ID: 1042271809

View in Genome Browser
Species Human (GRCh38)
Location 8:66962604-66962626
Sequence ATCAAACCCTCCGGCGGGGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 45
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 42}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042271798_1042271809 22 Left 1042271798 8:66962559-66962581 CCGGAGAGGCTACGCCGGGGGCT 0: 1
1: 0
2: 1
3: 5
4: 79
Right 1042271809 8:66962604-66962626 ATCAAACCCTCCGGCGGGGCGGG 0: 1
1: 0
2: 0
3: 2
4: 42
1042271795_1042271809 25 Left 1042271795 8:66962556-66962578 CCACCGGAGAGGCTACGCCGGGG 0: 1
1: 0
2: 1
3: 2
4: 48
Right 1042271809 8:66962604-66962626 ATCAAACCCTCCGGCGGGGCGGG 0: 1
1: 0
2: 0
3: 2
4: 42
1042271801_1042271809 8 Left 1042271801 8:66962573-66962595 CCGGGGGCTGAGGCGGCTTAGAG 0: 1
1: 0
2: 0
3: 15
4: 217
Right 1042271809 8:66962604-66962626 ATCAAACCCTCCGGCGGGGCGGG 0: 1
1: 0
2: 0
3: 2
4: 42
1042271793_1042271809 26 Left 1042271793 8:66962555-66962577 CCCACCGGAGAGGCTACGCCGGG 0: 1
1: 0
2: 0
3: 0
4: 41
Right 1042271809 8:66962604-66962626 ATCAAACCCTCCGGCGGGGCGGG 0: 1
1: 0
2: 0
3: 2
4: 42

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042271809 Original CRISPR ATCAAACCCTCCGGCGGGGC GGG Intergenic
901471095 1:9456924-9456946 TTCAAACCCTCTGCAGGGGCTGG - Intergenic
902987540 1:20164189-20164211 ACCAAACCCTGGGGCTGGGCTGG - Intronic
914677613 1:149916717-149916739 ATCAAAACGTCCGCGGGGGCGGG + Intronic
915456713 1:156045165-156045187 ATGAAACCCTACGGTGGGGAGGG - Intronic
920258849 1:204675194-204675216 AGCAATCCCTCCGGGGTGGCTGG + Intronic
1067077606 10:43197144-43197166 ACCAAACCCTCGGTCAGGGCAGG + Intronic
1072547434 10:96450392-96450414 ATAAGAACCTCCGGCGGGGGTGG - Intronic
1077299506 11:1840513-1840535 ATCACACTCTGCGGTGGGGCAGG - Exonic
1080798692 11:35589462-35589484 ATCAAAACCCCTGGCTGGGCTGG + Intergenic
1084034813 11:66502887-66502909 AACAAACACTCGGGCCGGGCGGG - Intronic
1107454964 13:40546424-40546446 AACAGACCCTCCGCGGGGGCTGG + Intergenic
1121236429 14:92394488-92394510 CTCAAACTCTCCTGCGTGGCTGG - Intronic
1202854540 14_GL000225v1_random:42553-42575 ATCAAAGCCTGCGGCGGGTGGGG - Intergenic
1124122925 15:26907426-26907448 ATCAAGTCCTGCTGCGGGGCAGG - Intronic
1128074280 15:64816586-64816608 ATGCCACCCTGCGGCGGGGCAGG - Exonic
1129518330 15:76170540-76170562 CTCTAACTCTCCAGCGGGGCAGG - Intronic
1132128374 15:99251191-99251213 ATCAAACCCCACGCCGGAGCCGG + Intronic
1138200926 16:55087781-55087803 ATCAAAGCCTCCAGCGAGGCTGG - Intergenic
1139478431 16:67215038-67215060 ATCAATCCCTCAGGCAGGGAGGG + Intronic
1139602555 16:67995341-67995363 ATAGAACCCTCCAGCAGGGCTGG - Intronic
1151966972 17:77436612-77436634 GTCACTCCCTCCAGCGGGGCAGG - Intronic
1157473668 18:48008265-48008287 AACAAAGCCCGCGGCGGGGCGGG - Intergenic
1160814490 19:1028837-1028859 ATCAAAGTTGCCGGCGGGGCGGG + Intronic
1161976925 19:7612261-7612283 CTCAGGGCCTCCGGCGGGGCCGG - Exonic
1165129245 19:33621927-33621949 AGCGAAGCCTCCGGCGAGGCTGG - Intergenic
1166317575 19:41997702-41997724 ACAGAAACCTCCGGCGGGGCAGG + Intergenic
944173405 2:196803074-196803096 ATCAAAACCTCCCGGGGGCCTGG - Intergenic
944800995 2:203238178-203238200 ATCAAACACTCGGGGTGGGCAGG - Intergenic
1175379652 20:58553971-58553993 ATCAGACCCTCTCGTGGGGCCGG - Intergenic
1179435881 21:41361788-41361810 ATCAGACTCTCTGGCGGGGGTGG + Intergenic
1185154808 22:49186912-49186934 TCCAAACCCTCCCGCGTGGCTGG - Intergenic
1185318016 22:50187104-50187126 ATCAGGGCCTCCGGCGAGGCTGG - Intronic
950127502 3:10518910-10518932 ATCATACTCTCCGGCCAGGCTGG + Intronic
978385170 4:108170876-108170898 ATCAAACCCTCAGGAGGGGGAGG + Intergenic
988508463 5:31844801-31844823 ATAAAACCATCTGGCAGGGCTGG + Intronic
991085531 5:62645325-62645347 ATCAAACACTCCTGTGGGTCAGG + Intergenic
997339529 5:133131991-133132013 ATCAAAGTCTCCAGCAGGGCCGG + Intergenic
1006003756 6:30986911-30986933 AGCACACCCTCCAGTGGGGCCGG + Exonic
1007022630 6:38537447-38537469 ATCAAAGACTCCTGCAGGGCAGG + Intronic
1026585691 7:71654318-71654340 ATAAAACCCTCCAGCCGGCCGGG - Intronic
1032451876 7:132038447-132038469 ATGAAACCCTGTGGCTGGGCAGG - Intergenic
1042271809 8:66962604-66962626 ATCAAACCCTCCGGCGGGGCGGG + Intergenic
1051343082 9:16129182-16129204 ATCAACCCCTCCGGAAGGGTGGG + Intergenic
1061309443 9:129752739-129752761 AGGAAGCCCCCCGGCGGGGCTGG + Intronic
1062618596 9:137409112-137409134 ATTAATCCCTCCAGTGGGGCAGG - Intronic