ID: 1042281154

View in Genome Browser
Species Human (GRCh38)
Location 8:67057736-67057758
Sequence AGTGCAATCCAGGTTTTATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 126
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 118}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042281154 Original CRISPR AGTGCAATCCAGGTTTTATG AGG (reversed) Intronic
906250124 1:44304787-44304809 AGTTCACTTCAGGTTTTAGGAGG - Intronic
907053132 1:51343140-51343162 AGTGCATTTCAGTTTTGATGAGG - Intronic
910615485 1:89193266-89193288 AGTGAAGAGCAGGTTTTATGGGG - Intronic
911336908 1:96592271-96592293 AGTGGAATAAAAGTTTTATGAGG - Intergenic
911761452 1:101621973-101621995 AATGCAACCAAGGTTTTATAGGG - Intergenic
920523058 1:206643646-206643668 AGTGGAAAGCATGTTTTATGTGG + Intronic
921704809 1:218310329-218310351 AGTGAAATCTAGTTTATATGTGG - Intronic
1063407968 10:5814067-5814089 AGTGAAAGCCAGGTTTCATTGGG + Intronic
1064621068 10:17217829-17217851 TGTGCAATCCAAGAATTATGGGG - Intergenic
1064713209 10:18147570-18147592 AGTGCAGCCCAGGTTGTATAAGG - Intronic
1065447283 10:25815964-25815986 AGTCCAATCTAGCTTTTATTGGG + Intergenic
1066524089 10:36257114-36257136 AGTGGTTTCCAGGTTTTTTGTGG - Intergenic
1069846853 10:71378053-71378075 GGGCCAATCCAGGTTTTATGGGG + Intergenic
1073490201 10:103848253-103848275 GGTGCAATCAACTTTTTATGGGG + Intronic
1074162048 10:110843526-110843548 AGAGCATTCCAGGTTATCTGGGG + Intergenic
1075201434 10:120408066-120408088 AGGGGAATCCAGGTTTTATGGGG - Intergenic
1078576412 11:12506697-12506719 AATGCACATCAGGTTTTATGGGG + Intronic
1085489581 11:76902366-76902388 ATTGAAATGCAGCTTTTATGTGG - Intronic
1086078806 11:82881520-82881542 TGTCCAATCCAGGCTTTATAGGG - Intronic
1093417758 12:18939969-18939991 AGAGGGATCCAGGGTTTATGGGG - Intergenic
1097369078 12:58753823-58753845 AGTGGGATCCAGGTTTTGTGGGG + Intronic
1098411640 12:70190848-70190870 GTTGCTATTCAGGTTTTATGAGG + Intergenic
1102077527 12:110071988-110072010 ATTGCGAACAAGGTTTTATGTGG - Intronic
1103470148 12:121173848-121173870 TCTGCAATCCAGCTTTTGTGAGG - Intronic
1108681121 13:52781271-52781293 AGTGCAATTCAGGGTATAAGTGG - Intergenic
1117288493 14:54310055-54310077 AGCGAAATCCAAGTTTAATGGGG + Intergenic
1120518246 14:85495324-85495346 CGTGCAATTCAGGTATTAAGAGG + Intergenic
1122471421 14:101969476-101969498 AGTTCAATCCAGATTTTACTAGG - Intronic
1202897188 14_GL000194v1_random:16954-16976 AGTGAATACCAGGTTTTAGGTGG + Intergenic
1124259610 15:28176725-28176747 AGAGTAATCCAGGTTGCATGTGG - Exonic
1124911250 15:33922897-33922919 AGTTCAATCAAAGTTTTATCAGG + Intronic
1126699186 15:51352579-51352601 ATTCCAATCCAGGCTTTAAGAGG - Intronic
1130814754 15:87419566-87419588 AATGCAATTCAGAATTTATGAGG - Intergenic
1130979903 15:88805063-88805085 ACTAGAATCCAGGTTTTCTGAGG + Intronic
1132134121 15:99316538-99316560 AGTTCATTCCATATTTTATGAGG + Intronic
1135872820 16:26166646-26166668 AGTGCTATGCATGTTTTATAAGG + Intergenic
1137064628 16:35827233-35827255 AGTGCAAATCACATTTTATGTGG + Intergenic
1140200835 16:72893494-72893516 ATTTCAATCCAGGGTTTATACGG - Intronic
1141427334 16:83952827-83952849 AGTGAAATCCAGGTGGAATGCGG + Intronic
1143640882 17:8196622-8196644 GGTGGAATGCAGGTTTTATGTGG + Intergenic
1148631390 17:49112297-49112319 TGTACAATCCAGATTTTATTTGG - Intergenic
1153186478 18:2491702-2491724 TGTTCATTCCAGATTTTATGTGG + Intergenic
1153762196 18:8342010-8342032 AGAGCAAGTCAGCTTTTATGGGG + Intronic
1156912622 18:42428600-42428622 TGTGCAATCCTGGATTTCTGAGG - Intergenic
1157744851 18:50126367-50126389 AGTGGAATGCAGGTTCTATCAGG - Intronic
1158450166 18:57557080-57557102 ACTGCACTCCAGGCTTCATGTGG - Intronic
1163272023 19:16260144-16260166 AGTTCAGGCCAGGTTATATGTGG - Intergenic
1165289262 19:34870044-34870066 ACTGCAATGTAGGTTTTATTTGG + Intergenic
925430436 2:3787042-3787064 AGTGTAATCCATTTGTTATGTGG + Intronic
926391023 2:12392995-12393017 GGTACCATCCAGGTTTTGTGGGG + Intergenic
929902073 2:46013608-46013630 AGTGGAAACCAGGTTTAAGGTGG - Intronic
933387704 2:81632550-81632572 AGTGCTATCCAGATGTTAAGTGG + Intergenic
936049999 2:109215518-109215540 AGTGCACTCCTGCTTCTATGTGG + Intronic
938754281 2:134365353-134365375 AGTGCAGTCCAGCTTTTTGGTGG + Intronic
938964915 2:136379831-136379853 AGTGCAGTTCAGGCTTTTTGGGG + Intergenic
944344954 2:198652187-198652209 AATGCAAACCATATTTTATGAGG + Intergenic
945882110 2:215336128-215336150 AGTGCAATTCATGTTTGAAGCGG + Intronic
947094140 2:226546691-226546713 GGTGCAATGCAGATTTTCTGTGG - Intergenic
947984080 2:234434508-234434530 AGTGGAATCAAGGTTTCCTGTGG + Intergenic
1169735096 20:8829272-8829294 AGTGCTGTCCAGGTTTTCTCAGG + Intronic
1170326184 20:15156797-15156819 AGTCAAATCCAGGTTTTCTGAGG - Intronic
1171017671 20:21556641-21556663 ACTGAACTCCAGGTTTTATCTGG + Intergenic
1176616872 21:9032943-9032965 AGTGAATACCAGGTTTTAGGTGG + Intergenic
1179053696 21:37913044-37913066 AGTGCCATCCAGGTGTTACAAGG - Intronic
1179081012 21:38170661-38170683 GGTGCAATCCAGGGTTTAACTGG + Intronic
1184379263 22:44134840-44134862 AGTAAAATCTTGGTTTTATGGGG - Intronic
949301641 3:2590825-2590847 AGTGCTATCTAAGTTTTATCAGG - Intronic
950702193 3:14758244-14758266 AGGGCCATCCAGGTTAAATGGGG + Intronic
951354588 3:21648850-21648872 AGTGCATCTCAGGTTATATGTGG - Intronic
953118124 3:40012945-40012967 AGTGGAATGCAGGTGTGATGTGG - Intronic
955688820 3:61570605-61570627 AGTGCACTGCAGGATTCATGAGG - Intronic
955696535 3:61642647-61642669 AGTCAAATCCGGGTTTTAAGGGG - Intronic
958898007 3:99851780-99851802 AGTGCAAACCAAGTTTTAATTGG - Intronic
958982787 3:100743414-100743436 AGTACAATCCAGGATTAAGGTGG + Intronic
963474513 3:145788337-145788359 AGTGCAATTCTGGTGTTAAGTGG + Intergenic
963517780 3:146330044-146330066 TGTGTATTCCAGGTTTCATGTGG + Intergenic
966641776 3:182199577-182199599 AGGACAATCCATGTTTTATAAGG + Intergenic
968360788 3:198145303-198145325 AATGCTCTCCAGGTTTTCTGTGG + Intergenic
968925965 4:3548680-3548702 AGTCTGATCCAGGTTTTGTGAGG - Intergenic
974175867 4:58323411-58323433 AATACAATCCAGAGTTTATGAGG - Intergenic
976452009 4:85200580-85200602 AGTTAAATCCAGGTACTATGAGG + Intergenic
978947961 4:114521768-114521790 ACTGCTATCCAGGATCTATGAGG - Intergenic
980986352 4:139698667-139698689 ATTGAAATGCAGCTTTTATGTGG - Intronic
983830228 4:172317787-172317809 AGTGCTATTCACTTTTTATGTGG - Intronic
984132204 4:175891729-175891751 AGAGCAATGCAGTTTTTAAGAGG - Intronic
984425495 4:179580226-179580248 AGTTCAACCCAGTTTTTATGGGG - Intergenic
987086829 5:14478160-14478182 AGTGCAATTAAAGTGTTATGTGG + Intronic
987524783 5:19033187-19033209 AGTTTAAGCAAGGTTTTATGTGG + Intergenic
989103775 5:37842108-37842130 ACTTCAATCCAGTTTTCATGAGG - Intergenic
990580463 5:57162948-57162970 ACTGCACTCTAGGTTTCATGGGG - Intergenic
993792068 5:92221132-92221154 GGTGCATTTCAGGTTGTATGAGG + Intergenic
994658478 5:102624417-102624439 ATTCCAATACAGTTTTTATGGGG + Intergenic
995897704 5:117034073-117034095 ACTGAAATCCAGGATTTTTGAGG - Intergenic
996757179 5:126947347-126947369 AGTGGAATCAAGGGTTTAAGAGG - Intronic
998116721 5:139543450-139543472 CGTGCAATCCAGGATCTACGTGG - Intronic
1001352672 5:170984586-170984608 AGTGCATTCCAGCTTGGATGAGG + Intronic
1002150742 5:177228163-177228185 AGTGCAATGCAGTTATTTTGGGG + Intronic
1003355541 6:5366098-5366120 AGTTCAATCCATGTTGTTTGAGG + Intronic
1007976468 6:46106480-46106502 AAAGCATTGCAGGTTTTATGGGG - Intergenic
1009620659 6:66071754-66071776 ACTGCAAGCCATTTTTTATGTGG - Intergenic
1012235480 6:96809153-96809175 AGTGTACTCCAGCTTGTATGTGG - Intronic
1013670182 6:112393335-112393357 AGAGTAGTCCAGGTTTTAAGCGG - Intergenic
1015358866 6:132313250-132313272 CATGCAATCCCGGTTTTATAGGG - Intronic
1015686701 6:135871151-135871173 AGTGCAATCACAGTTATATGTGG + Intronic
1017734090 6:157345009-157345031 AAGACAATCCAGGTTTTTTGGGG + Intergenic
1019259226 7:71351-71373 AATGCTCTCCAGGTTTTCTGTGG - Intergenic
1021281724 7:18727872-18727894 AGTGCAACCCAAATTTTACGAGG + Intronic
1024024894 7:45401549-45401571 GTTGCAATCCAGGTTCTATTTGG - Intergenic
1037610053 8:20468502-20468524 GGTGGAATCCAGGCCTTATGGGG - Intergenic
1040730871 8:50445461-50445483 AAAGCATTCCAGGTTTTATTTGG + Intronic
1041618288 8:59934084-59934106 AGTTAAATCCAGGTTTTGTGGGG - Intergenic
1042281154 8:67057736-67057758 AGTGCAATCCAGGTTTTATGAGG - Intronic
1043413655 8:80027200-80027222 AGTGCATTTTAGCTTTTATGTGG - Intronic
1048691524 8:136970046-136970068 TGTCCAATCTGGGTTTTATGTGG - Intergenic
1048921153 8:139231278-139231300 AGTGCCACCCAGGTTTCAAGTGG - Intergenic
1053644814 9:40114078-40114100 GGTGAACTCCAGGTTTTAGGTGG - Intergenic
1054144347 9:61550981-61551003 AGTCTGATCCAGGTTTTGTGAGG + Intergenic
1054464035 9:65481940-65481962 AGTCTGATCCAGGTTTTGTGAGG + Intergenic
1054539762 9:66261891-66261913 GGTGAACTCCAGGTTTTAGGTGG + Intergenic
1055981774 9:82010876-82010898 AGTGCAATCCATGATTCTTGAGG + Intergenic
1062131322 9:134895109-134895131 AGTGCAATGCAGGTTTACAGAGG - Intergenic
1188981743 X:36733111-36733133 CTTGCAATGCAGGTGTTATGGGG - Intergenic
1191829481 X:65401129-65401151 AGTTAAAACCAGGTATTATGAGG - Intronic
1194299985 X:92174239-92174261 ATTTAAAACCAGGTTTTATGAGG - Intronic
1201276774 Y:12305972-12305994 AATGGAATCCAGGTTGTAGGTGG + Intergenic
1201608912 Y:15818445-15818467 AGTGCAAGCCCTGTTTTTTGGGG - Intergenic