ID: 1042307281

View in Genome Browser
Species Human (GRCh38)
Location 8:67344367-67344389
Sequence ATCGGTCAACTCTAGATTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 53
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 49}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042307278_1042307281 30 Left 1042307278 8:67344314-67344336 CCTATTGATAAGGGTTCAAAAAT 0: 1
1: 0
2: 2
3: 23
4: 175
Right 1042307281 8:67344367-67344389 ATCGGTCAACTCTAGATTTCAGG 0: 1
1: 0
2: 0
3: 3
4: 49

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042307281 Original CRISPR ATCGGTCAACTCTAGATTTC AGG Intergenic
904753664 1:32756089-32756111 ATGGGTCAACTCAAGCTTTAAGG + Intronic
910634543 1:89392745-89392767 ATAGGCCAAATCTAGAATTCTGG - Intergenic
915926076 1:160020626-160020648 ATCGGGCTACTATAGAGTTCTGG + Intergenic
920924232 1:210327212-210327234 ATCTGTCAACTCTAGATCCAAGG - Intergenic
924045618 1:240026071-240026093 AAAAGTCAACTCAAGATTTCTGG - Intronic
1071798732 10:89034107-89034129 CTCAGTTAACTCTAGATCTCAGG - Intergenic
1074515380 10:114163855-114163877 ATGGCTCAAATCTAGATCTCTGG - Intronic
1075241310 10:120781357-120781379 TTGGATCAACTCTAGATTTGCGG - Intergenic
1082025949 11:47572417-47572439 AAGAGTCAACTCTAGAATTCAGG - Exonic
1091085073 11:132713646-132713668 TTGGGCCAACTCCAGATTTCTGG - Intronic
1093698662 12:22192550-22192572 CTCTGTCAAATCTAGATTTGGGG + Intronic
1101434879 12:104655992-104656014 ATCCGTCATGTCTAGATTCCAGG + Intronic
1106909083 13:34443920-34443942 ATCTGTTAACTCTATATTTAAGG + Intergenic
1109557939 13:64005013-64005035 AACACACAACTCTAGATTTCTGG - Intergenic
1110126292 13:71946953-71946975 ATGGTACAACTCTAGATTTCTGG - Intergenic
1116975707 14:51113716-51113738 TTGGGTCAATTCTAGATTTGGGG + Intergenic
1135472878 16:22747503-22747525 ATCTGGCAACTCTGGATGTCAGG + Intergenic
1139306112 16:65987645-65987667 TTGGGTCAATTCTATATTTCAGG - Intergenic
930290489 2:49487123-49487145 ATCAGAAATCTCTAGATTTCAGG - Intergenic
933289245 2:80419617-80419639 ATCGGTAAACTCTAGTCTTCAGG - Intronic
934636458 2:95993727-95993749 ATCAGTCATCTCTGTATTTCTGG + Intergenic
934797187 2:97111704-97111726 ATCAGTCATCTCTGTATTTCTGG - Intergenic
934836223 2:97591729-97591751 ATCAGTCATCTCTGTATTTCTGG + Intergenic
946660831 2:221997689-221997711 AGCAGTAAACTCTAGATTCCTGG - Intergenic
947346456 2:229195101-229195123 ATCGTTTAAATCTTGATTTCAGG + Intronic
1172347684 20:34216780-34216802 ATCTGTCTACTCTAGCTTTGTGG + Intronic
1183695092 22:39417207-39417229 TTCGGTCATCTCCAGCTTTCTGG + Intronic
949279773 3:2332142-2332164 ATTGGAAAACTTTAGATTTCAGG + Intronic
951035133 3:17924657-17924679 GTCTGGCAACTCTAGATTTAGGG + Intronic
956317746 3:67957579-67957601 ATTGTTCATCTCTAAATTTCAGG + Intergenic
971139764 4:23911447-23911469 ATCTGTCATCTCAAGATCTCAGG - Intergenic
975076478 4:70215495-70215517 AGCTGTCAACTCTGGATTTGTGG + Intergenic
975077055 4:70222806-70222828 AGCTGTCAACTCTGGATTTGTGG - Intergenic
976727805 4:88231757-88231779 CTCGGTCCTCTTTAGATTTCTGG - Intergenic
983876158 4:172876893-172876915 ATGGGCCAACTAAAGATTTCTGG + Intronic
984396617 4:179210053-179210075 CTCAGTCAACTCCACATTTCGGG + Intergenic
991240128 5:64448985-64449007 ATCATTCAAATATAGATTTCTGG + Intergenic
1003483673 6:6556035-6556057 AAGAGTCAACTCTAGATTTAGGG - Intergenic
1014355636 6:120406077-120406099 ATCGGCCTACTCTAAAATTCTGG - Intergenic
1021013423 7:15501201-15501223 TTTGGTCAAGTCTTGATTTCAGG + Intronic
1021328726 7:19307853-19307875 AGCAGTCAACTCTAGATTTTAGG + Intergenic
1023485039 7:40677222-40677244 TTCGGCCAACTCTACATTTTAGG + Intronic
1027820195 7:83032771-83032793 ATGATTCAACTCTAGATTTTTGG - Intronic
1031952335 7:127905181-127905203 AAAGGTCAAGTATAGATTTCAGG + Intronic
1042307281 8:67344367-67344389 ATCGGTCAACTCTAGATTTCAGG + Intergenic
1042459194 8:69042911-69042933 ATTTGTCTATTCTAGATTTCCGG + Intergenic
1044623289 8:94211976-94211998 AACTGTGAACTCTAGGTTTCAGG - Intronic
1050706276 9:8402208-8402230 TTAGGTCAGCTCTAGATTTAGGG + Intronic
1050872180 9:10585948-10585970 ATTTGTCAACATTAGATTTCAGG - Intronic
1052497646 9:29247629-29247651 AGTGGACAACTCTAGATTACAGG + Intergenic
1054722159 9:68615033-68615055 ATCTGACAGCTCCAGATTTCCGG - Intergenic
1187048119 X:15668724-15668746 ATCTGTGAACTCTTTATTTCTGG - Intergenic
1189227560 X:39426082-39426104 ATCTGTCTCCTCTAGATTTGGGG - Intergenic