ID: 1042277215

View in Genome Browser
Species Human (GRCh38)
Location 8:67018473-67018495
Sequence GTGGCTATTCACAGGCATGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042277213_1042277215 -8 Left 1042277213 8:67018458-67018480 CCAGGCTGGCGTGTAGTGGCTAT 0: 1
1: 36
2: 614
3: 2625
4: 25235
Right 1042277215 8:67018473-67018495 GTGGCTATTCACAGGCATGTAGG No data
1042277212_1042277215 -7 Left 1042277212 8:67018457-67018479 CCCAGGCTGGCGTGTAGTGGCTA 0: 1
1: 45
2: 1131
3: 17591
4: 192992
Right 1042277215 8:67018473-67018495 GTGGCTATTCACAGGCATGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042277215 Original CRISPR GTGGCTATTCACAGGCATGT AGG Intronic
No off target data available for this crispr