ID: 1042294099

View in Genome Browser
Species Human (GRCh38)
Location 8:67201516-67201538
Sequence CATTCTCTTCCGGATGTACA TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 89
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 82}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042294099_1042294101 -10 Left 1042294099 8:67201516-67201538 CCATGTACATCCGGAAGAGAATG 0: 1
1: 0
2: 0
3: 6
4: 82
Right 1042294101 8:67201529-67201551 GAAGAGAATGCGCAGCCCACAGG 0: 1
1: 0
2: 0
3: 7
4: 112
1042294099_1042294111 29 Left 1042294099 8:67201516-67201538 CCATGTACATCCGGAAGAGAATG 0: 1
1: 0
2: 0
3: 6
4: 82
Right 1042294111 8:67201568-67201590 CTGCTTCAGAAGGTTGGGCTTGG 0: 1
1: 0
2: 1
3: 37
4: 325
1042294099_1042294107 19 Left 1042294099 8:67201516-67201538 CCATGTACATCCGGAAGAGAATG 0: 1
1: 0
2: 0
3: 6
4: 82
Right 1042294107 8:67201558-67201580 TGCTGGTCTCCTGCTTCAGAAGG 0: 1
1: 0
2: 5
3: 17
4: 218
1042294099_1042294102 -5 Left 1042294099 8:67201516-67201538 CCATGTACATCCGGAAGAGAATG 0: 1
1: 0
2: 0
3: 6
4: 82
Right 1042294102 8:67201534-67201556 GAATGCGCAGCCCACAGGCCAGG 0: 1
1: 0
2: 1
3: 18
4: 172
1042294099_1042294103 2 Left 1042294099 8:67201516-67201538 CCATGTACATCCGGAAGAGAATG 0: 1
1: 0
2: 0
3: 6
4: 82
Right 1042294103 8:67201541-67201563 CAGCCCACAGGCCAGGCTGCTGG 0: 1
1: 4
2: 4
3: 64
4: 566
1042294099_1042294108 23 Left 1042294099 8:67201516-67201538 CCATGTACATCCGGAAGAGAATG 0: 1
1: 0
2: 0
3: 6
4: 82
Right 1042294108 8:67201562-67201584 GGTCTCCTGCTTCAGAAGGTTGG 0: 1
1: 0
2: 1
3: 14
4: 184
1042294099_1042294109 24 Left 1042294099 8:67201516-67201538 CCATGTACATCCGGAAGAGAATG 0: 1
1: 0
2: 0
3: 6
4: 82
Right 1042294109 8:67201563-67201585 GTCTCCTGCTTCAGAAGGTTGGG 0: 1
1: 0
2: 0
3: 16
4: 186

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042294099 Original CRISPR CATTCTCTTCCGGATGTACA TGG (reversed) Exonic
900373690 1:2343860-2343882 CATTCTCTTCCGGAAGAATGGGG - Intronic
910084625 1:83384885-83384907 CATTCTCTTCTTAATGTCCATGG - Intergenic
911368779 1:96972364-96972386 CATTTTCTTCAGTATTTACAAGG - Intergenic
920005539 1:202830850-202830872 CATTCTCTTGAGTATGTACCTGG - Intergenic
924538036 1:244954763-244954785 CATTCTCTTCTTGACGTACATGG - Intergenic
1062825216 10:562537-562559 CATTCTTTTCCATATGCACACGG + Intronic
1064941194 10:20737594-20737616 CATGCTCTGCCGAATTTACATGG + Intergenic
1069469311 10:68672942-68672964 CATTCTCTTTTGGCTGTTCATGG + Exonic
1073068501 10:100778727-100778749 CCTTCTCCCCAGGATGTACAGGG + Intronic
1073298788 10:102457977-102457999 TATTCTCTTCAGGTTGGACATGG + Intergenic
1080226304 11:29965045-29965067 CATTCTCTTAGGGATGAACAGGG + Intergenic
1088451170 11:109982777-109982799 CAATCTCTTCAGGATCTCCATGG - Intergenic
1092389029 12:8059090-8059112 CATTGTCTTCCGAATGCAAAGGG - Exonic
1093985375 12:25525611-25525633 CATTCTCTTCCCAATGTCAAAGG - Intronic
1105651446 13:22382587-22382609 CAATCTCATGCTGATGTACATGG - Intergenic
1106544753 13:30720842-30720864 CATTCTCTTAGGGATGAGCATGG - Intronic
1112114888 13:96340950-96340972 CAGTCTTTTCTGGTTGTACATGG + Intronic
1112621936 13:101062079-101062101 CAAGCTCTTCCGGATGTCCACGG + Exonic
1115072831 14:29346659-29346681 TATTTTCTTCCTGATGTTCAAGG + Intergenic
1115796049 14:36936765-36936787 GATTTTCTTCTGGATCTACAAGG - Intronic
1120926669 14:89804018-89804040 CATTCTCTTCGGTGTGTACTGGG + Intronic
1122063463 14:99154942-99154964 CATTCTCTTCCTGAACTACATGG + Intergenic
1122196637 14:100092378-100092400 CATTCTCCTGCTGATGGACATGG - Intronic
1127800525 15:62473373-62473395 CATACTCTTCTGTATGTATATGG - Intronic
1135486302 16:22868536-22868558 CATTCTCTAGCTGATATACATGG - Intronic
1138829912 16:60362494-60362516 CATTCTCTTCTGGAGGTTCTGGG - Intergenic
1139935172 16:70565235-70565257 CATTCTGTTCCAGCTGGACAAGG - Exonic
1153390393 18:4551305-4551327 TATTTTCTTCTGGATGTATAGGG + Intergenic
1159366635 18:67474694-67474716 CATTCCCTTCAAGATGTAAAAGG - Intergenic
1160701434 19:509265-509287 GATTCTCTTCCGGATGTCCTGGG - Intronic
1163192090 19:15684804-15684826 CTTTCTCTTCAGGATGAAGATGG + Exonic
1165981633 19:39729143-39729165 CATTCTCTTCCAGAGGTTCTGGG + Intergenic
1166783557 19:45354535-45354557 CATTCTCAGCCTGATGTACTGGG + Intronic
925220057 2:2131844-2131866 CGTTCTCTGCAGGAGGTACATGG + Intronic
925956466 2:8970920-8970942 CAATTTCTACCGGAGGTACAAGG + Intronic
926365442 2:12128968-12128990 CAGTCTCTTCCAGATTTCCAAGG - Intergenic
927707644 2:25306642-25306664 CATTGTCTTCTGGAGGTGCAGGG + Intronic
929694759 2:44104772-44104794 CATTCTCTTCCTCATTTACAGGG + Intergenic
930020077 2:46996415-46996437 CATTCACTTCTGGCTGTTCAGGG - Intronic
932530586 2:72526364-72526386 CATTGACTTCCTTATGTACATGG - Intronic
932743696 2:74313552-74313574 CATTCTCTCCTGGATGTAACAGG + Intronic
935220499 2:101008210-101008232 CATTTTCTTCTGGATCTTCATGG + Exonic
935800917 2:106694976-106694998 CATTCTCCTTTGAATGTACAGGG - Intergenic
936496052 2:113022294-113022316 ATTTCTTTTCCTGATGTACAGGG - Exonic
939581018 2:143945901-143945923 GTTTCTTTTCCGGATGAACAAGG - Exonic
947976957 2:234375067-234375089 CATTCTCTTCTGCATTTCCAGGG - Intergenic
1173618325 20:44417384-44417406 CATTCTCTGCAGGGGGTACAAGG - Intronic
1180702389 22:17788715-17788737 CGTTATCTCCCGGATGTGCATGG + Exonic
1184308412 22:43624891-43624913 CATTCTCTGCCGAACGAACATGG - Intronic
954020010 3:47731670-47731692 CACTCTGTTGCAGATGTACAAGG - Intronic
955676505 3:61454268-61454290 CATTCTCTTTTGGGTTTACAAGG - Intergenic
955853540 3:63247871-63247893 CATTCTCTTCATGATGGAAATGG - Intronic
961445945 3:126981840-126981862 CATTCTCCTGCCGATGGACATGG - Intergenic
967143528 3:186585574-186585596 CATTCTTTTCCGAATGCAAATGG - Exonic
969340926 4:6540756-6540778 CAGTCTCTCCCTGATGCACAAGG - Intronic
970911977 4:21287298-21287320 CATTCTATTGGGAATGTACATGG - Intronic
972410917 4:38793699-38793721 AATTCTTTTTCGGATTTACAGGG + Intronic
976967951 4:91068159-91068181 CATTCTCTTCTCAATGTTCATGG + Intronic
986773783 5:10995814-10995836 CAGTCTCTTCCCCATGTCCATGG - Intronic
986868641 5:12019950-12019972 CATTCTCTTCTAGATTTCCATGG + Intergenic
988470227 5:31531004-31531026 CTTTCTGTTGCGGAGGTACATGG - Intronic
989213009 5:38876043-38876065 AATTCTCTTCCAGATTTCCAAGG + Intronic
995344549 5:111096856-111096878 CATTCTCTTAGGGAAGGACAAGG + Intronic
996615483 5:125436216-125436238 CATTATCTGCTGGGTGTACAGGG - Intergenic
997153569 5:131526657-131526679 CTTTCTCTTCCTGATCTACCTGG + Intronic
998174979 5:139896103-139896125 CAGTCTTTTCTGCATGTACAGGG - Intronic
1004763462 6:18697374-18697396 CATTCTCTTCAGAATGGTCAAGG - Intergenic
1007018848 6:38498311-38498333 CATTCTCTTGCCCATGAACATGG - Intronic
1007486887 6:42186620-42186642 CCATCTCTTCCGCATTTACATGG - Intronic
1011942776 6:92863614-92863636 CATTCTCCGCCTGATCTACAGGG + Intergenic
1013836159 6:114338203-114338225 GATTCTATTCCTGTTGTACAAGG + Intronic
1018221525 6:161585167-161585189 CATTCTCTTTCTGAAGCACACGG + Intronic
1031350662 7:120726944-120726966 AATTTTCTTCCTGTTGTACAAGG + Intronic
1034752693 7:153585786-153585808 CATTCTTTTCCGCATGGACTAGG - Intergenic
1036433403 8:8710246-8710268 CATTCTCTTTAGGAAGTAAATGG - Intergenic
1038773028 8:30501657-30501679 CTTTCTCTTCCAAATGTAAATGG - Intronic
1040448878 8:47524361-47524383 CATTTTAATCTGGATGTACATGG - Intronic
1042294099 8:67201516-67201538 CATTCTCTTCCGGATGTACATGG - Exonic
1042542497 8:69921226-69921248 CATTGCCCTCTGGATGTACAAGG - Intergenic
1046258175 8:111728610-111728632 CATTCACATCCTGAGGTACACGG - Intergenic
1046775000 8:118154603-118154625 CTTTCTCTTCCTGAGGTCCAGGG + Intergenic
1048732912 8:137463659-137463681 CATCTTCCTCCAGATGTACATGG - Intergenic
1048982665 8:139711331-139711353 GATTCTCTTCCGAGTGTAGAGGG + Intergenic
1051209847 9:14729855-14729877 CATCCACTTCTGGATTTACAAGG + Intergenic
1055547122 9:77390033-77390055 CATTCTCCTCCTGAAGTAAAGGG - Intronic
1193894083 X:87089356-87089378 CATTCTTTTTCTTATGTACACGG + Intergenic
1194436160 X:93870785-93870807 ACTTCTCTTCCGGATGTTCCAGG + Intergenic
1197384251 X:125784089-125784111 GCTTCTCTTCCGGATGTTCCAGG + Intergenic
1201943421 Y:19483823-19483845 CACTGTCTTCCAGGTGTACATGG + Intergenic