ID: 1042276671

View in Genome Browser
Species Human (GRCh38)
Location 8:67012285-67012307
Sequence CAGGACACATAAATGGGACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 236
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 214}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042276671_1042276681 24 Left 1042276671 8:67012285-67012307 CCATGTCCCATTTATGTGTCCTG 0: 1
1: 0
2: 1
3: 20
4: 214
Right 1042276681 8:67012332-67012354 CCAACAAGCCTCTTGTTTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042276671 Original CRISPR CAGGACACATAAATGGGACA TGG (reversed) Intronic
901777290 1:11568969-11568991 CAAGACCCAAAAATGGGTCAGGG - Intergenic
906819391 1:48913357-48913379 CAGGACACAGAACTGGGATTTGG - Intronic
906966662 1:50464119-50464141 GAGGACACAGACATGGCACATGG - Intronic
908513068 1:64864977-64864999 TAAGATACATAAAAGGGACAGGG + Intronic
910360705 1:86411614-86411636 CAGGGCACATAAGTGTTACAGGG + Intergenic
911663289 1:100527449-100527471 GAATACAAATAAATGGGACAAGG + Intergenic
913137423 1:115906183-115906205 CAGGACCCAAAGGTGGGACATGG + Intergenic
915321363 1:155058124-155058146 CAGGACACATAACTGCCACTGGG - Exonic
916090445 1:161304864-161304886 CAGGAAAAACAAATGGGAAATGG - Exonic
916516714 1:165525256-165525278 CAGGATGCAGAAATGGGACCTGG - Intergenic
917240642 1:172944829-172944851 ATAGACACATAAATTGGACAAGG - Intergenic
921162744 1:212484798-212484820 CAAGACCCATAAGTGGGTCATGG - Intergenic
922808849 1:228404790-228404812 CTGGACACAGAAATGGGATTGGG - Intronic
923050600 1:230388877-230388899 CAGGCCACAGAAATGGGGAAAGG + Intronic
924154199 1:241159353-241159375 AACAACACATAAAAGGGACATGG - Intronic
924802782 1:247339754-247339776 CAGGACACATAACAGGGTCTGGG - Intergenic
1062907073 10:1186443-1186465 CAGGAGGCACCAATGGGACAAGG - Intronic
1067263163 10:44712416-44712438 CATGACAGAGAAATGAGACAAGG - Intergenic
1068673961 10:59750877-59750899 CAGGATGCAGAAATGGGACTAGG + Intergenic
1068825077 10:61427782-61427804 CAGAGCACATAAAAGTGACAGGG - Intronic
1069031996 10:63606745-63606767 CAGGACACATGAGTGAGAAATGG + Intronic
1069775574 10:70925360-70925382 CAGGGCAGATCAAGGGGACAAGG + Intergenic
1073440003 10:103546927-103546949 CAGGACACAGAGGTGGGAAATGG - Intronic
1074193640 10:111160187-111160209 GAAGAAACATAAATGAGACATGG + Intergenic
1075494825 10:122911043-122911065 CAGGGCTCAGAAATGGGACGTGG - Intronic
1075920417 10:126207246-126207268 CAGGACACAGAAAAGGGAAAGGG + Intronic
1076386430 10:130060123-130060145 CAGGACAAACAAACAGGACAAGG - Intergenic
1076590263 10:131577908-131577930 CTGGGCAGATAAATGGGGCAGGG + Intergenic
1081833314 11:46133272-46133294 AAGGTCACATAAATAGTACATGG + Intergenic
1084658681 11:70534561-70534583 CAGGACACAGGGCTGGGACAAGG + Intronic
1085201359 11:74704158-74704180 CAGAACAGATAGATGGGAAATGG - Intronic
1085669572 11:78450082-78450104 CAGGTCACATTAATGGGACGGGG + Intronic
1086063537 11:82723972-82723994 CAGCACACATAAAGGGGACAGGG + Intergenic
1087349000 11:97007064-97007086 AAGGAAACATCAATGGGATATGG + Intergenic
1088695067 11:112359602-112359624 AATGCCACAAAAATGGGACAAGG - Intergenic
1091403019 12:192393-192415 CAGGACACACAACTGGGGCCAGG - Intronic
1091801371 12:3326704-3326726 CAGGCCACACAAATGGGGCTGGG + Intergenic
1091949519 12:4581233-4581255 CAAGACACTGAAGTGGGACATGG + Intronic
1092273503 12:7041517-7041539 CAGGACACCGACATGGAACAGGG - Intronic
1095471927 12:42546261-42546283 CAGTACACATAAATTTGAAAAGG + Intronic
1100177093 12:92043260-92043282 CTGTACCCATAAATGAGACAAGG - Intronic
1101274824 12:103188038-103188060 CAAGACACATAAATGAGAGAGGG - Intergenic
1101758539 12:107640595-107640617 CTGGGCACATAAAGGGGCCAGGG + Intronic
1102540852 12:113618061-113618083 CAGGAGACAGCAATGGGGCAGGG + Intergenic
1103052423 12:117791697-117791719 AAGGACATTTGAATGGGACATGG + Intronic
1104699130 12:130888226-130888248 CAGAACACATAGCTGTGACATGG + Intergenic
1104962203 12:132493642-132493664 CAGGGCACAGAAAAGGGGCAGGG - Intronic
1105995071 13:25663137-25663159 CAGATCACATACGTGGGACATGG + Intronic
1107451706 13:40515908-40515930 CAGGAGACATGAATGGGAAATGG - Intergenic
1109106892 13:58264317-58264339 CAGGAGGCATAGATGGGACTGGG - Intergenic
1112043551 13:95572767-95572789 CAGGGCAGATAAGAGGGACATGG - Intronic
1113234067 13:108249806-108249828 CAGGACACTTCAATGGGGAAAGG + Intergenic
1113284768 13:108834599-108834621 CAGGAAACATAAAGGGCAAAAGG - Intronic
1113777360 13:112955395-112955417 CTGAACACAAAAATGGGCCATGG - Intronic
1115485972 14:33911641-33911663 CAGCACCAATAAATGAGACATGG - Intergenic
1115999323 14:39226222-39226244 AAGGATACATAAATGAGAAAGGG + Intergenic
1116143345 14:41030494-41030516 CAGGACACATAAAGGAAAAAGGG + Intergenic
1119088078 14:71754828-71754850 CAGGTCCCATAAGAGGGACACGG - Intergenic
1120832823 14:89013253-89013275 CTGGTCACATGAATGGGACCTGG + Intergenic
1121174322 14:91879403-91879425 CAGGACACCTGAACTGGACAAGG + Intronic
1121443854 14:93966264-93966286 CATGACTCATCCATGGGACAGGG - Intronic
1121744286 14:96275812-96275834 CAGAACACAGAAACAGGACAAGG + Exonic
1122184803 14:99983540-99983562 CAGGACAAATACATGGGAAAAGG - Intronic
1122675838 14:103412565-103412587 CAGGACCCACACTTGGGACAGGG + Intronic
1124807517 15:32900745-32900767 AAGGACAAACAAATGAGACAGGG - Intronic
1128421289 15:67493730-67493752 CAGGACACTAACATGGCACATGG - Intronic
1131096807 15:89660748-89660770 AAGTCCACATCAATGGGACAGGG - Intergenic
1132214229 15:100050820-100050842 CAGGGCACATAGAAGGGTCATGG - Intronic
1132867763 16:2102380-2102402 CAGGAAACACAAAGCGGACATGG + Exonic
1133173082 16:3993713-3993735 CAGGACCCAAAAATGGAACCGGG + Intronic
1135200576 16:20434358-20434380 CATGACAGATAACTGGGAAAAGG - Intronic
1135859225 16:26039989-26040011 CTAGACACCTAAATGGGAAATGG + Intronic
1138156057 16:54703840-54703862 TAGGACACATAACTGGGAAGGGG + Intergenic
1139106168 16:63829601-63829623 CAGGAAACCTGTATGGGACAAGG - Intergenic
1141450195 16:84094257-84094279 CGGGACACAAAAATGGGAAAAGG + Intronic
1142891681 17:2948024-2948046 CAGGACACACGGAGGGGACAAGG - Intronic
1143471374 17:7177967-7177989 GAGGACAAAGAAATGGGTCAAGG + Intronic
1143536445 17:7543084-7543106 GGGGATACATATATGGGACAGGG + Intergenic
1147383937 17:40071035-40071057 AAGAACAAAGAAATGGGACAGGG - Intronic
1147555615 17:41477075-41477097 CAGGGCACACAAATGGGGCGGGG + Exonic
1148247447 17:46043304-46043326 CAGGAAAAAAAAAAGGGACAGGG + Intronic
1149661934 17:58338528-58338550 CAGGGCCCATAACTGGGGCAGGG - Intergenic
1150723810 17:67635609-67635631 CATGAAATATAAATGGGAAAGGG + Intronic
1154075837 18:11200780-11200802 CAGGTCATAAAAAAGGGACACGG - Intergenic
1154534719 18:15390956-15390978 CAGCACACCAAAATGGCACATGG - Intergenic
1155545906 18:26914648-26914670 TAGGAGACACAGATGGGACACGG + Exonic
1155841182 18:30644422-30644444 CATGACACATAAATGACATATGG + Intergenic
1156472213 18:37384406-37384428 GAGGACACATAGGTGGGGCAGGG + Intronic
1157060292 18:44280319-44280341 TAGGACACAGAAATGGCAGAAGG - Intergenic
1159542653 18:69798178-69798200 CAAGACATATAAATGGGTCTAGG + Intronic
1159904038 18:74074638-74074660 CAGGATACATTAATAGGTCATGG - Intronic
1160440890 18:78891549-78891571 CAGGACAGACAGATGTGACATGG - Intergenic
1161517466 19:4704305-4704327 CTGGAAACATACAGGGGACAGGG + Intronic
1164714608 19:30382168-30382190 CATAACACGGAAATGGGACATGG - Intronic
1165188863 19:34045338-34045360 CAGGAGACATTCATGGGACTGGG + Intergenic
1165435656 19:35793317-35793339 CAGGACACAGAGATGGAACCTGG - Intergenic
1168037733 19:53733529-53733551 CAGGACGCATAGGTGGGAGATGG - Intergenic
1168351452 19:55678484-55678506 CTGGAAACACAAATGGGACATGG - Intronic
1168555395 19:57334521-57334543 CAGGACACAGAAAGGGGAGTTGG + Intergenic
925517130 2:4695402-4695424 CAGGAAACAAAAGTGGGAGAAGG + Intergenic
926083240 2:10005541-10005563 CAGGACACACACATGGGAGGGGG - Intergenic
930670038 2:54139146-54139168 CAGGACATACAAATTGGAGAGGG - Intronic
932407384 2:71522535-71522557 CAGGACACAGCAAGGGAACAGGG - Intronic
933405525 2:81853175-81853197 CAAGACAAATAAATGGCAAAAGG + Intergenic
933581560 2:84132506-84132528 CAGCACACAAAAAAGGCACAAGG + Intergenic
936057504 2:109272046-109272068 CATGACACAGGGATGGGACAGGG - Intronic
937824609 2:126353962-126353984 AAGGACAAAGAAATGGGCCATGG + Intergenic
939741027 2:145906465-145906487 CAGGAAAAAAAAAAGGGACAGGG + Intergenic
941787601 2:169515354-169515376 CTGCACACTAAAATGGGACATGG + Intronic
942210264 2:173663153-173663175 CAGGAGATAAAAATGGGACAGGG - Intergenic
942802440 2:179891275-179891297 CAGGCCATTTAAATGTGACAAGG - Intergenic
943403615 2:187450673-187450695 CAGAAAAAATAAATGGTACAAGG + Intergenic
944692447 2:202170151-202170173 CAGGGCTCACAAATGGCACAGGG - Intronic
945535895 2:211017508-211017530 CTGGTCACATAAATGGAATATGG + Intergenic
946295918 2:218783370-218783392 CAGAACACAGAAATGAGGCAGGG + Intronic
946447669 2:219753709-219753731 CAGGAAACATACATGGCAAAAGG - Intergenic
946823149 2:223650225-223650247 CAGGAGGCATAATGGGGACACGG - Intergenic
947547489 2:231020702-231020724 AAAGACACATAAGTGGGCCAAGG - Intronic
1170192048 20:13654163-13654185 CAGGGCACAGAAATGGTAAAAGG - Intergenic
1171913568 20:30990385-30990407 CAGGACATAGACATGGGCCAGGG + Intergenic
1172153746 20:32809384-32809406 CAGGTCAGATGGATGGGACATGG + Intergenic
1174298366 20:49564863-49564885 CAGGATAAAGAAATGAGACAAGG + Intronic
1174891577 20:54400779-54400801 AAAGACACAAAAATGGCACAGGG - Intergenic
1174985244 20:55444203-55444225 GAAGACACATAAATGGGACCTGG + Intergenic
1174985250 20:55444254-55444276 CATAATACATAAATGGGACCTGG + Intergenic
1175418693 20:58817771-58817793 CAGGCCACTGAGATGGGACAGGG - Intergenic
1175816961 20:61888185-61888207 CGGTACACACAGATGGGACATGG + Intronic
1179084694 21:38206690-38206712 CAGGACACTTGGATGGAACAGGG - Intronic
1182032076 22:27167304-27167326 CAGGACACATGCCTGGCACATGG + Intergenic
1182534269 22:30988563-30988585 CAGGAGACATACATAGAACATGG + Intergenic
1182990116 22:34759579-34759601 CAGGACACAGAACTGGGAGAAGG - Intergenic
1183172535 22:36198762-36198784 CAGGTCACACAGAGGGGACATGG + Intronic
1183178948 22:36245533-36245555 GAGGACACATGAGTGGGAGAGGG + Intergenic
1183691812 22:39394275-39394297 TAGGTCACATAATTGGGACAGGG - Intergenic
1185022124 22:48382781-48382803 CAGGTTACATAAATAGGACCTGG - Intergenic
949353946 3:3157641-3157663 CAGCACACATAAAAGGGACTCGG + Intronic
950257482 3:11517703-11517725 CAAGCCACAGAAATGGCACATGG + Intronic
952872619 3:37914766-37914788 CATGACACAAAAATCTGACAAGG - Intronic
953667897 3:44939181-44939203 AAGGAGACACAAAAGGGACATGG + Intronic
954215551 3:49122448-49122470 CAGGACATGTACATGGGATAGGG + Intronic
960813047 3:121643346-121643368 CATGAGAACTAAATGGGACAAGG + Intronic
961423673 3:126828345-126828367 CAGGACAAAAAACAGGGACATGG - Intronic
966803730 3:183788904-183788926 GAAGACACATAAATGGCCCAAGG - Intronic
968589856 4:1451962-1451984 CAGGAGACATAAGTGGGGGAGGG - Intergenic
969252108 4:5974721-5974743 CAGGACACAGAATTTGGTCAAGG - Intronic
970435177 4:16026626-16026648 CAGGATGGAGAAATGGGACATGG - Intronic
970781792 4:19746336-19746358 CAGTACACAAATATGAGACAGGG - Intergenic
971250398 4:24969356-24969378 CAGGCCACATAAATGTTGCAGGG - Intronic
972703076 4:41513450-41513472 CCGGATACACAAATGGGGCAAGG - Intronic
974636986 4:64577954-64577976 GAGGACATACAAATGGGAGAGGG + Intergenic
974844768 4:67338737-67338759 CAGGAAGCATAGATGGGCCAGGG + Intergenic
975774446 4:77769298-77769320 CAGGAAACATAAAAGGTATAGGG + Intronic
976614261 4:87060056-87060078 CAGGACACTTGACTGGGAAATGG + Intronic
977191683 4:94008931-94008953 AAGGACACAGTAATGGGACAAGG - Intergenic
978109966 4:104951580-104951602 TAGGAGACAAAAATGGGACAAGG + Intergenic
981336039 4:143569931-143569953 AAGGACAATTAAATGGGAAAAGG + Intergenic
985636311 5:1037554-1037576 CAGGACACACAGTGGGGACAAGG + Intronic
986377491 5:7147410-7147432 AAGGAAAAATAAATGAGACATGG - Intergenic
990552390 5:56896813-56896835 CATGATAAATAAATGGGAGAAGG - Intergenic
992765183 5:79991636-79991658 GAGGCCACATACATGGGAGAAGG - Intronic
993093202 5:83452045-83452067 GAGGATACATGAAAGGGACAGGG - Intergenic
994813488 5:104554405-104554427 CAAGACACACAAATGGCAAACGG + Intergenic
997291418 5:132738399-132738421 CAGCACACTGAAAAGGGACAAGG - Intergenic
997646513 5:135485772-135485794 CAAGACAGATAAAAGGGAAAAGG + Intergenic
997839714 5:137228136-137228158 CAGGACTCATACATGATACATGG + Intronic
999897453 5:156050785-156050807 GAGGATAAATAAATGGGCCAAGG - Intronic
1000598243 5:163241105-163241127 TAGGAAACATAAATGGGGCAAGG - Intergenic
1001243808 5:170090629-170090651 CAAGACACATACATGCTACAAGG - Intergenic
1003476168 6:6485588-6485610 AAGTACAGATAAATGAGACATGG - Intergenic
1005533068 6:26727976-26727998 CTGGAAACTTAAGTGGGACATGG + Intergenic
1005533379 6:26730610-26730632 CAAGAGACATAAACCGGACAAGG - Intergenic
1005537415 6:26771054-26771076 CAAGAGACATAAACCGGACAAGG + Intergenic
1005537726 6:26773688-26773710 CTGGAAACTTAAGTGGGACATGG - Intergenic
1005592056 6:27338711-27338733 CAGGGCACATATTTGGGAAAAGG - Intergenic
1009008597 6:57816101-57816123 CTGGAAACTTAAGTGGGACATGG - Intergenic
1009483647 6:64192882-64192904 CAGTAAAGATCAATGGGACAAGG - Intronic
1011897721 6:92252397-92252419 CAGGACACAGTCATGGGACAGGG + Intergenic
1011992669 6:93542518-93542540 CATCACAGATAAATGGGAAACGG - Intergenic
1012162307 6:95901174-95901196 CAAGACACAAAAATGTGATAAGG - Intergenic
1012692573 6:102333776-102333798 CAAGACCCATAAAGGGGTCAAGG - Intergenic
1012720808 6:102741439-102741461 CAGAAAAAATAAATGGGACTTGG + Intergenic
1014244174 6:119049758-119049780 CAGGACACAGGAATGGGCAAAGG + Intronic
1014464259 6:121736582-121736604 CAGGACACAGACATGGGCAAAGG - Intergenic
1014660352 6:124162667-124162689 CAGGTCACATAAAAGAGAGAAGG + Intronic
1015932633 6:138376700-138376722 AGGAACACATAAATGGAACAAGG + Intergenic
1017746453 6:157451295-157451317 CATGACACAAAAAATGGACAAGG - Intronic
1018110704 6:160534575-160534597 CTGGACACATGAAGGGGAGAGGG + Intronic
1018542946 6:164902810-164902832 CATGTCAAATAAATGTGACATGG + Intergenic
1021605422 7:22404934-22404956 CAGGATAAATAAATGGTAAATGG + Intergenic
1022884129 7:34624260-34624282 AAGGACACATAAATAGTAAATGG - Intergenic
1027684716 7:81266411-81266433 CAGGATACATAAATGTTGCAGGG + Intergenic
1028131319 7:87177525-87177547 CAGGCCACTAAATTGGGACAAGG - Intronic
1028225293 7:88244031-88244053 CAGGAAACAAAAATGGGATGAGG + Intergenic
1028856440 7:95598398-95598420 CAGGCCACATAACTGACACAGGG - Intergenic
1029298591 7:99560662-99560684 CAGGACACCGACATGGAACAGGG + Exonic
1029956243 7:104643246-104643268 CAGGAAATAAAAAAGGGACATGG + Intronic
1030853262 7:114517583-114517605 AAGAACACATAAAAGGGAAAAGG - Intronic
1032927210 7:136620755-136620777 CAGGACACAGAAACAGGAAAGGG + Intergenic
1036001124 8:4606160-4606182 CAGGACACATAACTGTCACTGGG + Intronic
1039091771 8:33837398-33837420 CAGAAAAAATAAATGTGACAAGG - Intergenic
1040862754 8:52016475-52016497 CAGAACACAAAAATCAGACAAGG - Intergenic
1041429905 8:57767617-57767639 CAGGAAACATAAAATGGGCATGG + Intergenic
1042276671 8:67012285-67012307 CAGGACACATAAATGGGACATGG - Intronic
1042749842 8:72146774-72146796 AAAGACACAGAAATGTGACAAGG + Intergenic
1044898274 8:96916248-96916270 CATGACACATAAATAGGAACTGG - Intronic
1047000872 8:120571034-120571056 CAGGAGTTATAATTGGGACAAGG - Intronic
1047223560 8:122938221-122938243 CAGGAAACATAAACTGGGCATGG - Intronic
1047366994 8:124220882-124220904 CACCACACATAAATGGGGCCGGG + Intergenic
1047757684 8:127931266-127931288 CTGGAAACATAAATGGAAAAGGG - Intergenic
1048101094 8:131352205-131352227 AAGGCCCCATAAATGGAACAAGG - Intergenic
1048422655 8:134292611-134292633 CTGAACACCTATATGGGACAAGG + Intergenic
1049475024 8:142793242-142793264 GAGGACACATAAGTGGTATAAGG - Intergenic
1049601067 8:143507914-143507936 CAGGGCACAGACATGGGTCAGGG + Intronic
1052334002 9:27301399-27301421 AAAGACACAGAAATGGGAAAGGG - Intergenic
1053068757 9:35088208-35088230 CAGGAATAATGAATGGGACAAGG + Intergenic
1055629411 9:78208045-78208067 GAGGCCACATCAATGGGAAAAGG + Intergenic
1055694197 9:78865265-78865287 AAGGACAGATAATTGGGAGATGG + Intergenic
1057317450 9:93978921-93978943 CAGGACACACAAGTGAGACAGGG + Intergenic
1058055884 9:100448469-100448491 CAGGACAAAGGAATGGGAGAGGG - Intronic
1058766696 9:108188903-108188925 CAGGTCACATAGCTGGGACATGG - Intergenic
1058871228 9:109203229-109203251 CAGGGCACATCAATGGGCCAAGG + Intronic
1059214091 9:112543861-112543883 CAGCAAATATAAATTGGACATGG - Intronic
1060507983 9:124212728-124212750 CAGGACACACACATGGGAGAAGG - Intergenic
1060578345 9:124719557-124719579 CAGGAAACGTAAATGGGTAAAGG + Intronic
1060771096 9:126332723-126332745 GAGGGCACATAAAGGGGAGAGGG - Intronic
1061701366 9:132418398-132418420 CAGGAGACATAAAGGAGACGTGG + Intronic
1062257545 9:135635274-135635296 TATGTCACTTAAATGGGACATGG - Intronic
1185556318 X:1024030-1024052 CAGGACAGATAAATAAAACAGGG - Intergenic
1186071061 X:5821215-5821237 CTGGAAACACAAATGGCACACGG + Intergenic
1187583520 X:20635161-20635183 GAGGACACATTAAAGGGACCTGG + Intergenic
1190377561 X:49804599-49804621 CAGGACCCATCAATAGGAAATGG + Intergenic
1194525606 X:94973305-94973327 CTGGACACAGAAATGGGCAAAGG - Intergenic
1195158421 X:102145604-102145626 CATGACAAAAAAATGAGACAAGG - Intergenic
1196370979 X:114979496-114979518 CATGACAATTAAGTGGGACAGGG - Intergenic
1196712021 X:118772208-118772230 CAGGAGACATAGATGTGACTAGG - Intronic
1199497114 X:148464867-148464889 CAAGTCACAGAAATGTGACAAGG + Intergenic