ID: 1042310611

View in Genome Browser
Species Human (GRCh38)
Location 8:67375577-67375599
Sequence CTAAAATCAAGGCATCAGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042310607_1042310611 -7 Left 1042310607 8:67375561-67375583 CCTAGGTCTTACTGGGCTAAAAT No data
Right 1042310611 8:67375577-67375599 CTAAAATCAAGGCATCAGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042310611 Original CRISPR CTAAAATCAAGGCATCAGTG GGG Intergenic
No off target data available for this crispr