ID: 1042307497

View in Genome Browser
Species Human (GRCh38)
Location 8:67346654-67346676
Sequence TTGTGGAGATCGTGGCACAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042307493_1042307497 -10 Left 1042307493 8:67346641-67346663 CCACCAAGCAAGGTTGTGGAGAT No data
Right 1042307497 8:67346654-67346676 TTGTGGAGATCGTGGCACAAGGG No data
1042307491_1042307497 -4 Left 1042307491 8:67346635-67346657 CCAGGGCCACCAAGCAAGGTTGT No data
Right 1042307497 8:67346654-67346676 TTGTGGAGATCGTGGCACAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042307497 Original CRISPR TTGTGGAGATCGTGGCACAA GGG Intergenic
No off target data available for this crispr