ID: 1042323455

View in Genome Browser
Species Human (GRCh38)
Location 8:67503384-67503406
Sequence GAGGACCTGTTGAACTCAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 11778
Summary {0: 1, 1: 0, 2: 22, 3: 708, 4: 11047}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042323455_1042323461 2 Left 1042323455 8:67503384-67503406 CCTCCTGAGTTCAACAGGTCCTC 0: 1
1: 0
2: 22
3: 708
4: 11047
Right 1042323461 8:67503409-67503431 TCCTCAGCCTCTGGAGTAGCTGG 0: 70
1: 3295
2: 19822
3: 235990
4: 282143
1042323455_1042323463 3 Left 1042323455 8:67503384-67503406 CCTCCTGAGTTCAACAGGTCCTC 0: 1
1: 0
2: 22
3: 708
4: 11047
Right 1042323463 8:67503410-67503432 CCTCAGCCTCTGGAGTAGCTGGG 0: 2984
1: 16415
2: 226878
3: 278634
4: 169895
1042323455_1042323457 -7 Left 1042323455 8:67503384-67503406 CCTCCTGAGTTCAACAGGTCCTC 0: 1
1: 0
2: 22
3: 708
4: 11047
Right 1042323457 8:67503400-67503422 GGTCCTCCCTCCTCAGCCTCTGG No data
1042323455_1042323465 11 Left 1042323455 8:67503384-67503406 CCTCCTGAGTTCAACAGGTCCTC 0: 1
1: 0
2: 22
3: 708
4: 11047
Right 1042323465 8:67503418-67503440 TCTGGAGTAGCTGGGACTACAGG 0: 1302
1: 9603
2: 118577
3: 247901
4: 241623

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042323455 Original CRISPR GAGGACCTGTTGAACTCAGG AGG (reversed) Intronic
Too many off-targets to display for this crispr