ID: 1042281819

View in Genome Browser
Species Human (GRCh38)
Location 8:67064168-67064190
Sequence CAGGGGCTATTAAACTGTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 128
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 121}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042281819_1042281831 24 Left 1042281819 8:67064168-67064190 CCCCCACAGTTTAATAGCCCCTG 0: 1
1: 0
2: 1
3: 5
4: 121
Right 1042281831 8:67064215-67064237 CAAGTCCCCGGCCAGCGTACTGG 0: 1
1: 0
2: 1
3: 2
4: 47
1042281819_1042281829 12 Left 1042281819 8:67064168-67064190 CCCCCACAGTTTAATAGCCCCTG 0: 1
1: 0
2: 1
3: 5
4: 121
Right 1042281829 8:67064203-67064225 GAACGAGTTGACCAAGTCCCCGG 0: 1
1: 0
2: 0
3: 5
4: 53

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042281819 Original CRISPR CAGGGGCTATTAAACTGTGG GGG (reversed) Intronic
902534501 1:17111767-17111789 CAGTGGTTGTCAAACTGTGGGGG - Intronic
908435793 1:64104614-64104636 CAGGGCCTATTGAAGGGTGGGGG - Intronic
911004368 1:93202899-93202921 CAGTGGTTAATAAACTCTGGTGG + Intronic
918647189 1:186918346-186918368 AAGGGCCTGTTAAACTCTGGGGG - Intronic
919582975 1:199400421-199400443 CAGGGGATTTTAAACTAAGGAGG + Intergenic
922198729 1:223382869-223382891 CAGTGGGTCTTAAACTGTAGAGG + Intergenic
922864907 1:228851728-228851750 GAGGGACTATTAAACTGAAGTGG + Intergenic
1064397222 10:14991668-14991690 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1064400119 10:15014138-15014160 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1064612019 10:17113637-17113659 CAAGAGCTACTAGACTGTGGTGG + Intronic
1065532592 10:26687739-26687761 CAGGGGCTATTACCCTGGTGTGG - Intergenic
1065834532 10:29644837-29644859 CAGGGGCTACAAGACTGAGGAGG + Intronic
1066390402 10:34973491-34973513 AAGGGCCTATTGAACTCTGGGGG + Intergenic
1067056548 10:43055964-43055986 CAGGGGAAATTCATCTGTGGGGG + Intergenic
1067206939 10:44226111-44226133 CAGGGTCTATTAGGGTGTGGGGG - Intergenic
1069263127 10:66424170-66424192 CAGGGAATATTTAACTGTGAAGG - Intronic
1072297302 10:94022993-94023015 CAGGGGCTCTCAATCTGTGAGGG + Intronic
1077589034 11:3477521-3477543 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1080396225 11:31892727-31892749 CAGGGGTTCTTAAAATGTTGGGG + Intronic
1080629630 11:34061999-34062021 CAAAGACTATTAAACAGTGGTGG - Intronic
1084244729 11:67849144-67849166 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1084658915 11:70535861-70535883 CAGGGCCTGGTAAGCTGTGGGGG + Intronic
1084847464 11:71911683-71911705 AAGGGCCTATTGAACTCTGGGGG + Intronic
1091190872 11:133694341-133694363 CCTGGGCTCTTAAGCTGTGGAGG + Intergenic
1092415293 12:8286289-8286311 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1092432376 12:8419890-8419912 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1095705871 12:45236384-45236406 CAGGGCCTATTAGAAGGTGGGGG - Intronic
1096971851 12:55672903-55672925 CAGGGGCAATTAAATTGTGAAGG - Intergenic
1098748643 12:74269065-74269087 AAGGGCCTGTTAAACTCTGGGGG + Intergenic
1099178683 12:79453128-79453150 CTGGGGCTATGAAACTGAGATGG - Intergenic
1101700117 12:107165735-107165757 TAGAGCCTATTAAACTGAGGAGG - Intergenic
1104915486 12:132262318-132262340 CAGGGGCTCTAAACCTATGGGGG - Intronic
1107544157 13:41421456-41421478 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1109803003 13:67401929-67401951 AAGGGCCTGTTAAACTCTGGGGG + Intergenic
1110871262 13:80455018-80455040 CTGGGGCCATTGAAGTGTGGAGG + Intergenic
1111155156 13:84311627-84311649 AAGGTGCTATTAAATTGTGTAGG - Intergenic
1113882393 13:113635067-113635089 CAAGGCCTGTAAAACTGTGGTGG + Intronic
1116652004 14:47605093-47605115 CAGGGCATTTTAAACTATGGGGG - Intronic
1117288914 14:54313521-54313543 CAGGGGCCATAATACTATGGTGG - Intergenic
1118549849 14:66938306-66938328 CAGGGTCTACTAAATTGTGTGGG + Intronic
1121079326 14:91095102-91095124 CAGGGGCAAATGAACTGGGGGGG - Intronic
1121537049 14:94698117-94698139 CAGGGGCTGGGAAACTTTGGAGG - Intergenic
1123115801 14:105893558-105893580 CAGGGGGTGTCAGACTGTGGTGG - Intergenic
1123120045 14:105912273-105912295 CAGGGGGTGTCAGACTGTGGTGG - Intergenic
1123402782 15:20003859-20003881 CAGGGGGTGTCAGACTGTGGTGG - Intergenic
1123512119 15:21010513-21010535 CAGGGGGTGTCAGACTGTGGTGG - Intergenic
1126688101 15:51265834-51265856 CAGAGTATAATAAACTGTGGGGG - Intronic
1128400744 15:67277951-67277973 CAGGGGCTCTGTAAATGTGGTGG + Intronic
1132980467 16:2736510-2736532 CAGTGGCTGAAAAACTGTGGCGG + Intergenic
1135008463 16:18850318-18850340 AAGGAGTTATTAAAGTGTGGAGG - Exonic
1139269884 16:65671981-65672003 CAGGGGACATAACACTGTGGTGG + Intergenic
1142856543 17:2733666-2733688 CAGGGGAGATTAGAATGTGGCGG + Intergenic
1143825795 17:9605977-9605999 GAGAGGCTCTTTAACTGTGGGGG + Intronic
1144095611 17:11897982-11898004 CAGGGGCTATCAAAAGCTGGAGG - Intronic
1148191564 17:45681929-45681951 CAGGCGCTCTTAACCTGGGGAGG + Intergenic
1150894043 17:69188690-69188712 CAGGGCCTACTTAAGTGTGGAGG - Intronic
1155945774 18:31849295-31849317 CAGGTGGTATTAAACTGTTCGGG - Intronic
1158750806 18:60257959-60257981 CAGGGACTACTAGACAGTGGAGG + Intergenic
1162284204 19:9726110-9726132 AAGGGCCTGTTAAACTCTGGGGG - Intergenic
1163943208 19:20513824-20513846 AAGGGCCTGTTAAACTCTGGGGG - Intergenic
1163966372 19:20750816-20750838 AAGGGCCTATTGAACTCTGGGGG - Intronic
1166054387 19:40279738-40279760 CAGGGGCTACTGAGCTGTGGTGG + Intronic
925418135 2:3687980-3688002 CAGGGGCTCTTACTCTTTGGAGG + Intronic
928754201 2:34504204-34504226 CTGGGGCTATTAGAGGGTGGAGG + Intergenic
931113402 2:59137988-59138010 CAAAGGCTATAAAGCTGTGGGGG + Intergenic
932349946 2:71023607-71023629 AAGGGCCTATTGAACTCTGGGGG + Intergenic
934653521 2:96105434-96105456 CAGAGGCCATTCAACTGTGTGGG + Intergenic
935072242 2:99705165-99705187 CAGGGGCAACTAAACCATGGAGG + Intronic
940869526 2:158848384-158848406 AAGGGCCTATTGAACTCTGGGGG + Intronic
940872202 2:158869382-158869404 AAGGGCCTATTGAACTCTGGGGG + Intergenic
940874409 2:158885370-158885392 AAGGGCCTATTGAACTCTGGGGG + Intergenic
947595003 2:231405528-231405550 AAGGGCCTATTGAACTCTGGGGG + Intergenic
948757423 2:240167630-240167652 CAGGGGCTCTAGAATTGTGGGGG - Intergenic
1168959501 20:1859213-1859235 AAAGGGCTTTTTAACTGTGGAGG - Intergenic
1171336176 20:24387851-24387873 AAGGGGCTGTGAAACTGTGAAGG + Intergenic
1171408547 20:24930246-24930268 AAGGGCCTATTGAACTCTGGGGG + Intergenic
1171957882 20:31473875-31473897 CAGGGGTTCTCAAACTTTGGCGG - Intronic
1172805829 20:37610944-37610966 CAGGGTCTTTTAAACAGAGGAGG - Intergenic
957076184 3:75604895-75604917 AAGGGCCTATTGAACTCTGGGGG - Intergenic
958149879 3:89677805-89677827 CAGCAGCTCTTAAACTTTGGTGG - Intergenic
959733763 3:109633778-109633800 TTGGGGCTACTAAAGTGTGGAGG - Intergenic
961624124 3:128247817-128247839 CAGAGGCTACTGAACTGTAGTGG + Intronic
964522395 3:157583191-157583213 AAGGGCCTGTTAAACTCTGGGGG - Intronic
965832450 3:172808140-172808162 CAGGGGCTATAAGACTATGAGGG - Intronic
969700933 4:8767357-8767379 CAGGGGCTATTAAAGTGCTTCGG - Intergenic
969789067 4:9479509-9479531 AAGGGCCTATTGAACTCTGGGGG + Intergenic
969793804 4:9510277-9510299 AAGGGCCTATTGAACTCTGGGGG + Intergenic
970209102 4:13689001-13689023 TAGGGCCTATTAGACGGTGGAGG - Intergenic
975769958 4:77710128-77710150 CAGTGGCACTTAAACTGTTGGGG + Intergenic
980780151 4:137483063-137483085 AAGGGCCTGTTAAACTCTGGGGG + Intergenic
985855761 5:2425324-2425346 CAGGGGATATTCTACTGTGCTGG - Intergenic
986781673 5:11072055-11072077 CTGGGGGTATTAGTCTGTGGAGG + Intronic
987287561 5:16472854-16472876 CAAGGGCTGATAATCTGTGGTGG - Intergenic
993536092 5:89088035-89088057 CAGTGGTTCTTAAACTGTGGTGG + Intergenic
993538343 5:89116909-89116931 CATGGGCTACTAGACTGGGGAGG + Intergenic
995957317 5:117793659-117793681 CTGGGGCTATTAACGTGTGTAGG - Intergenic
996413003 5:123179517-123179539 TAACGGATATTAAACTGTGGTGG - Intronic
1002776710 6:333929-333951 CAGGGGCTATTAAAATGTGTAGG + Intronic
1008831994 6:55775888-55775910 CAGGGGTTCTTCAAATGTGGAGG + Intronic
1017540472 6:155397203-155397225 AAGGGGCCATGAAACTGTTGAGG + Intronic
1020307021 7:6843222-6843244 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1020311497 7:6872066-6872088 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1020323065 7:6954404-6954426 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1025924633 7:65947285-65947307 CAAGTGCTATTAAACTATTGTGG + Intronic
1026857982 7:73767661-73767683 CAGGGGCTGTTAAAGTGGGCAGG - Intergenic
1029078175 7:97952166-97952188 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1032883682 7:136115902-136115924 CAGGGGAGCTTAAACTGTGTGGG - Intergenic
1033221728 7:139531066-139531088 TAGGGGCTTATTAACTGTGGGGG - Intronic
1036239833 8:7072337-7072359 AAGGGCCTATTGAACTCTGGGGG + Intergenic
1036903500 8:12689228-12689250 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1038799128 8:30733386-30733408 AAGGGCCTATTGAACTCTGGGGG + Intronic
1039278388 8:35956286-35956308 AAAGGCCTATTAAACTCTGGGGG + Intergenic
1039349616 8:36748054-36748076 TAGGAGCTATTAAATGGTGGTGG - Intergenic
1041522375 8:58770704-58770726 CAGGGGCTAATAAAGTGTGCTGG - Intergenic
1042281819 8:67064168-67064190 CAGGGGCTATTAAACTGTGGGGG - Intronic
1053149277 9:35732475-35732497 CAGGGGCTATGCAAATGTAGGGG - Exonic
1054186111 9:61953384-61953406 CAGGGTCTGTGAAACGGTGGGGG - Intergenic
1056917169 9:90756062-90756084 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1057477873 9:95419620-95419642 CCAGGTCTATGAAACTGTGGTGG + Intergenic
1062224082 9:135439214-135439236 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1185909967 X:3972196-3972218 AAGGGCCTGTTAAACTCTGGGGG + Intergenic
1187634122 X:21207790-21207812 CAGGGCCTATTAAAGGGTGGAGG + Intergenic
1188576279 X:31654746-31654768 TAGGGACTATTAGAGTGTGGAGG + Intronic
1190653945 X:52594587-52594609 TGGGGGCTATCACACTGTGGTGG + Intergenic
1194400555 X:93434469-93434491 AAGGGTCTATTGAACTCTGGGGG + Intergenic
1199151501 X:144492145-144492167 CAGGGGCTATCAAACTTTCTCGG + Intergenic
1201555107 Y:15259043-15259065 AAGGGTCTGTTAAACTCTGGGGG + Intergenic
1202126765 Y:21575243-21575265 AAGGGGCTGTTAATCTCTGGAGG + Intergenic