ID: 1042286214

View in Genome Browser
Species Human (GRCh38)
Location 8:67113818-67113840
Sequence GAACTCAGGGTTGCAGCGTC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 100
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 94}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042286214 Original CRISPR GAACTCAGGGTTGCAGCGTC TGG Exonic
901112510 1:6809788-6809810 GAATTCAGGGTTGCTGAGTGTGG + Intronic
903603037 1:24556078-24556100 GATCCCAGGGTGGCAGCGCCGGG + Intergenic
904029773 1:27527077-27527099 GATCTCAGGGTTGCAGGCTGTGG - Intergenic
905627761 1:39499548-39499570 GAACTGAGGGTCGCAGGGTTTGG + Intronic
907281685 1:53351145-53351167 GAACTCAGAGTTGCTGCCTATGG + Intergenic
907361057 1:53915535-53915557 GAACACAGGGTGACTGCGTCAGG + Intergenic
908676580 1:66611346-66611368 GAGCTCAGGGTTGCAGAGAAGGG + Intronic
910678307 1:89837273-89837295 GAAGTCAGGGATGCAGAGCCTGG - Intronic
910848925 1:91632127-91632149 GACCGCAGGGCTGCAGCATCAGG + Intergenic
916789756 1:168115050-168115072 GAACCCAGGGTTGTAGCAGCTGG + Intronic
920741138 1:208582306-208582328 GAACACAGGATGGCAGCATCTGG + Intergenic
923202295 1:231724315-231724337 GAAATCAGGGTGGAAGAGTCAGG - Intronic
923715309 1:236420268-236420290 TAACTCAGGGTTGAAAAGTCAGG - Intronic
1063930808 10:11026781-11026803 GTTCTCAGGGTTGGAGCCTCGGG + Intronic
1064389867 10:14932729-14932751 CAACTTAGGATTGCAGCCTCAGG + Intronic
1064394883 10:14973876-14973898 CAACTTAGGATTGCAGCCTCAGG + Intronic
1067321475 10:45224847-45224869 GGACTCAGGGTAGCAACTTCTGG - Intergenic
1068438340 10:57019289-57019311 GAACTCTGGGGTGGAGCCTCAGG - Intergenic
1069874699 10:71554563-71554585 GAACCCAGGGCTGCAGGGGCTGG - Intronic
1071515423 10:86293640-86293662 GGATTCAGGGCTGCAGCATCAGG + Intronic
1072448915 10:95523391-95523413 GAACTCAGGGCTGCAGAGCTTGG - Intronic
1076120951 10:127935998-127936020 GAGCTCAGGCATGCAGCTTCTGG + Intronic
1076833045 10:133006541-133006563 GATCTCAGGCTTGCAGCCTCTGG - Intergenic
1076916819 10:133427136-133427158 GGTCTCAGGGCTGCAGCTTCAGG - Intergenic
1076936922 10:133571936-133571958 GGTCTCAGGGCTGCAGCTTCAGG - Intergenic
1076988713 11:257826-257848 GCATTCAGGGTTGCAGGCTCAGG + Intergenic
1091712444 12:2751645-2751667 GAAATCAGGTTTGCAGCTGCTGG + Intergenic
1094265958 12:28560168-28560190 GAGCTCTGGGTTGGAGGGTCTGG - Intronic
1104304330 12:127595629-127595651 GAACTCTGGATTGCAGCAGCTGG + Intergenic
1105211346 13:18258874-18258896 GAGCTCAGGGCTGCAGGGCCTGG - Intergenic
1113503276 13:110794777-110794799 AAACCCAGGGATGCAGGGTCTGG - Intergenic
1115711804 14:36059145-36059167 GAACTCTGGGTGGCCGGGTCAGG + Intergenic
1120414887 14:84206850-84206872 GATCACAGTGTTGCAGAGTCTGG + Intergenic
1127732419 15:61812986-61813008 GATCTCAGACTTGCAGCCTCTGG + Intergenic
1131988449 15:98068269-98068291 GAGCTCAGGGCTGCAGGGTAGGG - Intergenic
1132031896 15:98445266-98445288 GAAAGCAGGCTTGCAGTGTCTGG - Intronic
1133683938 16:8147876-8147898 GAACTCAGGCTTTCATCCTCAGG + Intergenic
1134092579 16:11399447-11399469 GAGGTCAGGGGAGCAGCGTCTGG - Intronic
1135402878 16:22178324-22178346 GAACTGAGGGTTCCAGGCTCAGG - Intronic
1138122468 16:54411624-54411646 GATCTCAGGGCTCCAGCTTCAGG - Intergenic
1140291404 16:73662043-73662065 GAACTCAGGGTTGCCAAGCCAGG + Intergenic
1141907438 16:87036555-87036577 GACCTCAGACTTGCAGCCTCCGG + Intergenic
1143850971 17:9811779-9811801 GAGCTCAGGGCTGCAGAGCCCGG + Intronic
1144052731 17:11510890-11510912 GACCTCAGGGTTTTAGAGTCTGG - Intronic
1145056278 17:19706031-19706053 GAACTCAGGGTGGCAGTGTGAGG + Intronic
1149413711 17:56436022-56436044 GACCTCAGGGTGGCAGGGCCAGG + Intronic
1150435619 17:65152102-65152124 GAGTTCAGGGTTGCAGCTTTAGG + Intronic
1151350803 17:73530977-73530999 GAAACCAGGGTTACAGAGTCAGG - Intronic
1158675085 18:59511110-59511132 GAAGTCAGGGTTTCAGCTGCTGG - Intronic
1160071005 18:75627699-75627721 GAACTCAGAGTCCCAGGGTCAGG - Intergenic
1160379760 18:78444638-78444660 GTACTCAGGGGTGCTGAGTCAGG + Intergenic
1160448018 18:78942214-78942236 GAACTCAGGTTTGCAGGCTGTGG - Intergenic
1160448056 18:78942405-78942427 GAACTCAGGTTTGCAGGCTGTGG - Intergenic
1160448066 18:78942453-78942475 GAACTCAGGTTTGCAGGCTGTGG - Intergenic
1161006112 19:1937572-1937594 AGCCTCAGGGTCGCAGCGTCTGG - Intergenic
1163004439 19:14388750-14388772 GAACCCTGGATTGCAGCGACAGG - Exonic
1163063023 19:14773984-14774006 GAACCCTGGATTGCAGCGACAGG + Exonic
1165705852 19:37975764-37975786 GGAGTCAGGGGTGCAGCCTCTGG + Intronic
1166041544 19:40205830-40205852 GGACCCAGGGCTGCTGCGTCTGG - Intronic
1166108136 19:40607588-40607610 GAACTCAGGGTTGGAGGGTGGGG - Intronic
1167405817 19:49307783-49307805 CAACTCAGGGTTGCCTCCTCTGG + Intronic
931844322 2:66186904-66186926 GAGCTCAGAGTAGCAGCATCAGG - Intergenic
946102134 2:217334611-217334633 GGGCTCTGGGTTGCAGTGTCTGG + Intronic
948265131 2:236630317-236630339 GAGCTCAGGGTCAAAGCGTCAGG - Intergenic
1171011273 20:21510694-21510716 GAACCCCGGGCGGCAGCGTCCGG - Intergenic
1174503875 20:51004450-51004472 GAACTCGCGGGTGCAGCGGCGGG + Exonic
1175655214 20:60763935-60763957 GGACTCAGGGTTCCAGCCCCAGG - Intergenic
1183345912 22:37307551-37307573 GAGCTCAGGGGTCCAGAGTCAGG - Intronic
954683585 3:52358823-52358845 GACCTCAGGGCTGCAGCCTGAGG - Intronic
969222986 4:5773506-5773528 GAACTCAGTGTAGCAGAGGCAGG + Intronic
969844042 4:9905492-9905514 GAACTCAGAGTCTCAGCCTCTGG - Intronic
972167115 4:36300479-36300501 GAAGTCAGGGTTGCAGCTAAGGG - Intronic
972571259 4:40312419-40312441 GTACTCCTGGTTGCAGCATCTGG + Intergenic
976614210 4:87059679-87059701 GAACTCAAGGCTGCAGAGACAGG - Intronic
979630613 4:122898671-122898693 GAATTCAGGCTTTCAGTGTCTGG + Intronic
984185314 4:176536474-176536496 GAACCCAGAGTTGCAGGGCCAGG + Intergenic
988497877 5:31760016-31760038 CAGCTCAGGGGTGCAGCTTCAGG + Intronic
996833772 5:127768520-127768542 GATCTCAGAATTGCAGCCTCTGG + Intergenic
1002188901 5:177468846-177468868 GACCTCAAGCTTGCAGCATCAGG - Exonic
1020068892 7:5212471-5212493 GAAGTGAGGGTGGCAGCCTCAGG + Intronic
1029378736 7:100198839-100198861 GCACTCAGGGTAGAAGAGTCTGG - Exonic
1033538182 7:142331373-142331395 AAACTCAGAGATGCAGCGTGAGG + Intergenic
1033540602 7:142352586-142352608 GAACTCGGAGATGCAGCGTGAGG + Intergenic
1033551863 7:142454894-142454916 GAACTCAGAGATGCAGCGTGAGG + Intergenic
1033554144 7:142473827-142473849 GAACTCAGAGATGCAGTGTGAGG + Intergenic
1033558781 7:142511346-142511368 GAACTCAGAGATGCAGTGTGAGG + Intergenic
1039283481 8:36012004-36012026 GAACTCAAGGATACAGGGTCGGG + Intergenic
1042286214 8:67113818-67113840 GAACTCAGGGTTGCAGCGTCTGG + Exonic
1049282765 8:141758925-141758947 GAACTGAGGGTTGCAGCGAGGGG + Intergenic
1049539182 8:143199538-143199560 GCACTGAGGGTTGCAGGGTGAGG + Intergenic
1049757968 8:144319164-144319186 GAGCTCAGGGCGGCAGCCTCAGG + Intronic
1057569461 9:96193473-96193495 GATCTCAGTGTGGCAGCGTTGGG - Intergenic
1058060760 9:100493252-100493274 GAACTCAGGGTTTCTCAGTCTGG - Intronic
1203563505 Un_KI270744v1:75784-75806 GAAGTCAGAGCTGCAGCGTGAGG + Intergenic
1186210471 X:7245181-7245203 AAGCTCAGGGTTGGAGCATCAGG - Intronic
1188022823 X:25176989-25177011 GAACTGAGGGTCGCAGTGTTCGG - Intergenic
1193611690 X:83639594-83639616 GGACTCAGGTTTCCTGCGTCAGG + Intergenic
1194780501 X:98019827-98019849 GAGCTCAGGGTCCCAGCTTCTGG - Intergenic
1199231225 X:145437977-145437999 CAACTCAGGGTTGCCTCCTCTGG + Intergenic
1201470927 Y:14334240-14334262 GACCTCAGACTTGCAGCCTCCGG + Intergenic