ID: 1042261052

View in Genome Browser
Species Human (GRCh38)
Location 8:66859519-66859541
Sequence GAGGCAGATGATGCATTCGT TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 135
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 121}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042261052 Original CRISPR GAGGCAGATGATGCATTCGT TGG Exonic
902198381 1:14815204-14815226 GAGGGAAATGCTGCAGTCGTGGG + Intronic
903067464 1:20708577-20708599 GAGGCAGCTGCAGCATTCATGGG + Intronic
904786949 1:32990330-32990352 GAGGCAGAGGATGCATTGAGTGG + Intergenic
905395807 1:37665656-37665678 GAGGAAGATGGTGAATTCATTGG + Intergenic
906594998 1:47068147-47068169 GAGGCAGATAAAGCATGAGTGGG + Intronic
908004218 1:59711787-59711809 GAGGGAGATGATTGATTCATGGG - Intronic
908679256 1:66641482-66641504 GAGGAAGATGAAGCATTTGTAGG - Intronic
909751318 1:79165205-79165227 GATGGAGATGATGAATTTGTTGG + Intergenic
911967680 1:104387977-104387999 GAGGCAGAGGATGGTATCGTCGG - Intergenic
912914729 1:113802757-113802779 GAGACAGACTATGCATTTGTGGG - Intronic
913219248 1:116646099-116646121 GAGGGAGATGCTGCAGTTGTGGG - Intronic
918925382 1:190779187-190779209 GAGTAAGATGATACATTTGTGGG + Intergenic
924464846 1:244290667-244290689 GAGGCAGGTGATGAATATGTTGG + Intergenic
1062984737 10:1757692-1757714 GAGGCAGATGAGCCCATCGTGGG + Intergenic
1067162892 10:43842330-43842352 GAGGGAGATGGTGCACTCGGGGG + Intergenic
1068449473 10:57166817-57166839 GTGGCAGGTGATGGAATCGTGGG - Intergenic
1069831420 10:71284492-71284514 CAGGTAGAAGATGCATTGGTGGG + Intronic
1074973839 10:118565134-118565156 GAGGCAGCTGAGGCAATCCTGGG + Intergenic
1080269536 11:30436405-30436427 GATGCAGATGCTGCAGTCTTGGG + Intronic
1080885340 11:36362838-36362860 GAGGCAAATGCTGCATGGGTGGG + Intronic
1085669437 11:78448753-78448775 GAGGAAGATGAGGCAATCCTTGG + Intronic
1091053865 11:132400627-132400649 GATCCAGATGATCCATTCTTTGG + Intergenic
1092242775 12:6845680-6845702 GCCGCAGATGATGCTCTCGTGGG - Exonic
1094527340 12:31240443-31240465 GAGGCATATGATTCCTTCTTCGG - Intergenic
1097343834 12:58469034-58469056 GAGGAAGATGAAGCATTCATGGG - Intergenic
1102628153 12:114252934-114252956 GAGGCAGAGGATGCAAGGGTAGG - Intergenic
1105546596 13:21355365-21355387 GGGACATCTGATGCATTCGTAGG + Intergenic
1105947005 13:25198590-25198612 GAGGCAGAGGGTGCATGCTTAGG - Intergenic
1106321368 13:28642556-28642578 GAGACAGATCATTCATTCTTAGG - Intergenic
1107104996 13:36633542-36633564 GAGGCCAATGATGGATTCATGGG + Intergenic
1107978795 13:45714686-45714708 GCGGGAGATTATGCATTTGTGGG - Intergenic
1113841122 13:113362420-113362442 ATGGGACATGATGCATTCGTGGG + Intronic
1114752822 14:25224675-25224697 GAAGCAGATGATCCTTTCATCGG - Intergenic
1115776640 14:36722508-36722530 GGGGAAGATGATGCATGTGTCGG + Intronic
1117993925 14:61461042-61461064 GAGGCAGCTAATGGCTTCGTGGG + Intronic
1119628452 14:76204309-76204331 CAGGTAGATGTTGCATTCTTGGG - Exonic
1120275315 14:82366211-82366233 GTGGCAGATGATGCAGTTTTTGG - Intergenic
1122891145 14:104732810-104732832 AAGGCAGCAGATGCAGTCGTGGG + Intronic
1126740562 15:51772603-51772625 GTGGCAGAGGATGCATCTGTGGG + Intronic
1135041525 16:19120947-19120969 GAGGAAGATGATTCAGTGGTGGG + Exonic
1135167959 16:20157098-20157120 GTGGCAAATGAGGCATTTGTTGG - Intergenic
1137786244 16:51140086-51140108 GTGGCAGATGATGCACTCATTGG + Exonic
1151694436 17:75706981-75707003 GCGGCAGATGGGGCATACGTGGG - Exonic
1152994853 18:396965-396987 GTGGTAGGAGATGCATTCGTGGG - Intronic
1155544841 18:26904261-26904283 GATGGAGATGAGGAATTCGTTGG - Intergenic
1156126597 18:33913281-33913303 GAGACAGATAATGTATTGGTAGG - Intronic
1156314190 18:35951994-35952016 GAGGCCCATGCTGCATTCCTTGG + Intergenic
1158255609 18:55545122-55545144 GAGGCAACTGATGCATACATAGG - Intronic
1158406111 18:57161146-57161168 GAGGCAGGTGATGAATTGCTAGG + Intergenic
1159431607 18:68359394-68359416 GAGGCAGAGGTTGCAGTGGTTGG + Intergenic
1166289132 19:41850586-41850608 GAGGCAGCTGAAGCCCTCGTGGG + Exonic
1166363870 19:42269014-42269036 TAGGCAGATCAGGCAGTCGTAGG + Intronic
1166422704 19:42651240-42651262 GAGTCAGATGATGTATTCCTGGG - Intronic
1166433192 19:42743331-42743353 GGGTCAGATGATGTATTCATGGG + Intronic
1166436291 19:42768558-42768580 GGGTCAGATGATGTATTCATGGG + Intronic
1166446164 19:42858586-42858608 GGGTCAGATGATGTATTCATGGG + Intronic
1166449152 19:42882535-42882557 GGGTCAGATGATGTATTCATAGG + Intronic
1166456039 19:42940047-42940069 GGGTCAGATGATGTATTCATGGG + Intronic
1166465827 19:43029316-43029338 GGGTCAGATGATGTATTCATGGG + Intronic
1166471967 19:43085516-43085538 GGGTCAGATGATGTATTCATGGG + Intronic
1166483106 19:43189342-43189364 GGGTCAGATGATGTATTCATGGG + Intronic
1166492735 19:43272380-43272402 GGGTCAGATGATGTATTCATGGG + Intergenic
1202638851 1_KI270706v1_random:64658-64680 GCTGCAGATGAAGCATTCTTGGG + Intergenic
928263343 2:29787592-29787614 AAGGGAGCTGATACATTCGTGGG + Intronic
928388405 2:30889099-30889121 GTTGCAGATGATTCATTCCTGGG + Intergenic
935064573 2:99636668-99636690 GAGGCAGATGCTGCATTCTGAGG + Intronic
935666186 2:105515135-105515157 GTGGCAGAAGGTGCATTTGTCGG + Intergenic
939604232 2:144233782-144233804 TAGGCAGTTAATGCATTCTTCGG - Intronic
940198747 2:151126705-151126727 GACACAGATGATACATTTGTAGG - Intergenic
941033874 2:160545107-160545129 GGGGGAGATGATGCATGTGTGGG - Intergenic
946417022 2:219544773-219544795 GAGCCAGATGATGCCTTCTGGGG + Exonic
1174609943 20:51790767-51790789 GTGGCAAATGAGACATTCGTTGG + Exonic
1174944467 20:54970164-54970186 AAGTCAGATGATACATTGGTGGG - Intergenic
1180820540 22:18824155-18824177 GAGGGAGATGCTGCAGTTGTGGG - Intergenic
1181206764 22:21258627-21258649 GAGGGAGATGCTGCAGTTGTGGG - Intergenic
1181914409 22:26268121-26268143 GAGGCAGAGAATGCATTGGAAGG - Intronic
1184781443 22:46651675-46651697 GTGGCAGGTCATGCATTTGTGGG + Intronic
1203220160 22_KI270731v1_random:36796-36818 GAGGGAGATGCTGCAGTTGTGGG + Intergenic
1203270666 22_KI270734v1_random:50030-50052 GAGGGAGATGCTGCAGTTGTGGG - Intergenic
950149208 3:10673184-10673206 CAGGCAGCCGATGCATTTGTGGG - Intronic
951287952 3:20838180-20838202 GAGGCAGACTATGCATGCATTGG + Intergenic
952500567 3:33957772-33957794 GAGGCAGAGGATGTATTTCTAGG + Intergenic
952831496 3:37568740-37568762 GAGGGAGATGAGGAATTTGTTGG - Intronic
955053957 3:55439837-55439859 GAGGCAGCTGGTGCATGAGTGGG - Intergenic
957625145 3:82646005-82646027 GATGGAGATTATGAATTCGTTGG + Intergenic
961666582 3:128496741-128496763 GTGGTAAATGATGCATTCGATGG - Intergenic
962682652 3:137815803-137815825 GAGGCAGATGATGACTTTGGAGG - Intergenic
965576963 3:170227309-170227331 CAGGCACATGATGCTGTCGTAGG + Intronic
975767863 4:77687930-77687952 TAAGCTGATGATGAATTCGTGGG + Intergenic
978528550 4:109691482-109691504 AAGGAAGATGGTGCATTAGTAGG - Intronic
982070213 4:151687814-151687836 GTGCCAGCTGATGCATTCCTGGG - Intronic
1202766198 4_GL000008v2_random:150517-150539 GCTGCAGATGAAGCATTCTTGGG + Intergenic
986645243 5:9910665-9910687 GAGGCTGATGAGGGGTTCGTGGG - Intergenic
986789499 5:11145898-11145920 GAGGAAGATGATGCATGTCTGGG - Intronic
987709114 5:21486620-21486642 GAGGGAGATGAGGAATTTGTTGG - Intergenic
988750498 5:34187533-34187555 GAGGGAGATGAGGAATTTGTTGG + Intergenic
989056539 5:37371209-37371231 GAGGCTGCTGATGCTTTCGAGGG + Intergenic
991738758 5:69650731-69650753 GAGGCAGATGAGGAATTTGTTGG + Intergenic
991759439 5:69905696-69905718 GAGGCAGATGAGGAATTTGTTGG - Intergenic
991787896 5:70212422-70212444 GAGGCAGATGAGGAATTTGTTGG + Intergenic
991790333 5:70230472-70230494 GAGGCAGATGAGGAATTTGTTGG + Intergenic
991815082 5:70505563-70505585 GAGGCAGATGAGGAATTTGTTGG + Intergenic
991818217 5:70526848-70526870 GAGGCAGATGAGGAATTTGTTGG + Intergenic
991838667 5:70780762-70780784 GAGGGAGATGAGGAATTTGTTGG - Intergenic
991880342 5:71212786-71212808 GAGGCAGATGAGGAATTTGTTGG + Intergenic
991882783 5:71230812-71230834 GAGGGAGATGAGGAATTTGTTGG + Intergenic
996442180 5:123504058-123504080 GAGCCAGATGTGGCATTTGTAGG + Intergenic
1000966158 5:167659172-167659194 GGAGCAGTTGATGCATTTGTTGG + Intronic
1001696361 5:173673323-173673345 GAGGAAGGTGAAGCATTTGTTGG - Intergenic
1003103171 6:3193183-3193205 GAGTCAGGTGGTGCATTCCTAGG + Intergenic
1003405096 6:5821396-5821418 GGGGCATCTGATGCATTGGTAGG - Intergenic
1003943723 6:11054013-11054035 GAGGTAGATGATGAATGCATTGG - Intergenic
1005548568 6:26893838-26893860 GAGGGAGATGAGGAATTTGTGGG + Intergenic
1005706372 6:28458137-28458159 GAGGAAGACTATGCATTTGTGGG + Intergenic
1009019324 6:57934945-57934967 GAGGGAGATGAGGAATTTGTTGG + Intergenic
1011558325 6:88591220-88591242 GAGGCAGATGCTGTCTTCGCTGG - Intergenic
1015591046 6:134823322-134823344 GAGGCAAATGATTGATTCCTGGG - Intergenic
1018178644 6:161201012-161201034 GAGCAAGATGATGCATTTGCAGG - Intronic
1028293503 7:89097855-89097877 AAAGCAGGTGATGCATTTGTAGG - Intronic
1035133430 7:156676435-156676457 CAGGCAGATGGAGCACTCGTGGG - Exonic
1035836109 8:2753868-2753890 GAGGCAGATGAAGCAAGGGTAGG + Intergenic
1038162350 8:25052008-25052030 GAGACGGATGATGGATTTGTAGG + Intergenic
1041642801 8:60220603-60220625 GGGGGAGATGATGCCTTCTTAGG - Intronic
1042261052 8:66859519-66859541 GAGGCAGATGATGCATTCGTTGG + Exonic
1045362714 8:101448081-101448103 GTGGCAAATGTTGCATTCTTTGG + Intergenic
1052565233 9:30141174-30141196 GTGGGAGATGATTCATTCATGGG - Intergenic
1058705585 9:107635599-107635621 GAGGCAGTTCCTGCATTCGTGGG + Intergenic
1059407378 9:114109643-114109665 GGGGCAGCAGTTGCATTCGTGGG + Intergenic
1059925868 9:119208618-119208640 AATGCAGATGGTGCATTTGTGGG - Intronic
1062673406 9:137724890-137724912 GGGACAGATGTGGCATTCGTTGG + Intronic
1203546946 Un_KI270743v1:135406-135428 GCTGCAGATGAAGCATTCTTGGG + Intergenic
1188979240 X:36712290-36712312 TAGGGAGGTGATGCATTTGTGGG + Intergenic
1190565990 X:51731349-51731371 GAGGCAGAAGGTGCTTTCCTGGG + Intergenic
1200715253 Y:6533125-6533147 GACGCATATGTTACATTCGTTGG + Intergenic
1200715315 Y:6534364-6534386 GACGCATATGTTACATTCGTTGG + Intergenic