ID: 1042316238

View in Genome Browser
Species Human (GRCh38)
Location 8:67429136-67429158
Sequence CAGTACCTGTGTAAGATCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 110
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 104}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042316238_1042316240 -1 Left 1042316238 8:67429136-67429158 CCACAGATCTTACACAGGTACTG 0: 1
1: 0
2: 0
3: 5
4: 104
Right 1042316240 8:67429158-67429180 GCGAAGAGGTAGAAAGTCTAAGG No data
1042316238_1042316242 20 Left 1042316238 8:67429136-67429158 CCACAGATCTTACACAGGTACTG 0: 1
1: 0
2: 0
3: 5
4: 104
Right 1042316242 8:67429179-67429201 GGTGGAACTTTTCCTAAGAATGG No data
1042316238_1042316241 2 Left 1042316238 8:67429136-67429158 CCACAGATCTTACACAGGTACTG 0: 1
1: 0
2: 0
3: 5
4: 104
Right 1042316241 8:67429161-67429183 AAGAGGTAGAAAGTCTAAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042316238 Original CRISPR CAGTACCTGTGTAAGATCTG TGG (reversed) Intronic
903685822 1:25131158-25131180 CATTACCTGTCTGAGATCTCTGG + Intergenic
903699713 1:25237969-25237991 CAGTACCTACATAAGATCAGAGG + Intergenic
905263706 1:36736749-36736771 CAGGCCTTGTGGAAGATCTGAGG + Intergenic
909610642 1:77548386-77548408 CAGAACCTGGGCATGATCTGGGG - Intronic
910539010 1:88333446-88333468 CAGCACCAGTGAAAGGTCTGTGG + Intergenic
910778070 1:90896001-90896023 CAGTAGCTGTGTGAAATCTGTGG + Intergenic
917075835 1:171203754-171203776 CAGAACCTCTGTAAATTCTGGGG + Intronic
918643885 1:186880006-186880028 CAGGCCCTGTGTAAGAACTTTGG + Intronic
921330024 1:214026068-214026090 CAGTATCTGTGTAGTATCTCAGG + Intronic
923627856 1:235628600-235628622 CTGGTCCTGTGTAAGTTCTGGGG + Intronic
1064218922 10:13422997-13423019 CAGTTCCTGTGAAAGACCCGTGG - Intergenic
1068656115 10:59577863-59577885 AAGTAACTGGGTGAGATCTGGGG + Intergenic
1072234594 10:93442494-93442516 CAGTTCTTGTGTAAGAGGTGTGG - Intronic
1074794815 10:116932217-116932239 CAGTACCAGTCCAAGACCTGGGG - Intronic
1075992756 10:126851821-126851843 CAGCCCCTGTGAAAGTTCTGTGG - Intergenic
1085693975 11:78688359-78688381 CAGGTCCTGTGCAAGATATGTGG - Intronic
1091613169 12:2029085-2029107 AAGTACCTGAGTGAGAACTGAGG + Intronic
1092816301 12:12315108-12315130 CAGAACTTGTGGATGATCTGAGG - Intergenic
1098976465 12:76907406-76907428 CATACTCTGTGTAAGATCTGAGG + Intergenic
1100711877 12:97265981-97266003 CAGTACCTGTGTCAGACATTGGG + Intergenic
1105464613 13:20626639-20626661 CAGTGCCAGTGAGAGATCTGCGG - Intronic
1107389706 13:39951427-39951449 CTGATCCTGTGTAACATCTGTGG - Intergenic
1108579418 13:51815975-51815997 AAGTACCTCTCTATGATCTGCGG - Intergenic
1109883675 13:68513692-68513714 CAGTAGTTGTATAATATCTGTGG - Intergenic
1115800492 14:36988153-36988175 CATCACCTGTGTAATATCGGGGG + Intronic
1121711810 14:96044069-96044091 CAGTACCCCTGCAAGAGCTGGGG + Intronic
1128169562 15:65499185-65499207 CACTTCCTGTGTAAGCACTGAGG - Intronic
1128434547 15:67633043-67633065 CAGTGCCTCTGTAAAATGTGGGG - Intronic
1129653725 15:77509018-77509040 CAGGACCTGTGTAAGAGGTAGGG + Intergenic
1131429331 15:92374098-92374120 GAGTGCCTGTGTGAGATGTGAGG - Intergenic
1138150662 16:54653876-54653898 CAGGGTCTGTGAAAGATCTGTGG - Intergenic
1146666433 17:34707701-34707723 AAGTACATGTGCAAGATGTGCGG + Intergenic
1152424867 17:80213513-80213535 CAGGACCTGGGTCAGATTTGGGG - Intronic
1154011595 18:10579348-10579370 CAGCACCTGGGTAACCTCTGGGG - Intergenic
1155368375 18:25072005-25072027 CAGGAACTGTGTAGGAGCTGAGG + Intronic
1156698169 18:39793189-39793211 CAGGACATGTGTAAGACCTTTGG - Intergenic
1165590366 19:36964115-36964137 CAGTAACTTTGTAAGATCTCAGG + Intronic
925578366 2:5384198-5384220 CAGTGCCTGTGGGAGACCTGGGG - Intergenic
927178272 2:20425350-20425372 TAGTTCCTGTGTATTATCTGCGG + Intergenic
928971576 2:37035030-37035052 CAGTAGTTGTGTAAGATGGGTGG - Intronic
935516890 2:104051397-104051419 CAGTGCCTGGGTAAGCTCTCAGG + Intergenic
937151437 2:119689067-119689089 CAGTACAGGTGTGACATCTGTGG - Intergenic
939595610 2:144118963-144118985 CAGACCCTGAGTAAGTTCTGGGG - Intronic
942215666 2:173716928-173716950 CAGTGCCTGAGTAAGACCTGGGG - Intergenic
943798702 2:192030756-192030778 CAGTAAATGTGAAAGAACTGTGG + Intronic
946946333 2:224826451-224826473 GAGTAAGTGTGGAAGATCTGAGG - Intronic
1169265439 20:4164515-4164537 CAGGACCTGTGTGAAAGCTGTGG + Intronic
1172738019 20:37143196-37143218 CCCTACATGAGTAAGATCTGTGG + Intronic
1174609931 20:51790684-51790706 CCGTTCCAGTGTAAGATCTGTGG - Exonic
1175018029 20:55812830-55812852 CAGTACATGTGTAAGCAGTGGGG + Intergenic
1176179353 20:63742151-63742173 CAGTGTCTGTGGAAGAGCTGCGG + Exonic
1176523663 21:7848249-7848271 GAGTACCTGTGTAAAATATATGG - Intergenic
1178657683 21:34478261-34478283 GAGTACCTGTGTAAAATATATGG - Intergenic
1181046154 22:20215277-20215299 CCTCACCTGTGTAAGATCTCAGG - Intergenic
949435476 3:4024603-4024625 CAATAGCTGTGTGAGACCTGTGG - Intronic
952552113 3:34490715-34490737 CAGTAACTGTTCAAAATCTGGGG + Intergenic
953055680 3:39385452-39385474 CAGCACCTGTGTGAGCACTGGGG + Intronic
955867315 3:63398809-63398831 CAGTCCCTGAGGAATATCTGAGG + Intronic
956608665 3:71099554-71099576 AAGTGCCTGTGTAAAAACTGTGG - Intronic
956764389 3:72472224-72472246 CAGTACCAGTCTATGACCTGGGG - Intergenic
962612518 3:137091571-137091593 CAGTACCTATTTAAAATCAGTGG - Intergenic
965751625 3:171980627-171980649 CACTTCCTGTGTAATATCAGTGG - Intergenic
966443381 3:179973311-179973333 CTGTTCCTGGGCAAGATCTGTGG - Intronic
967437164 3:189461331-189461353 AAATACCTTTGTAAGAGCTGAGG + Intergenic
969158517 4:5234389-5234411 CAGTATCTGTAAAAGATGTGGGG - Intronic
972845830 4:42988006-42988028 CAGAAACTGTGTGACATCTGAGG - Intronic
973615805 4:52676757-52676779 CAGCAGCTGTGCAGGATCTGAGG + Intergenic
974338297 4:60580266-60580288 GAGGATCTGTGTAAAATCTGGGG - Intergenic
974381902 4:61151710-61151732 AAGTACCTGTGTCTGATTTGTGG + Intergenic
977475693 4:97506052-97506074 CAGACACTGTGTTAGATCTGTGG + Intronic
979646644 4:123077405-123077427 CAAGAACTGTGAAAGATCTGGGG + Intronic
981094939 4:140769472-140769494 CAGTTCCTTTCTAAAATCTGTGG + Intergenic
981340460 4:143616044-143616066 CTGAATCTGTGAAAGATCTGAGG - Intronic
984667600 4:182445844-182445866 CAATTCTTGTCTAAGATCTGCGG - Intronic
986012147 5:3725896-3725918 CACTCCCTGTGTAAGAATTGGGG - Intergenic
995764749 5:115602691-115602713 CTGTACCTCTGAAAGATCTACGG - Intronic
996759122 5:126969518-126969540 AAATACCTGTGTTAGAACTGTGG - Intronic
1005632775 6:27724128-27724150 CGGTAGTTGTGTAAGATTTGAGG - Intergenic
1007200201 6:40101387-40101409 CAGTTCCTGGGTAAGATGAGAGG - Intergenic
1013698250 6:112730140-112730162 CCATACCTGTGTAATCTCTGGGG - Intergenic
1018907277 6:168082905-168082927 CAGTGCCTGGGGAAGAACTGGGG - Intergenic
1019900217 7:4014545-4014567 CAGTCTCTGTGTCAGATCCGAGG + Intronic
1020789176 7:12604647-12604669 CAATACCTTTATAAGTTCTGAGG - Exonic
1022989446 7:35694163-35694185 CAGTAAGTGTGTAAAAGCTGGGG - Exonic
1026566375 7:71492882-71492904 AAGTAGCTGTGGAAGATTTGGGG + Intronic
1027579865 7:79978843-79978865 CAATTCCTGTATAAGACCTGAGG - Intergenic
1028258731 7:88633891-88633913 AACTACCTATGTCAGATCTGCGG - Intergenic
1030789458 7:113706181-113706203 CAAGACCTGTGTAAGAACTTGGG - Intergenic
1033806555 7:144960879-144960901 CAGTAACTGTCACAGATCTGAGG - Intergenic
1037604271 8:20424144-20424166 AAGTACCTGTGAAAAAGCTGAGG - Intergenic
1039350846 8:36761932-36761954 CAGTCCATCTGTCAGATCTGTGG - Intergenic
1042316238 8:67429136-67429158 CAGTACCTGTGTAAGATCTGTGG - Intronic
1043045710 8:75321412-75321434 CAGTCCTTGAGTATGATCTGAGG - Intergenic
1045408114 8:101888033-101888055 CAGTCCCAGTGAAAGTTCTGAGG + Intronic
1046048891 8:108997158-108997180 CAGTATCTGTGAAAGATTTGTGG - Intergenic
1046254589 8:111679839-111679861 CAGTCTCTGTGTAAGGTCAGGGG - Intergenic
1047619262 8:126589618-126589640 CAGTGACTGTGTAAGCCCTGTGG + Intergenic
1049937166 9:510441-510463 CAGTGCTTGTTTAAGTTCTGAGG + Intronic
1050890306 9:10817000-10817022 CAGTGCCTATGGAAGAACTGAGG + Intergenic
1055461834 9:76527057-76527079 AGGTATCTGTGTAAGAACTGGGG - Intergenic
1056288934 9:85121553-85121575 CAAAACCTGAGTAAGCTCTGTGG + Intergenic
1058272965 9:102998048-102998070 CAGTAACTGTGCATGTTCTGAGG - Intronic
1058881075 9:109286270-109286292 CAGGAGGTGGGTAAGATCTGGGG + Intronic
1062622990 9:137430971-137430993 CCATCCCTGTGTAAGACCTGGGG + Intronic
1185558786 X:1042702-1042724 GACCACCTGTGTACGATCTGAGG + Intergenic
1187573965 X:20534269-20534291 CAGTAGCTGTGGAGGACCTGAGG + Intergenic
1188437669 X:30180482-30180504 CAGGCCCTGTGTGAGCTCTGAGG - Intergenic
1194657668 X:96592877-96592899 CACTATCTGGGTAAGACCTGAGG - Intergenic
1201861520 Y:18602889-18602911 CAGTACCTTTGTTATATTTGGGG + Intergenic
1201871803 Y:18717491-18717513 CAGTACCTTTGTTATATTTGGGG - Intergenic