ID: 1042274641

View in Genome Browser
Species Human (GRCh38)
Location 8:66991542-66991564
Sequence CAATTTTACTGGGGAGAAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042274631_1042274641 16 Left 1042274631 8:66991503-66991525 CCTCTCTTTCGCCTTCTCTTCAG 0: 1
1: 0
2: 2
3: 51
4: 587
Right 1042274641 8:66991542-66991564 CAATTTTACTGGGGAGAAGTGGG No data
1042274633_1042274641 5 Left 1042274633 8:66991514-66991536 CCTTCTCTTCAGTGGTTGACCTT 0: 1
1: 0
2: 0
3: 6
4: 175
Right 1042274641 8:66991542-66991564 CAATTTTACTGGGGAGAAGTGGG No data
1042274630_1042274641 23 Left 1042274630 8:66991496-66991518 CCTAAAACCTCTCTTTCGCCTTC 0: 1
1: 0
2: 0
3: 13
4: 230
Right 1042274641 8:66991542-66991564 CAATTTTACTGGGGAGAAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042274641 Original CRISPR CAATTTTACTGGGGAGAAGT GGG Intronic
No off target data available for this crispr