ID: 1042277213

View in Genome Browser
Species Human (GRCh38)
Location 8:67018458-67018480
Sequence ATAGCCACTACACGCCAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 28511
Summary {0: 1, 1: 36, 2: 614, 3: 2625, 4: 25235}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042277213_1042277215 -8 Left 1042277213 8:67018458-67018480 CCAGGCTGGCGTGTAGTGGCTAT 0: 1
1: 36
2: 614
3: 2625
4: 25235
Right 1042277215 8:67018473-67018495 GTGGCTATTCACAGGCATGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042277213 Original CRISPR ATAGCCACTACACGCCAGCC TGG (reversed) Intronic
Too many off-targets to display for this crispr