ID: 1042322457

View in Genome Browser
Species Human (GRCh38)
Location 8:67491184-67491206
Sequence CAGAAGAATCAATTGGAGTC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042322451_1042322457 25 Left 1042322451 8:67491136-67491158 CCAAAATGGGTGCATCTCAACAC 0: 1
1: 0
2: 1
3: 7
4: 112
Right 1042322457 8:67491184-67491206 CAGAAGAATCAATTGGAGTCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042322457 Original CRISPR CAGAAGAATCAATTGGAGTC GGG Intronic
No off target data available for this crispr