ID: 1042277212

View in Genome Browser
Species Human (GRCh38)
Location 8:67018457-67018479
Sequence TAGCCACTACACGCCAGCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 211760
Summary {0: 1, 1: 45, 2: 1131, 3: 17591, 4: 192992}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042277212_1042277215 -7 Left 1042277212 8:67018457-67018479 CCCAGGCTGGCGTGTAGTGGCTA 0: 1
1: 45
2: 1131
3: 17591
4: 192992
Right 1042277215 8:67018473-67018495 GTGGCTATTCACAGGCATGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042277212 Original CRISPR TAGCCACTACACGCCAGCCT GGG (reversed) Intronic
Too many off-targets to display for this crispr