ID: 1042281956

View in Genome Browser
Species Human (GRCh38)
Location 8:67064674-67064696
Sequence CAGGCTCTGGAATCTGGGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 496
Summary {0: 1, 1: 1, 2: 7, 3: 46, 4: 441}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042281945_1042281956 27 Left 1042281945 8:67064624-67064646 CCTCGGGGCGTAGGTCTCGAGGC 0: 1
1: 0
2: 0
3: 2
4: 31
Right 1042281956 8:67064674-67064696 CAGGCTCTGGAATCTGGGGGTGG 0: 1
1: 1
2: 7
3: 46
4: 441
1042281943_1042281956 28 Left 1042281943 8:67064623-67064645 CCCTCGGGGCGTAGGTCTCGAGG 0: 1
1: 0
2: 0
3: 0
4: 16
Right 1042281956 8:67064674-67064696 CAGGCTCTGGAATCTGGGGGTGG 0: 1
1: 1
2: 7
3: 46
4: 441
1042281948_1042281956 -3 Left 1042281948 8:67064654-67064676 CCGGCGACGTGCCAGAGTTACAG 0: 1
1: 0
2: 0
3: 3
4: 64
Right 1042281956 8:67064674-67064696 CAGGCTCTGGAATCTGGGGGTGG 0: 1
1: 1
2: 7
3: 46
4: 441

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042281956 Original CRISPR CAGGCTCTGGAATCTGGGGG TGG Intronic
900311783 1:2036965-2036987 CAGGGTCTGGGGCCTGGGGGTGG - Intergenic
900639984 1:3684019-3684041 CAGGCTGTGGGAGCTGGTGGGGG + Intronic
901177563 1:7315751-7315773 CAGCCACTGGAAGCTGGGAGAGG - Intronic
901252870 1:7795083-7795105 TAGGCTCTGGATGCTTGGGGGGG + Intronic
901882501 1:12202396-12202418 AAGTCCCTGGTATCTGGGGGAGG + Intronic
902410669 1:16209964-16209986 CAGGGGCTGGAAGCTGGGGTGGG - Intronic
902642353 1:17774976-17774998 TGGGCTCTGGAATCTAGGTGAGG + Intronic
902723879 1:18322716-18322738 CAGGCTCTGGGTTCAGGGGTGGG - Intronic
902797976 1:18811705-18811727 CTGGCTGTGGAATCGGGGAGTGG - Intergenic
903478773 1:23638189-23638211 CAGGCTCTGGAAGGAGGGAGAGG + Intronic
903601600 1:24546128-24546150 GAGGATCAGGAATCTGGGAGTGG + Intergenic
904357436 1:29949784-29949806 CAGGGTTTGGAAGCTGTGGGAGG - Intergenic
905864321 1:41368500-41368522 CAGGCTCTGGGACCTGGGTAGGG + Intronic
906069675 1:43007692-43007714 CAGGCCCGGGAATGTGGGGCGGG - Intergenic
906635656 1:47408656-47408678 CAGGAGCTGACATCTGGGGGAGG - Intergenic
909671434 1:78193544-78193566 AAGGCTCTGGCATCTGGTGAAGG + Intergenic
910830888 1:91461950-91461972 CAGGTTCAGGAATCAAGGGGTGG - Intergenic
912170347 1:107092150-107092172 CAGCCTCTGGAATCTGGGAAAGG + Intergenic
912769007 1:112445229-112445251 GAGGGTCAGGAATCTGGGAGGGG - Intronic
913063580 1:115229694-115229716 CAGGCTCTCTAGTCTTGGGGCGG + Intergenic
913199470 1:116484254-116484276 CTGCCTCTGGACTCTGGGGAGGG + Intergenic
916173543 1:162019939-162019961 CAGGCTCCAGAAGCTGCGGGAGG - Exonic
916598671 1:166271464-166271486 CAGGGGCTGGAAGCTGGAGGTGG - Intergenic
916782971 1:168056317-168056339 GAGGCCCTGGCAGCTGGGGGTGG - Intronic
917716784 1:177746301-177746323 GAGCCTCTGGAACATGGGGGTGG - Intergenic
918221710 1:182441483-182441505 CAGTCTCTAGAATGTGGAGGGGG - Intergenic
919727533 1:200893908-200893930 GAGGCACTGGAATCTGGGTCGGG + Intronic
919746106 1:201010161-201010183 CAGGCTCTGGCATCTGGGAAGGG - Intronic
920059616 1:203218335-203218357 AAGCCTCAGGAATCTGGTGGAGG - Intronic
920205573 1:204288519-204288541 GAGGAACTGGGATCTGGGGGAGG + Intronic
920666049 1:207963665-207963687 CAGGCTCGGGAAGCCGGGCGCGG + Intergenic
920881017 1:209880634-209880656 AGGGCTCTGGGATCTGGTGGAGG + Intergenic
921861501 1:220046582-220046604 CAGGCTCTGGAACCTGCGGGCGG - Exonic
922034513 1:221835436-221835458 CAAGCCCTGGAATCTGTGGGAGG - Intergenic
922729383 1:227941963-227941985 GAGGCTCTGGACCCTGGGGCAGG - Intronic
923632957 1:235666444-235666466 CAGGGGCTGGAAGCTGAGGGAGG + Intronic
924612261 1:245583466-245583488 CAGGCTTGGGTATCTGGGTGGGG - Intronic
1064946659 10:20797982-20798004 CAGCCTCTGGAATCACTGGGAGG - Intronic
1066239228 10:33517199-33517221 CACCTTATGGAATCTGGGGGAGG - Intergenic
1067161501 10:43828740-43828762 CAGGTTCTGGAATCTAGAGCTGG + Intergenic
1068213549 10:53952919-53952941 CAGGCCCTGGAAGCAGGGAGAGG + Intronic
1068861845 10:61855567-61855589 CAGGCTCTGGGCTATAGGGGAGG + Intergenic
1070692899 10:78540959-78540981 CAGAGTCTGAAATCTGGGAGGGG + Intergenic
1070907318 10:80084563-80084585 GAGTCTCTGGAATTTGGGGAAGG - Intronic
1070933651 10:80277574-80277596 AAGGGGCTGGAATCTGGGGTAGG + Intronic
1070954106 10:80453733-80453755 CCGGCTTTGGAGCCTGGGGGCGG - Intergenic
1071450075 10:85785747-85785769 CAGGTTTGGGAGTCTGGGGGTGG - Intronic
1071462810 10:85914479-85914501 CAGGCTCTGAAAACAGGAGGCGG + Intronic
1073439641 10:103544909-103544931 GAGGCTCTGGAATTTAGGGAGGG - Intronic
1073538360 10:104297913-104297935 CAGGCTCTGAAGTCTGCGGGAGG - Intronic
1074145598 10:110714627-110714649 CAGCCTCTGGGAGCTGTGGGTGG + Intronic
1074279274 10:112035672-112035694 AAGGCTCTGGAATCTGGCTAGGG + Intergenic
1074283723 10:112078750-112078772 CAAGCTAGGGAATCTGGGAGTGG + Intergenic
1075227807 10:120645339-120645361 CAGGCTCAGGGATATAGGGGTGG - Intergenic
1075657446 10:124171613-124171635 CAGGCTCTGCATGCTGGGGCTGG - Intergenic
1076433601 10:130424554-130424576 AAGTCCCTGGAAGCTGGGGGAGG + Intergenic
1076693530 10:132236198-132236220 CAGGCTCTGCCACCTGGGGAAGG - Intronic
1077646702 11:3931802-3931824 CAAGCTAGGGAATCTGGGAGTGG + Intronic
1078085246 11:8229949-8229971 CCTGATCTGGAATCTGGGAGGGG - Intronic
1080199800 11:29655724-29655746 CAGGATCTGGAATCTGAAGGTGG - Intergenic
1081395510 11:42582005-42582027 CAGCCCCTGAAATCTGAGGGAGG - Intergenic
1081537695 11:44007323-44007345 CAGGCTCTGGAATGTCTGGCTGG - Intergenic
1081575740 11:44317642-44317664 CTGGCTCTGGAGAGTGGGGGAGG + Intergenic
1081596793 11:44465051-44465073 CTGGCTGTGGGATCTGGGGCAGG - Intergenic
1081608557 11:44544021-44544043 CAGACTTTGGTATCTGAGGGGGG - Intergenic
1081965178 11:47165041-47165063 CATCCTCTGGAACCAGGGGGAGG - Exonic
1082082757 11:48025076-48025098 CAGGCTATGGGATCTGGGAAAGG + Intronic
1082722492 11:56695297-56695319 CATGCTCTGGACTATAGGGGTGG + Intergenic
1082904250 11:58289069-58289091 CAGAGTCTGGAAACTGGGGAAGG + Intergenic
1082959093 11:58901996-58902018 GAGCCTCTGGAGTCTGGAGGTGG + Intronic
1082974621 11:59059579-59059601 GAGCCTCTGGAATCTGGAGGGGG + Intergenic
1083381528 11:62273388-62273410 CAGGCTCTGGGATGTGAGGCAGG + Intergenic
1083477313 11:62922791-62922813 AGGGCTCTGGAGTCTGGGGCAGG + Intergenic
1083853480 11:65380723-65380745 CTGGTTCTGGAGTTTGGGGGAGG + Intronic
1084400451 11:68940010-68940032 CAGCCTCTGGATCCTGGGGAAGG + Exonic
1084688670 11:70712115-70712137 CAGCCTCTGGAAGCCGGGCGGGG - Intronic
1084949672 11:72657720-72657742 TAGGATCTTGGATCTGGGGGAGG + Intronic
1084980580 11:72826556-72826578 CCAGCTCTGGAAGGTGGGGGAGG + Exonic
1085211061 11:74778824-74778846 CAAGCTAGGGAATCTGGGAGTGG - Intronic
1087625955 11:100596469-100596491 GAGGCTCTGGGATCATGGGGTGG - Intergenic
1090071470 11:123548013-123548035 CAGGCTCCGGCATCTGGGGTGGG + Intronic
1090400767 11:126447047-126447069 CGGGGTCTGGGATCTGGGAGTGG + Intronic
1090800357 11:130167395-130167417 GAGGCTCTAAAATCTGGGAGAGG - Intronic
1092075000 12:5665667-5665689 CAGGGACTGGAATGTGGGGCAGG - Intronic
1094389584 12:29934772-29934794 CGGGCTCAGGAATCAAGGGGTGG - Intergenic
1095472704 12:42553508-42553530 TTGGCTCTAGAATCAGGGGGTGG + Intronic
1095943556 12:47741028-47741050 CAGGGTGTGGGATCTGCGGGTGG + Exonic
1097247084 12:57612612-57612634 CAGACATTGGAAGCTGGGGGTGG - Intronic
1097283689 12:57861650-57861672 CAGGCTATGTAACCTGGGGCAGG - Intergenic
1097805532 12:63960841-63960863 CAGGCTCTAGAAGCTGGAAGAGG + Intronic
1099428619 12:82553718-82553740 CAGAGTCTGGACTGTGGGGGCGG + Intergenic
1099578258 12:84406849-84406871 CAGGTTCAGGAATCAGGGGGTGG + Intergenic
1100240937 12:92710155-92710177 CAGGTTCAGGAATCAAGGGGTGG - Intergenic
1101743996 12:107523964-107523986 CAGGTGCTGGAGGCTGGGGGAGG - Intronic
1102112493 12:110374921-110374943 GAGGCTCTGAACTTTGGGGGTGG - Intronic
1102281838 12:111624660-111624682 CAGCCTCTAGAAGCTGGGGAAGG - Intergenic
1102329137 12:112013988-112014010 CCGGCTGTGGAAGCTGGGAGGGG + Intronic
1102425923 12:112844352-112844374 CAGCCTCTGGTAGCTGGGGTAGG + Intronic
1102639245 12:114351981-114352003 CCAGCTGTGTAATCTGGGGGGGG + Intergenic
1102676921 12:114665422-114665444 CAGCCTCTGGAATCGGGGGGCGG - Intergenic
1104234542 12:126920919-126920941 CAGTCTCTGGAAACTGGGAGAGG - Intergenic
1104690627 12:130823366-130823388 CAGGCTCTGGGATTAGGGTGTGG - Intronic
1104805730 12:131588123-131588145 AAGGCTTTGGTATCTGGGGAGGG - Intergenic
1104927095 12:132319481-132319503 CAGGCCCGGGAAGCTGGGTGGGG - Intronic
1105432168 13:20346296-20346318 CAGGCCCTGAACCCTGGGGGAGG + Intergenic
1106478529 13:30118711-30118733 CAGCCCCTGGAAGCTGGGAGAGG + Intergenic
1106532633 13:30608206-30608228 CATGGTCAGGAATCTGGGAGTGG - Intronic
1107534994 13:41320534-41320556 AATGATCTGGAGTCTGGGGGAGG - Intronic
1107715122 13:43192336-43192358 CAAGCTCGGGAATCTGGGAGCGG + Intergenic
1108605669 13:52036120-52036142 CAGCCTCTGGAATCTGGAAAAGG - Intronic
1108712098 13:53043598-53043620 AAGCCTCTGGAATCTGTGTGTGG + Intronic
1109229801 13:59743031-59743053 CAGGCAGTGGAATCTGGTGATGG + Intronic
1109292158 13:60489475-60489497 CAGGCTCTGGAATCACAGGCTGG + Intronic
1110299995 13:73915087-73915109 CAGCCACTGGAAGCTGGGAGAGG - Intronic
1111406475 13:87813323-87813345 CAGTCTCTCCAATTTGGGGGGGG - Intergenic
1112115066 13:96343348-96343370 CAGGCTCTAGAAGCTGGGTAAGG - Intronic
1113200698 13:107865999-107866021 CAGGAACTGGAGTCGGGGGGCGG - Exonic
1113618508 13:111697415-111697437 CAGGCTCTGGAGGCAGGGAGAGG - Intergenic
1113624037 13:111782676-111782698 CAGGCTCTGGAGGCAGGGAGAGG - Intergenic
1113676061 13:112208811-112208833 CAGGAGCTGGGAGCTGGGGGAGG + Intergenic
1114080881 14:19200747-19200769 CAGCCTGTGGAATGTGGGTGGGG - Intergenic
1116256168 14:42559349-42559371 CAGGCTGTGGATTCAGAGGGTGG - Intergenic
1116764257 14:49051265-49051287 AAGGCGCAGGAATCTAGGGGCGG - Intergenic
1116950913 14:50877621-50877643 TAGTCTCTGAAATTTGGGGGCGG + Intronic
1117546375 14:56797673-56797695 CAGGCTCTGGAATGGGGAAGCGG - Intergenic
1117799817 14:59431625-59431647 CAGCCACTGGAAGCTGGGTGAGG + Intronic
1117954172 14:61109993-61110015 CAGGGTCTGGCATGTGGGTGTGG - Intergenic
1121522168 14:94593660-94593682 CAGACTCTAGAATCAGAGGGTGG - Intronic
1122039709 14:98976537-98976559 CAGGTTTTGGTATCTGTGGGAGG - Intergenic
1122479894 14:102040304-102040326 CAGGCCCTGGATCCTGGGGGTGG - Exonic
1122552198 14:102556178-102556200 CAGCATCTGGCATCTGGAGGAGG + Intergenic
1122885776 14:104709716-104709738 CAGGCCCTGGGGTCTGAGGGCGG - Intronic
1122983076 14:105200271-105200293 CAGGCTCTGCAAGCTGGGGGAGG - Intergenic
1123813716 15:23955201-23955223 CTGACACTGGAATGTGGGGGCGG + Intergenic
1124409776 15:29427533-29427555 CAGTCTCTGGAAGCTGGAGAAGG - Intronic
1124624484 15:31300234-31300256 CAGGCTCTGGGGCCTGGGTGGGG - Intergenic
1124785743 15:32679080-32679102 AGGGCTCTGGAAGCTGGGCGTGG - Intronic
1126344679 15:47680287-47680309 CAGGCTGTGGGATATGGGGATGG - Intronic
1127797851 15:62453973-62453995 CAGCCACTGGCACCTGGGGGTGG - Intronic
1127857115 15:62962028-62962050 CAGGCCCTGGAAGCTGCTGGAGG + Intergenic
1127978855 15:64019094-64019116 CAGGATTTGGAATGTTGGGGTGG - Intronic
1128068550 15:64779244-64779266 AAAGGTCTGGAAGCTGGGGGTGG - Intergenic
1129408530 15:75336153-75336175 GTGGCTCCGGAAACTGGGGGAGG + Intronic
1130828284 15:87572405-87572427 AAGGCCCTGGAATCTGGGTGTGG - Intergenic
1131000919 15:88939283-88939305 CTGGGCCTGGAAGCTGGGGGTGG - Intergenic
1131908511 15:97170610-97170632 AAGGCTGTGGGATCTGGGGGAGG + Intergenic
1132404650 15:101535123-101535145 CAGGCCCTGGAGTCGGGGTGAGG + Intergenic
1132719112 16:1307316-1307338 CAGGGACTGGATTCTGGGGGAGG + Intergenic
1132849456 16:2018258-2018280 CAGGCTCTGCCCTCTGGGAGGGG + Intronic
1133269363 16:4602891-4602913 CAGGCCTTGGAAGCTGGGAGGGG + Intergenic
1133270815 16:4610093-4610115 CAGGCTTGGGGATCTGGGGAAGG - Intronic
1134022312 16:10929642-10929664 CAGGCTCGGGAGGCTTGGGGTGG + Exonic
1134250767 16:12572356-12572378 CAGGCTCTGCCTTCTGGAGGCGG + Exonic
1134537122 16:15034990-15035012 CAGCCGCTGGAATGTGGGGAGGG + Intronic
1134675846 16:16090120-16090142 GCGGCCCTGGAATCTGGGGCAGG + Intronic
1135404931 16:22190901-22190923 TAGGCTCTGAAGTCAGGGGGCGG - Exonic
1135468430 16:22707531-22707553 CAGTCTTTGTAATCTGGGAGTGG - Intergenic
1135564159 16:23499069-23499091 AAGGCTCTGGATTCTGTGAGGGG - Intronic
1135984548 16:27174456-27174478 CAGGGTCTGGAATCTGGGGGAGG - Intergenic
1135984614 16:27174968-27174990 CACGCTAAGGAATCTGGGAGTGG + Intergenic
1136576814 16:31130161-31130183 CTGGGTCTGGAAACTCGGGGTGG + Intronic
1137573548 16:49582663-49582685 CAGGCAGTGGAAACTGAGGGAGG + Intronic
1138337401 16:56264012-56264034 CAGTGGCTGGAATCTGAGGGTGG + Intronic
1138717024 16:59035470-59035492 CAGCCTCTAGAAGCTGGGAGAGG - Intergenic
1139593413 16:67945322-67945344 GCGGCACTGGAATCTAGGGGTGG - Intronic
1140265742 16:73418933-73418955 CAGGATCTGGAATTGGGAGGTGG - Intergenic
1140279745 16:73543801-73543823 AAGGCTCTGGGAAGTGGGGGTGG - Intergenic
1140896981 16:79333298-79333320 CAGACTCTGGGATCAGGGGTGGG + Intergenic
1141086013 16:81096173-81096195 GAGGCCCTGGCAGCTGGGGGTGG - Exonic
1141616642 16:85213674-85213696 CAGGCTCTAGACTCTGGGCTGGG - Intergenic
1141910432 16:87054880-87054902 CAGCCTCTGGAAGCTGGAGAAGG + Intergenic
1142160368 16:88554462-88554484 CAGCCTCTGGAAGCTGGGAAAGG - Intergenic
1142337981 16:89502542-89502564 GAGGGTCAGGAATCTGGGAGTGG - Intronic
1142364531 16:89643110-89643132 CAGGATCTGGAGGCTGGGCGTGG - Intergenic
1142614303 17:1125856-1125878 CAGGTTCTGGAGTGTGGGAGGGG + Intronic
1142861307 17:2763739-2763761 CAGCCTCTGGGAGATGGGGGTGG + Intergenic
1143477390 17:7210723-7210745 CAAGTTTTGGAGTCTGGGGGAGG + Intronic
1143658754 17:8312268-8312290 CTGGCTCTAGAAGCTGAGGGGGG - Exonic
1143911349 17:10252392-10252414 GAGGATCTGGAATTTGGGTGTGG + Intergenic
1143974490 17:10820034-10820056 CAGGCTCAGGGCTCTGGGGATGG + Intergenic
1144192568 17:12859960-12859982 CAGGCTCTGGGCTATAGGGGTGG + Intronic
1144705365 17:17364311-17364333 CAGGCCTGGGAATCTGGGGAAGG - Intergenic
1145261749 17:21358704-21358726 CAAGCCCTGGAGGCTGGGGGAGG + Intergenic
1145906882 17:28521295-28521317 CAGGCTTTGTAACCTGGGGAGGG - Intronic
1145916972 17:28579982-28580004 AAGGCCCTGGGATTTGGGGGTGG - Intronic
1146657704 17:34644824-34644846 CAGACTCTGAGATCTGAGGGAGG - Intergenic
1146825311 17:36017644-36017666 CAGGCTTTGGACCCTGGGAGGGG - Intronic
1147215560 17:38897073-38897095 CAGGTTCTGGACTCTTGGGGTGG + Intronic
1147260468 17:39207089-39207111 CAGGCTCTGGAATCCTGGGAGGG - Intergenic
1147338733 17:39741510-39741532 CAGGCTCTGGCAACTGGGTCTGG + Intronic
1147383126 17:40067307-40067329 CAGGGTCTGAGCTCTGGGGGTGG + Intronic
1147402508 17:40189423-40189445 CAAGCTCAGGGCTCTGGGGGAGG + Intronic
1148048543 17:44758557-44758579 CAGGCTGTGGAAGCTGGGGTTGG - Intergenic
1148202070 17:45756008-45756030 CAGCCCCTGGAGTCTGGGAGGGG - Intergenic
1148243762 17:46016955-46016977 CCCGCTCTGGACTCTCGGGGTGG - Intronic
1148352590 17:46951392-46951414 CAGGCTCAGAAAGCTGGGGTGGG - Intronic
1148438402 17:47699259-47699281 CTGGCTCTGGGAGCTGGAGGAGG + Intronic
1149303597 17:55327840-55327862 CAAGCTCAGGAATCTGGGAGTGG + Intergenic
1149544941 17:57496476-57496498 TAGGCTCTGGAAGGTGGTGGCGG - Intronic
1150565297 17:66333699-66333721 CAGGCACTGGTTCCTGGGGGAGG - Intronic
1150739175 17:67765812-67765834 CAGGCACAGGTCTCTGGGGGAGG - Intergenic
1151740680 17:75979652-75979674 GAGACTCTGGAGTCTGGGGCGGG + Intronic
1151789290 17:76293894-76293916 CAGGCTCTGGATTCTGCCAGTGG - Exonic
1152300483 17:79492634-79492656 GAGGTTCAGGAATCTGGGAGGGG - Intronic
1152394704 17:80025442-80025464 CAGGCTCTGTGAGCTGGAGGAGG + Intronic
1152496943 17:80679972-80679994 CTCTCTCTGGACTCTGGGGGAGG - Intronic
1152630532 17:81408837-81408859 CAGGCTCCTGAGTCTGGGGGTGG + Intronic
1152658873 17:81533233-81533255 CAGGCTCTGGCCGATGGGGGGGG - Intronic
1152804663 17:82349601-82349623 GAGGCTCAGGAATGAGGGGGAGG - Intergenic
1153051254 18:905295-905317 AAAGCTCTGGAAGCCGGGGGAGG - Exonic
1153510485 18:5846644-5846666 GCTGCTCTGGAATCTTGGGGAGG + Intergenic
1153700209 18:7685131-7685153 CAGGATGTGGGATCTGGGGTGGG + Intronic
1154127486 18:11704585-11704607 CTGGGTCTGGAAACTGGGGAGGG - Intronic
1154492885 18:14934642-14934664 CAGGCTAGGGCATCTGGGGCTGG + Intergenic
1154499543 18:14988375-14988397 CAGTCTGTGGAATGTGGGTGGGG + Intergenic
1155004079 18:21712541-21712563 CAGCCTCTGGGATCTATGGGTGG + Intronic
1156792664 18:40995477-40995499 CAGGTTTTGGTATCTGTGGGGGG + Intergenic
1157179359 18:45482404-45482426 GAGGGTCTGGAATCTGGGCTTGG + Intronic
1157491539 18:48127218-48127240 TAGGCTCTGGAATCAGGGCCTGG - Intronic
1158493182 18:57928706-57928728 GAGGCTCTGGAACCGGGGAGGGG + Intergenic
1159563628 18:70023245-70023267 GTGGCTCAGGAATCTGGGCGTGG - Intronic
1160957544 19:1700391-1700413 CCGGCCCTGGAACCTGGGGCAGG + Intergenic
1161024925 19:2032331-2032353 TGGGCTCTGGAGGCTGGGGGTGG + Intronic
1161233694 19:3187803-3187825 CAGGCTCTGGAGGGTGGGAGTGG + Intronic
1161425060 19:4198617-4198639 CCGGGTCTGGAATGGGGGGGTGG - Intronic
1161872270 19:6879275-6879297 GAGGATCAGGAGTCTGGGGGTGG + Intergenic
1162919015 19:13889579-13889601 CTGGCTCTGGCACCTGGGAGCGG - Exonic
1162966092 19:14156810-14156832 CAGCCTCTGGGATCAGGAGGAGG + Intronic
1163448677 19:17362608-17362630 GAGGCTCTGGTAGCTGGAGGTGG - Intronic
1164120336 19:22260146-22260168 CAGAGGCTGGAATCTGGTGGTGG + Intergenic
1164622617 19:29706101-29706123 CAGCCTCTGGGATATGGGGCTGG - Intronic
1166091983 19:40515301-40515323 CAGGCTCTCGAATCTGCAGGAGG - Exonic
1167238753 19:48330730-48330752 CAGGCTCTTGGGTCTGTGGGAGG - Intergenic
1167455576 19:49595573-49595595 CAGGCTCTGACATTTGGGGGTGG - Exonic
1167520180 19:49950111-49950133 CAGGCCCTGGAAGCTGAGGGAGG + Exonic
1168240061 19:55084392-55084414 CAGACTCTGGGTCCTGGGGGAGG + Intronic
925130049 2:1488355-1488377 CAGGCTCTGGGACCTTGTGGTGG - Intronic
925250889 2:2436378-2436400 CAGGCCCTGGAATAGAGGGGCGG - Intergenic
926066842 2:9847571-9847593 CACGCTCTGCAATCTGGGAAAGG + Intronic
926124661 2:10264756-10264778 CAAGCTCAGGAATGTGCGGGTGG - Intergenic
926196308 2:10765567-10765589 AAAGCTCGGGAATCTGGGTGGGG + Intronic
926423288 2:12718638-12718660 CAGGCCCTCGAGTCTGGGAGAGG + Intronic
927993164 2:27462426-27462448 CAGGCTCTGGACTGGAGGGGAGG + Intronic
928001052 2:27523406-27523428 CAGGCTCTAGGATCTCGAGGGGG - Exonic
928615980 2:33040023-33040045 CCGGTTTTGGAATCTGGGAGTGG + Intronic
928618740 2:33067759-33067781 CAGTTTTTGGAATCTGAGGGAGG + Intronic
929187451 2:39110136-39110158 CAGATTCTGGTATCTGAGGGAGG - Intronic
929408171 2:41666726-41666748 TAGTCTCTGGAAGCTGGGGAAGG - Intergenic
930155824 2:48106761-48106783 GAGGCTCTGGAAGCCAGGGGAGG + Intergenic
930322443 2:49873663-49873685 CAGGTTCTGGTATCTGTGGTAGG + Intergenic
931247679 2:60504950-60504972 CAGGCTGTGGAAGCGTGGGGTGG + Intronic
932090093 2:68798829-68798851 CAGGCTCTGGAGTGAGGGGAGGG + Intronic
932219611 2:69989617-69989639 CAGGCTGTTTACTCTGGGGGCGG - Intergenic
933747687 2:85582895-85582917 CATGCTCTGAAATTTGGGGAGGG + Intergenic
935386878 2:102509213-102509235 CAGCCTCTGGAAGCTGTGGGAGG - Intronic
936109212 2:109651205-109651227 CAGGCCCAGGAATCAAGGGGTGG - Intergenic
937127160 2:119482169-119482191 CAGGCTCTGGGAACTGGAGAGGG + Intronic
937591134 2:123614623-123614645 CAAGCTCTGAATTCTGGGAGGGG - Intergenic
937867650 2:126766058-126766080 CAGGCTGTGGAATTGGGGGGTGG + Intergenic
938498749 2:131818743-131818765 CAGCCTGTGGAATGTGGGTGGGG + Intergenic
938684933 2:133729067-133729089 CAAGCTAGGGAATCTGGGAGTGG + Intergenic
938801761 2:134770422-134770444 CAGGCTCTGGAAGCTGGAAAAGG - Intergenic
940290459 2:152073484-152073506 ATGGCACTAGAATCTGGGGGTGG - Intronic
940303311 2:152198730-152198752 CGGGCTCTGGACTATAGGGGTGG - Intergenic
940829936 2:158456613-158456635 CTGGCTCTGAAATCTGGGGCAGG - Exonic
942219601 2:173756297-173756319 TGGGCTCTGGATTATGGGGGTGG + Intergenic
943114292 2:183647001-183647023 CATGCTATGGATTCTGGAGGTGG - Intergenic
943347933 2:186762338-186762360 CAGGCTCTGGGATGCGGGGAGGG - Exonic
944546092 2:200800159-200800181 CAGTCTCTGGAAGCTGGCGAAGG + Intergenic
944596560 2:201266545-201266567 CAGGCTCAGGAACTTGAGGGAGG - Exonic
946560110 2:220903309-220903331 CAGGCTCTGGACTTTGGTCGGGG - Intergenic
946894929 2:224313956-224313978 CAGGATCAGGACTCTGGGGAAGG - Intergenic
946930385 2:224664626-224664648 TAGGCTCTGGAATCAGGCGTGGG + Intergenic
947154380 2:227146701-227146723 CAGCCTCTAGAATCTGGAGAAGG - Intronic
947790298 2:232862670-232862692 CAGAGTCTGTAATCTGGGGTGGG + Intronic
948529985 2:238598136-238598158 CAGGGGCAGGAATCTGGGAGAGG - Intergenic
948783633 2:240339966-240339988 CTGGCTCTGGAAGCTGGCTGTGG - Intergenic
948864197 2:240767209-240767231 CAGGCCCTGGGATCTGGCAGGGG - Intronic
948918904 2:241052358-241052380 CGGGCTCCGGAAGCAGGGGGAGG - Exonic
1169734168 20:8819660-8819682 CAGGTTTTGGTATCTGGGCGGGG - Intronic
1169906943 20:10614033-10614055 CAGGATCTGGAAGCAGCGGGTGG + Intronic
1170004083 20:11646798-11646820 CAGGCTCTGGGAGTAGGGGGAGG - Intergenic
1170072971 20:12389050-12389072 CTGGCCCAGGAATCTGGAGGTGG - Intergenic
1170475979 20:16714901-16714923 CAGGTTCGGCAATTTGGGGGTGG + Intergenic
1171231050 20:23485481-23485503 CAGCCTCTAGAAACTGGAGGGGG + Intergenic
1171238755 20:23548362-23548384 CAGGCTCTGGATTAGGGGAGGGG + Intergenic
1171242850 20:23585876-23585898 CAGGCTCTGGATTAGGGGAGGGG - Intergenic
1171438994 20:25146664-25146686 CAGGCTCTGCTCTCTGGGGACGG - Intergenic
1172006875 20:31823946-31823968 CAGGCCCTGGGCCCTGGGGGAGG - Intronic
1172228246 20:33319746-33319768 CAGCCTCTGTAAAATGGGGGAGG - Intergenic
1172595861 20:36150847-36150869 CAGGCCCTGGACACTGGGGAAGG - Intronic
1173523498 20:43715839-43715861 AAGGCTCTGGCTTCTAGGGGAGG + Intronic
1173553167 20:43947551-43947573 GAGGCTCTGGAATCTGTTTGGGG + Intronic
1173806218 20:45927080-45927102 CAGGCTCTGGTTTCTGTGGTGGG - Intergenic
1174194187 20:48761476-48761498 CAGGGCCTAGAATCTGGGTGGGG - Intronic
1175992104 20:62794653-62794675 CAGGCGCTGGACTCTGGGGGCGG + Intergenic
1175998523 20:62821858-62821880 CTGGCTGTTGAGTCTGGGGGTGG - Intronic
1176244251 20:64089849-64089871 CAGGCTCAGGAAGCTCGGGTAGG + Intronic
1179881905 21:44296508-44296530 CAGGCTCCCCACTCTGGGGGAGG + Intronic
1180432173 22:15263196-15263218 CAGCATCTGGAATATGGCGGTGG - Intergenic
1180499891 22:15921938-15921960 CAGCCTGTGGAATGTGGGTGGGG + Intergenic
1180698001 22:17766038-17766060 CCGGCTCTGGAGGCTGAGGGGGG - Intronic
1182796359 22:32994276-32994298 CTGGCCCTGGTGTCTGGGGGAGG - Intronic
1183739852 22:39663458-39663480 CAGGCTCAGGGATCTGGGCTGGG + Intronic
1184490964 22:44808606-44808628 CAAGCTCTGGAATCCCGGGCAGG + Intronic
1184674405 22:46032631-46032653 CAGGCTCTGGACTCTGGGGAAGG - Intergenic
1184757786 22:46526636-46526658 CAGGCCCTGGAGGCTGAGGGAGG - Intronic
1185223584 22:49640970-49640992 CAGCCTGTGGAGGCTGGGGGTGG - Intronic
950440551 3:13007855-13007877 GGGGCTCTGGACTCTGGGGCGGG - Intronic
951504307 3:23425569-23425591 CTGTCTCTTCAATCTGGGGGTGG - Intronic
953018899 3:39101327-39101349 CAGGCTCTGGAATCTGACCCCGG + Intronic
953383599 3:42492370-42492392 CAGGCCTGGGAAGCTGGGGGTGG - Intronic
953582038 3:44166328-44166350 CTGCCTCTGGAGTCTGGGTGGGG - Intergenic
954147374 3:48641013-48641035 CGGGCTCTGGGATCTGGGTGGGG + Intronic
954431266 3:50472069-50472091 CAGGCTCAGCAGTCTTGGGGAGG + Intronic
954991528 3:54844447-54844469 CAGCGTCTGCATTCTGGGGGAGG + Intronic
955250059 3:57272380-57272402 CAGGCTCTACAATCTAGGGGTGG + Exonic
957516210 3:81255386-81255408 AAGGCTATGGAATCTGAAGGTGG - Intergenic
957950663 3:87122037-87122059 CAAGCTCAGGAATCTGGGAGTGG + Intergenic
959551404 3:107663472-107663494 GAGGCAATGGAATCTGGGTGGGG - Intronic
960844467 3:121993650-121993672 CAGGCCCTGGGATCTGAGGGAGG - Exonic
961342264 3:126235193-126235215 CAGGCTCTGTATTTTTGGGGAGG - Intergenic
961505147 3:127365666-127365688 CAGGCTGTGGAATCTGAAGGCGG + Intergenic
961677858 3:128578470-128578492 CTGGCTCTGGAACCCTGGGGAGG - Intergenic
961689540 3:128658626-128658648 CAGGCTCTGGAGGCTGAGGCAGG + Intronic
962962801 3:140326617-140326639 CAGGTTCTTGAATCTTTGGGAGG - Intronic
962990790 3:140575324-140575346 AATGCTTTGGCATCTGGGGGAGG - Exonic
963483910 3:145912149-145912171 CAGGCTCTGGGCTATAGGGGTGG - Intergenic
963698615 3:148595712-148595734 CAGATTTTGGAATCTGTGGGAGG - Intergenic
964767758 3:160195194-160195216 CAGGCACTGAAATATGGGGCAGG + Intergenic
966237429 3:177717723-177717745 CAGGCACAGAAATCTGGTGGTGG + Intergenic
966932635 3:184685738-184685760 CAGGCTCTTGGGGCTGGGGGAGG + Intergenic
967723661 3:192841673-192841695 GAGGGTCAGGAATCTGGGAGTGG - Intronic
968548517 4:1210662-1210684 CAGGGTCTGGACACTTGGGGTGG + Intergenic
968632331 4:1658522-1658544 CAGGCTCTGGAGTGTGGTGCTGG + Intronic
968923099 4:3532683-3532705 CAGGCTCCGGGCTCTGGGTGAGG - Intergenic
968923776 4:3536341-3536363 CAGGCACTGGGTTGTGGGGGAGG + Intergenic
968936418 4:3612689-3612711 CAGGCTCTAGGTTCTGGGGAGGG + Intergenic
968966994 4:3773761-3773783 CAGCCTCTGGGACCTGGGGCTGG - Intergenic
969375199 4:6758898-6758920 CAAGCTAAGGAATCTGGGAGTGG + Intergenic
969462123 4:7334388-7334410 GGGGCTGTGGAATCTGGGGAAGG - Intronic
969540205 4:7784038-7784060 CAGGGGCTGGAATCTAGGGCAGG + Intronic
970067279 4:12112905-12112927 CAGGTTTTGGAATCAGGGTGAGG + Intergenic
970195133 4:13544633-13544655 CTGGCTCTGGATTCGGGGGGAGG - Exonic
970284409 4:14493820-14493842 CATGCTCTGGGGTATGGGGGTGG + Intergenic
970467801 4:16344751-16344773 TTGCCTCTAGAATCTGGGGGAGG + Intergenic
970510543 4:16777450-16777472 CAGGCATTGGAAGCTGGCGGTGG + Intronic
971312238 4:25535397-25535419 CAGGACATGGAATATGGGGGAGG + Intergenic
971487717 4:27177072-27177094 GAAGCTCAGGAAGCTGGGGGCGG + Intergenic
972069983 4:35006773-35006795 GAGGCACTGGAAGCTGGGAGAGG - Intergenic
972273882 4:37539065-37539087 CAAGCTAAGGAATCTGGGAGTGG + Intronic
972475335 4:39444522-39444544 CAAGCTCTGGGAGCTGGGGTTGG + Intronic
972491422 4:39591027-39591049 CTGGATTTGGAATCTGAGGGGGG - Intronic
972752930 4:42010859-42010881 CTGGGTCTGTAATCTGGGAGTGG + Intronic
974099305 4:57399184-57399206 TGGGCTCTGGAATCTGGGTGAGG + Intergenic
975178980 4:71321605-71321627 AAGGTTCTGGCATCTGGGGAGGG + Intronic
977302945 4:95288678-95288700 CAGCCACTGGAATCTGGGAGAGG - Intronic
977995361 4:103493634-103493656 CGGGCTAAGGAATCTGGGAGTGG + Intergenic
978352419 4:107833939-107833961 CAGTCTCCAGAATCTGGAGGAGG + Intronic
979418229 4:120469928-120469950 AAGGCACTGGCATCTGGTGGGGG - Intergenic
979527896 4:121736664-121736686 CAGGTCCTGGAATCAAGGGGTGG + Intergenic
979931905 4:126641931-126641953 CAAGCTAGGGAATCTGGGTGTGG + Intergenic
981539170 4:145831148-145831170 CAGGTTAGGGAATGTGGGGGTGG + Intronic
981588462 4:146329553-146329575 CAGGCTCTGGAGTCAAGGGGAGG - Intronic
984681809 4:182619664-182619686 GTGGCTCTGGAATCTTGAGGGGG - Intronic
985169783 4:187136557-187136579 ATGGGTCTGGAATCTGGGAGTGG - Intergenic
985480869 5:109472-109494 CAGGGTGTGGCACCTGGGGGTGG - Intergenic
985740921 5:1617083-1617105 CCGGAGCTGGAATCTGGGTGAGG - Intergenic
986174620 5:5341348-5341370 CAGGCTCTGGGCTCCGGCGGTGG - Intergenic
986464568 5:8008402-8008424 CTGGCTCTGGAATCTGGGGTAGG + Intergenic
986691226 5:10315545-10315567 GAGGGTCAGGAATCTGGGGGTGG - Intergenic
986929922 5:12805356-12805378 CAGCGTCTGGAGGCTGGGGGCGG - Intergenic
987386810 5:17337944-17337966 AAGGGTCGGGAATCTGGGCGTGG + Intergenic
988907901 5:35808971-35808993 CAGGCTCTGGAATCAGGTCATGG + Intronic
990304112 5:54478149-54478171 CAGGCTAAGGAATCTGGGAGTGG - Intergenic
991491520 5:67188267-67188289 CTGGCTCTGGTATCTGGTGAGGG - Intronic
991645985 5:68800723-68800745 TATGCTCAGGAATCTGGGAGTGG - Intergenic
992009578 5:72513213-72513235 GAGGCTCTGGAAATTGGGGATGG - Intergenic
992567419 5:78012665-78012687 TTGGCTCTGTAACCTGGGGGAGG - Intronic
993542153 5:89165055-89165077 CAGGCGGTGGAGTCTAGGGGAGG + Intergenic
993968607 5:94389081-94389103 CAAGCTAAGGAATCTGGGAGTGG + Intronic
995479390 5:112579961-112579983 CAAGCTAAGGAATCTGGGAGTGG + Intergenic
995528404 5:113068898-113068920 AAGGATCAGGAACCTGGGGGTGG - Intronic
995650165 5:114361336-114361358 CAGGCTCTGGAATCTGGATTGGG - Intronic
996815204 5:127566616-127566638 TGGGCTCTGGGCTCTGGGGGAGG - Intergenic
997247768 5:132365406-132365428 CAAGCTAAGGAATCTGGGAGTGG - Intergenic
997339092 5:133128538-133128560 GAGGGTGTTGAATCTGGGGGTGG + Intergenic
997620664 5:135290529-135290551 CAGGGTCAGGAATCTGAGTGTGG - Intronic
997693707 5:135845162-135845184 CAGGCACTGGAAGCTGGTAGAGG - Intronic
998182631 5:139956067-139956089 CAGGCTCTGGAGGCTGGTGAAGG + Intronic
998292405 5:140927606-140927628 CAGTCTCTGGAACCTTGGTGCGG - Exonic
998348625 5:141486247-141486269 CAGGTTCTGCACTCTCGGGGAGG - Exonic
999174721 5:149624017-149624039 CAGGCTCTGGGACGTGGTGGTGG - Exonic
999319106 5:150602224-150602246 CAGGCTCTGGGTTCTGGTGGTGG + Intronic
999406850 5:151314223-151314245 TAGGCTATGGGATCTGGGTGTGG + Intergenic
999615333 5:153416912-153416934 GAGGATCAGGAATTTGGGGGCGG - Intergenic
1001460115 5:171904542-171904564 AAGGCCCAGGAATCTGGGTGTGG + Intronic
1003147541 6:3521315-3521337 CAGGGTCTGGAATCAGTTGGCGG + Intergenic
1003760357 6:9172729-9172751 CAGGCTAAGGACTCTGGGAGTGG + Intergenic
1003791425 6:9551496-9551518 CAGGTTCAGGAATCTAGGGATGG + Intergenic
1003875020 6:10427241-10427263 CAGGCTCTGGAACCCTGGGGAGG + Intergenic
1005309366 6:24544692-24544714 CAGGCCCTAGAATATGGGAGTGG - Exonic
1006059797 6:31411577-31411599 CAGGCTCAGGATTCTGTCGGAGG - Intronic
1006105492 6:31713822-31713844 CAGGCTCAGGAATCTGGGAGAGG + Exonic
1007173700 6:39882300-39882322 CAGATGCTGGAAGCTGGGGGTGG + Intronic
1007655601 6:43449405-43449427 CAGGATCTGGAATATGGGAATGG - Exonic
1011930227 6:92701731-92701753 CAGGCACTGGAAGCAGGGAGAGG + Intergenic
1016878643 6:148888418-148888440 CATGCTCATGAATGTGGGGGTGG - Intronic
1017016098 6:150100698-150100720 CGGGGCCTGGAAGCTGGGGGTGG + Intergenic
1018388805 6:163327750-163327772 CAGGGCCTGGGATGTGGGGGTGG + Intergenic
1018420611 6:163637637-163637659 CTGCCTCTGGAGTCTGGTGGTGG + Intergenic
1018457464 6:163964593-163964615 CAGGCTGTGTGATCTGGGGAGGG + Intergenic
1018969189 6:168514118-168514140 CAGGCTAGGGAAGCTGGGTGGGG - Intronic
1019748859 7:2716408-2716430 CATGCTCTGGAAACGGGTGGTGG - Exonic
1020621325 7:10523059-10523081 CATCCTCTTGAATCTGGGAGTGG + Intergenic
1022997113 7:35768535-35768557 AAGGCCCTGGCAGCTGGGGGCGG - Intergenic
1023839026 7:44085586-44085608 TAGCCTCTGAATTCTGGGGGAGG + Intergenic
1025249835 7:57344332-57344354 CAGGTCCTGGCATCGGGGGGTGG - Intergenic
1025256135 7:57385022-57385044 CAGGCCCTGGCATCTGAGTGTGG - Intergenic
1025279325 7:57615465-57615487 CAGGCACTGAGATCCGGGGGAGG - Intergenic
1025305406 7:57850035-57850057 CAGGCACTGAGATCCGGGGGAGG + Intergenic
1026539240 7:71266011-71266033 CAGCCTCTGGAAGCTAGGAGAGG - Intronic
1026844998 7:73693774-73693796 CAGGGTCTGCACTCTGGGGCTGG - Intronic
1027179396 7:75927558-75927580 GATGCTCTGGAATCTGGTAGTGG + Intronic
1028935217 7:96456511-96456533 CAGGTTCAGGAATCGAGGGGTGG + Intergenic
1030139474 7:106290378-106290400 CAGGGTGTGGAAGCTGGGTGGGG - Intergenic
1030836480 7:114293484-114293506 GAGGCTCAGGAATCAAGGGGTGG - Intronic
1032021001 7:128407088-128407110 GAGGCTGTGGAGTCTGGGTGGGG - Intronic
1033319477 7:140326760-140326782 CAGGCTCTGCAATCCGTGAGAGG - Intronic
1034046788 7:147937645-147937667 CAGGATCTGAAACATGGGGGTGG - Intronic
1036503743 8:9336567-9336589 GAGTTTCTGGCATCTGGGGGAGG - Intergenic
1037216562 8:16460692-16460714 CAAGCTCTAGAAGCGGGGGGAGG + Intronic
1037789434 8:21923972-21923994 CAGGGTTAGGAATCTGGGAGTGG + Intronic
1037882507 8:22579876-22579898 CAGCATCAGGAATCTGGGGGTGG + Intronic
1038473418 8:27844323-27844345 CAGACCCTGGCATCTGGGAGAGG + Intergenic
1039350445 8:36758257-36758279 CAGGCTCTGGAATTACGGTGTGG + Intergenic
1040106968 8:43546817-43546839 AAGGCTCTGGCCTTTGGGGGAGG + Intergenic
1040573202 8:48627468-48627490 CAGGCCCTGGAAGCTGGGCTGGG - Intergenic
1040652142 8:49461012-49461034 CAGGCTTGGCACTCTGGGGGTGG - Intergenic
1040912139 8:52529861-52529883 CAGGTTCAGGAATCAAGGGGCGG + Intergenic
1040970024 8:53125607-53125629 CAGCCTCTGGAAGCTGGAAGAGG + Intergenic
1041815165 8:61962260-61962282 CAGGCACTGGCATCTGGTGAGGG + Intergenic
1042281956 8:67064674-67064696 CAGGCTCTGGAATCTGGGGGTGG + Intronic
1043708129 8:83378542-83378564 CAGTCTCTGGGAGCTGGGAGAGG + Intergenic
1044325807 8:90856080-90856102 CAAGCTCTGCAGTCTAGGGGTGG - Intronic
1045559690 8:103248939-103248961 CAAGCTATAGAATCTGGGAGTGG - Intergenic
1046871486 8:119209054-119209076 CACGCTGTGGAAAGTGGGGGCGG + Intronic
1047073995 8:121379009-121379031 CAGGCTCTGGCCTTTGGGGCAGG + Intergenic
1047235865 8:123041793-123041815 GAGGCTCTGGGATCTGGAGCGGG - Intronic
1047544328 8:125800729-125800751 CAGCATCTGGAAGCTGAGGGTGG + Intergenic
1049391644 8:142374777-142374799 AAGGCTCTGGAAACTAGTGGGGG + Intronic
1049450098 8:142656294-142656316 GAGGCTCTGGGATGTGGGGTGGG - Intergenic
1049475868 8:142796787-142796809 CAGGCACTGGAATTGGGGGGTGG - Intergenic
1049478479 8:142807830-142807852 CAGGGACTGGACTCTGGGGCGGG + Intergenic
1049502444 8:142974634-142974656 AAGGCTCTGAAAGCTGGGGGTGG + Intergenic
1050182693 9:2937285-2937307 TTGGATCTGGAATCTGGGTGAGG - Intergenic
1050266661 9:3897855-3897877 CTGGCTCTGGAATCAGATGGGGG + Intronic
1052029163 9:23609162-23609184 AAGGCTCTTGAATCTAGGTGAGG - Intergenic
1053008563 9:34620659-34620681 CAGGCACTGGAAGCCAGGGGAGG - Intergenic
1053214739 9:36261027-36261049 CAGCCTCTAGAATCTGGAAGGGG - Intronic
1053799488 9:41755364-41755386 CAGGCACTGGGTTGTGGGGGAGG + Intergenic
1054145727 9:61559633-61559655 CAGGCACTGGGTTGTGGGGGAGG - Intergenic
1054187897 9:61967425-61967447 CAGGCACTGGGTTGTGGGGGAGG + Intergenic
1054465469 9:65490737-65490759 CAGGCACTGGGTTGTGGGGGAGG - Intergenic
1054650617 9:67621156-67621178 CAGGCACTGGGTTGTGGGGGAGG - Intergenic
1056508593 9:87281231-87281253 CAGCCTCTGGAACCTGGGAGAGG + Intergenic
1057051603 9:91928201-91928223 CAGGCTTTGGGGCCTGGGGGTGG - Intronic
1057210097 9:93196354-93196376 CAGAATCTGGAATCTGGAGATGG + Intronic
1057264309 9:93603929-93603951 CAGGCTGGGGGATCTGGAGGTGG - Intronic
1057955220 9:99401870-99401892 CAAGCTAAGGAATCTGGGAGTGG - Intergenic
1058865734 9:109160680-109160702 CAGGCTCTGGTTTCTGAGGTAGG - Intronic
1059456308 9:114402389-114402411 AAGGCTCAGGCATCTGGGGATGG + Exonic
1059767089 9:117393852-117393874 CAAGCTCTGGGATATGGAGGAGG + Intronic
1060543782 9:124448798-124448820 CTGGCTCTGGAAACTGGGACTGG + Intergenic
1061372760 9:130207081-130207103 CAGGATCTGCTGTCTGGGGGAGG - Intronic
1061419174 9:130464048-130464070 GGGGTTCTGGAGTCTGGGGGAGG - Intronic
1061428729 9:130517829-130517851 CAGGCTCTGGGCTGTAGGGGTGG - Intergenic
1061746424 9:132743509-132743531 AAGGCTGGGGAATCTGGCGGTGG - Intronic
1061783367 9:133008476-133008498 CAGGGCCAGGAATTTGGGGGTGG + Intergenic
1062185394 9:135215587-135215609 CAGCCTCTGGAAGCTGGAAGCGG + Intergenic
1062269377 9:135701685-135701707 CAGGCTGCGGCATCTGTGGGTGG - Intergenic
1062490045 9:136800525-136800547 CAGGGGCTGGGATCTGGGAGGGG + Exonic
1203770493 EBV:47645-47667 CAGGCTCCTGGATCTGGGGCTGG + Intergenic
1186667146 X:11728917-11728939 CAGCCTCTAGAATCTGGAAGGGG - Intergenic
1186672479 X:11781509-11781531 AAGGCTTTGGAAACTGGAGGAGG - Intergenic
1188855665 X:35192448-35192470 CAGGTGCTGGAAGCTTGGGGAGG - Intergenic
1191116950 X:56862724-56862746 CAAGCTAAGGAATCTGGGAGTGG + Intergenic
1191253059 X:58268423-58268445 GAGGCACTGGCATCTGGGGGAGG + Intergenic
1191902680 X:66055515-66055537 CAGGCTATGGCACCTGGGTGGGG + Intergenic
1192161836 X:68794190-68794212 GAGGTTCTGGAACCTGGGAGGGG + Intergenic
1192934910 X:75849371-75849393 CAGGCTGTGGATTCAGAGGGTGG - Intergenic
1193663546 X:84287406-84287428 CAAGCTATGGAATCTGGGTGTGG + Intergenic
1195574946 X:106439030-106439052 CAATCTGTGGAATCTGGGGCAGG + Intergenic
1198209866 X:134506795-134506817 CAGTCACTGGCAACTGGGGGTGG + Intronic
1198701496 X:139401741-139401763 CAGGCCCAGGAATCAAGGGGTGG + Intergenic
1200153007 X:153960402-153960424 CAGGCCATGGTATCTGGGGGAGG + Exonic