTTTATTTTCTCTTGG + Intergenic
1160035052 18:75292643-75292665 TGTACAGGTTTCTGAACATTTGG - Intergenic
1162253761 19:9470434-9470456 TGTACAGGTTTCTCTGAGCTGGG + Exonic
1165470595 19:36001975-36001997 TGTACAGTTTCCTGATCTCTTGG - Intergenic
1167320882 19:48796586-48796608 TGTACAGGATTCGGTGCACTGGG + Exonic
1168106809 19:54170522-54170544 TCTACAGATTTCAGTATTCTTGG - Intronic
925221939 2:2148744-2148766 TGAACAGGTTTCTCCACTATGGG + Intronic
928068865 2:28194462-28194484 TGGAGAGGTTTCTGTTTTCTTGG - Intronic
932011817 2:67985807-67985829 TGAAGAGATATCTGTACTCTTGG + Intergenic
935199678 2:100845364-100845386 TGTACAGGTTGCTGCAGGCTGGG + Intronic
936442520 2:112567323-112567345 TTTTCAGGTTTCTGTAATTTAGG + Intronic
937622661 2:124006813-124006835 TGTGCAGTTGTCTGTACTTTGGG - Intergenic
937851529 2:126640322-126640344 TGTACAGCTTTTTGTTTTCTGGG + Intergenic
938623066 2:133077824-133077846 TGGACAAGTCACTGTACTCTAGG - Intronic
939038114 2:137157268-137157290 TGGGCAGCTTTCTGTACTGTGGG - Intronic
941575047 2:167219599-167219621 TGCACAGGGTCCTGTACTCCAGG + Intronic
941940927 2:171036468-171036490 GGCACAGGTTTCTGTCCTCTAGG - Intronic
942886837 2:180935828-180935850 TGTATAGGTTTCTGAAAGCTTGG - Intergenic
945519878 2:210812760-210812782 TGTGTAGGTTTATGAACTCTGGG + Intergenic
947444466 2:230153405-230153427 TTGACTGGTTTCTGTACTCTGGG + Intergenic
1168865691 20:1084432-1084454 AGTAAAGGTTTCTTTACTGTAGG - Intergenic
1172595753 20:36149895-36149917 AGTACAGGTTTAGATACTCTGGG - Intronic
1174557966 20:51409751-51409773 TGTAGAATTTTCTGTAGTCTGGG - Intronic
1174811202 20:53647336-53647358 TGAGCAGGTTTCTGTCCTCTTGG - Intergenic
1175379400 20:58552492-58552514 TGTTAAGGTCTCTGTACTCCTGG - Intergenic
1176672626 21:9748719-9748741 TGTCCTGGTTTCAGTTCTCTTGG - Intergenic
1178149266 21:29775489-29775511 TGGACAGGCTTCTGCACTCCTGG + Intronic
960082441 3:113555482-113555504 TGTGCATTTTTCTGTATTCTTGG + Intronic
963273681 3:143309601-143309623 TTCTCATGTTTCTGTACTCTAGG + Intronic
964117476 3:153151331-153151353 TGTCCAGGTTCATGAACTCTGGG - Intergenic
966549543 3:181189106-181189128 TGGACAAGTTTTTGTCCTCTCGG - Intergenic
967011927 3:185443419-185443441 TGTACATGTTTATGTTTTCTTGG + Intronic
967698602 3:192565573-192565595 TGTATAGGTTTTTGTAGCCTAGG + Intronic
972246600 4:37251513-37251535 TCTACAGTTTTCTGCCCTCTGGG - Intronic
972871975 4:43311781-43311803 TGTCCAATTTTCTGTACCCTAGG + Intergenic
973606550 4:52592961-52592983 TGTACAGGCTTCTGTTCTGGGGG - Exonic
973868417 4:55138878-55138900 TTTAAAGGTGGCTGTACTCTGGG - Intergenic
975625405 4:76340968-76340990 TGTACAGCTTTTTGTGCTATGGG + Intronic
978120799 4:105077197-105077219 TGTAGACTTTTCTGTATTCTAGG + Intergenic
978577824 4:110203528-110203550 TGTACAGGTGCCTGTACAGTTGG + Intergenic
981790091 4:148526663-148526685 AGTACAGGTGTCTGTCCTCAAGG - Intergenic
982602902 4:157474193-157474215 TGTACAGGTTTCTTAACTTGTGG + Intergenic
983565691 4:169149070-169149092 TGGACAGTTTCCAGTACTCTAGG - Intronic
985402097 4:189603112-189603134 TGTCCTGGTTTCAGTTCTCTTGG + Intergenic
987999081 5:25326811-25326833 TGTAGTAGTTTCTGTATTCTTGG + Intergenic
991217583 5:64173069-64173091 TGTACAGTTTGCTGTATACTAGG - Intronic
991487059 5:67148440-67148462 TGCAGAGCTTTCTTTACTCTCGG + Intronic
997676493 5:135716956-135716978 TATACCGGTTTATGTACTATGGG + Intergenic
1000544749 5:162584268-162584290 TTTCCTGGTTTCTGTACTCAGGG + Intergenic
1001305930 5:170572751-170572773 TGCACATGTTTCTGTGCTATCGG + Intronic
1001459689 5:171900245-171900267 TGTATATGTTTATGTACTCATGG - Intronic
1012711822 6:102616753-102616775 TGTACAGGTTCCAGTACAATTGG - Intergenic
1014258271 6:119186100-119186122 TTTACAGTGTTCTGTGCTCTGGG - Intronic
1014359366 6:120457165-120457187 TGAACAGATTTCATTACTCTGGG + Intergenic
1014984848 6:127992056-127992078 TGTACAGGTTTCTCTTCTGAGGG + Intronic
1016224586 6:141719941-141719963 TTTACAAGTTTCTTAACTCTTGG + Intergenic
1022943535 7:35261023-35261045 TGCACATGTTTCTGGGCTCTGGG - Intergenic
1028484059 7:91339194-91339216 GGTACAACTTTCTGTACTTTGGG - Intergenic
1029608346 7:101613507-101613529 AGCACAGGTTTCTGTAGTCCAGG + Exonic
1033929287 7:146504196-146504218 TGTCCAGGTTTCTGCCCTGTGGG - Intronic
1034745199 7:153517971-153517993 TGGACTGGTTTCTGTAGTCAGGG - Intergenic
1035927766 8:3747136-3747158 AGTACAGGCTGCTGTGCTCTTGG - Intronic
1035968550 8:4222000-4222022 TGTACAGGTTTATGTGGTGTAGG - Intronic
1036635393 8:10546998-10547020 AGCATAGGATTCTGTACTCTTGG - Intronic
1038969423 8:32615921-32615943 TTTACACGTTTCTGTAATATAGG + Intronic
1039026836 8:33267756-33267778 TATACAGGGTTCTGTACCATTGG - Intergenic
1042220635 8:66470012-66470034 TGTCCAGGTTTCTGTAGCCTGGG - Intronic
1042259762 8:66846271-66846293 TGTACAGGTTTCTGTACTCTGGG - Intronic
1044727042 8:95202434-95202456 TATATAGGGTTCAGTACTCTTGG - Intergenic
1044948718 8:97415210-97415232 GGTGCAGGTTTGTGTACTCCAGG - Intergenic
1048301933 8:133258039-133258061 TGTACAGGTTTTTGTAGTCAGGG - Intronic
1051151926 9:14089766-14089788 TGTAAAGGTTTTTGTACTTTTGG - Intronic
1051809856 9:21036646-21036668 TGCACTGGTGTCTGTACACTAGG + Intergenic
1053119823 9:35538306-35538328 TAGACAGGCTTCTGTACACTGGG - Intronic
1056115459 9:83436973-83436995 TGAACAGTTTTCTGTTGTCTTGG - Intronic
1061279438 9:129588800-129588822 TGGACAGGCACCTGTACTCTGGG - Intergenic
1186897567 X:14019599-14019621 TGTACTGCTTTCTGTATACTAGG - Intronic
1187370487 X:18701729-18701751 TGGACAGGTTTCTTTACTGCAGG - Intronic
1187479440 X:19641787-19641809 TATACAGGTATATGTACACTTGG + Intronic
1187556033 X:20352470-20352492 TAAACAGGTTTCTTTACTGTGGG - Intergenic
1189303675 X:39970868-39970890 TGAACAGGTTTCTCTACTACAGG - Intergenic
1191762874 X:64663548-64663570 GGCACAGCTTTCTGTTCTCTGGG + Intergenic
1192425749 X:71074592-71074614 AGTACAGGTTACTGTAGACTGGG - Intergenic
1192932675 X:75824538-75824560 TGCACAGGTTTCTGAGCACTAGG - Intergenic
1194703887 X:97150726-97150748 TGTAAAGGTTTCTGTATTTATGG + Intronic
1195996322 X:110735311-110735333 TAAACAGGTTTCTTTACTATGGG - Intronic
1196193491 X:112817604-112817626 TGTACAGGTTTGAGGACTCTTGG - Intronic
1197306401 X:124847112-124847134 TGTACAGGTTTCTTTATTAAAGG + Intronic
1200848461 Y:7857542-7857564 TGTACTAGTTTCTTTCCTCTTGG - Intergenic