ID: 1042323456

View in Genome Browser
Species Human (GRCh38)
Location 8:67503387-67503409
Sequence AGGGAGGACCTGTTGAACTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1609
Summary {0: 1, 1: 0, 2: 6, 3: 95, 4: 1507}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042323456_1042323457 -10 Left 1042323456 8:67503387-67503409 CCTGAGTTCAACAGGTCCTCCCT 0: 1
1: 0
2: 6
3: 95
4: 1507
Right 1042323457 8:67503400-67503422 GGTCCTCCCTCCTCAGCCTCTGG No data
1042323456_1042323463 0 Left 1042323456 8:67503387-67503409 CCTGAGTTCAACAGGTCCTCCCT 0: 1
1: 0
2: 6
3: 95
4: 1507
Right 1042323463 8:67503410-67503432 CCTCAGCCTCTGGAGTAGCTGGG 0: 2984
1: 16415
2: 226878
3: 278634
4: 169895
1042323456_1042323465 8 Left 1042323456 8:67503387-67503409 CCTGAGTTCAACAGGTCCTCCCT 0: 1
1: 0
2: 6
3: 95
4: 1507
Right 1042323465 8:67503418-67503440 TCTGGAGTAGCTGGGACTACAGG 0: 1302
1: 9603
2: 118577
3: 247901
4: 241623
1042323456_1042323461 -1 Left 1042323456 8:67503387-67503409 CCTGAGTTCAACAGGTCCTCCCT 0: 1
1: 0
2: 6
3: 95
4: 1507
Right 1042323461 8:67503409-67503431 TCCTCAGCCTCTGGAGTAGCTGG 0: 70
1: 3295
2: 19822
3: 235990
4: 282143

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042323456 Original CRISPR AGGGAGGACCTGTTGAACTC AGG (reversed) Intronic
900375840 1:2354335-2354357 CGGGAGGACTGCTTGAACTCAGG + Intronic
900502628 1:3013971-3013993 AGGCAGCACCTGCTGAACTCCGG + Intergenic
900565048 1:3328041-3328063 AGGGAAGACCTGGGGGACTCGGG + Intronic
900664913 1:3808655-3808677 TGGGAGGATCAGTTGAGCTCAGG + Intergenic
901092268 1:6649798-6649820 TGGGAGGATCTCTTGAACCCAGG - Intronic
901104507 1:6744764-6744786 AGGGAGGATCACTTGAGCTCAGG - Intergenic
901330756 1:8406298-8406320 AGGGAGGATCGGTTGAGCCCAGG - Intronic
901369391 1:8783575-8783597 TGGGAGGACTGTTTGAACTCAGG + Intronic
901382820 1:8886218-8886240 AGGCAGGACCACTTGAACCCAGG + Intergenic
901423799 1:9168298-9168320 AGGGAGGATCGCTTGAACCCAGG + Intergenic
901493432 1:9608143-9608165 TGGGAGGATCGGTTGAACCCAGG + Intronic
901531652 1:9857364-9857386 CGGGAGGGACTGTTGTACTCGGG + Intronic
901729806 1:11271233-11271255 CGGGAGGATCTCTTGAGCTCAGG - Intergenic
901887891 1:12236608-12236630 TGGGAGGATCACTTGAACTCAGG - Intronic
902077166 1:13796526-13796548 CGGGAGGATCATTTGAACTCAGG + Intronic
902307831 1:15556064-15556086 TGGGAGGACCACTTGAGCTCAGG + Intronic
902442932 1:16442827-16442849 TGGGAGGATCTCTTGAGCTCAGG + Intronic
902510022 1:16961364-16961386 AGGGAGGACCACTTGAGCCCGGG - Intronic
902514441 1:16982466-16982488 TGGGAGAACCTCTTGAACCCGGG - Intergenic
902682987 1:18056834-18056856 AGGGAGGATCTGAGAAACTCTGG + Intergenic
902918309 1:19651968-19651990 CGGGAGGACCACTTGAACTCAGG - Intronic
902972287 1:20062564-20062586 TGGGAGGATCAGTTGAGCTCAGG + Intronic
903059992 1:20662776-20662798 AGGCAGGAGGTGTGGAACTCAGG - Intergenic
903221394 1:21871487-21871509 CGGGAGGACCACTTGAGCTCAGG - Intronic
903293847 1:22331390-22331412 TGGGAGGACCACTTGAACCCGGG + Intergenic
903542463 1:24104773-24104795 AGGGAGGACCACTTGAACCCAGG - Intronic
903585808 1:24414625-24414647 CGGGAGGATCGCTTGAACTCGGG - Intronic
903618738 1:24682205-24682227 TGGGAGGATCGCTTGAACTCCGG - Intergenic
903648356 1:24908417-24908439 TGGGAGGATCAGTTGAACCCAGG + Intronic
903904026 1:26670732-26670754 CGGGAGGATCAATTGAACTCAGG - Intergenic
903917672 1:26776074-26776096 TGGGAGGATCACTTGAACTCAGG - Intronic
903956688 1:27031042-27031064 AGGGAGGATCGCTTGAACCCAGG - Intergenic
903981090 1:27188808-27188830 AGGGTGGACCGCTTGAGCTCAGG - Intergenic
904134470 1:28300629-28300651 AGGGAGGATCGTTTGAACCCGGG + Intergenic
904190524 1:28739525-28739547 AGGGCGGACCTCTTGAGCTCAGG - Intronic
904241853 1:29152048-29152070 TGGGAGGACCGCTTGAACCCAGG + Intronic
904474216 1:30754441-30754463 TGGGAGGATCTCTTGAACCCAGG + Intronic
904505394 1:30948656-30948678 TGGGAGGACCACTTGAGCTCAGG + Intronic
904524492 1:31122525-31122547 TGGGAGGACCTCTTGAGCCCAGG + Intergenic
904622141 1:31782081-31782103 AGGGAGGACCTTGGGGACTCTGG - Intergenic
904663289 1:32100936-32100958 AGGGAGAACCACTTGAACTCAGG + Intronic
905079323 1:35303194-35303216 TGGGAGGATCAGTTGAACTTGGG + Intronic
905130571 1:35753316-35753338 CAGGAGGATCTGTTGAGCTCAGG - Intronic
905169687 1:36102084-36102106 AGGGAGGATCACTTGAGCTCAGG + Intronic
905177593 1:36147549-36147571 CGGGAGGACTGCTTGAACTCGGG + Intronic
905195109 1:36270159-36270181 AGGGAGGACTCCTTGAACCCAGG + Intronic
905215649 1:36405616-36405638 CAGGAGGACCTCTTGAGCTCAGG - Intergenic
905672759 1:39803058-39803080 CGGGAGGATCACTTGAACTCAGG + Intergenic
905826068 1:41027029-41027051 TGGGAGGATCTCTTGAGCTCAGG - Intergenic
905962522 1:42056045-42056067 AGGGAGGATCATTTGAGCTCTGG + Intergenic
905978319 1:42197749-42197771 AGGGAGGATCACTTGAACCCAGG - Intronic
906043835 1:42811710-42811732 AAGGAGGAACTGATGAACTGGGG + Intronic
906197973 1:43941017-43941039 TGGGAGGATCTCTTGAACTCAGG - Intergenic
906349316 1:45044095-45044117 CAGGAGGACCACTTGAACTCAGG + Intronic
906428228 1:45732267-45732289 AGGGAGAACCGCTTGAACCCGGG + Intronic
906446583 1:45904691-45904713 AGGGTGGATCACTTGAACTCAGG - Intronic
906802306 1:48748826-48748848 AGAGAGGACCTGAAGAACCCCGG - Intronic
907163195 1:52386732-52386754 AGGGAGGACTGCTTAAACTCAGG + Intronic
907183543 1:52591218-52591240 AGGGAGGATCACTTGAACCCAGG + Intergenic
907187301 1:52619551-52619573 TGGGAGGACTGGTTGAGCTCAGG + Intergenic
907342262 1:53743995-53744017 TGGGAGGATCCCTTGAACTCAGG - Intergenic
907543527 1:55238861-55238883 AGGGAGGATTGCTTGAACTCAGG + Intergenic
908250162 1:62259367-62259389 TGGGAGGATCTCTTGAACCCAGG - Intronic
908817693 1:68050849-68050871 GGGGAGGAACTGTTAAACTGTGG + Intronic
909019821 1:70418475-70418497 AGGGAGGATCACTTGAGCTCAGG - Intronic
909073685 1:71027258-71027280 AGGGAGGAACCCTTGAACCCAGG - Intronic
909664615 1:78119463-78119485 TGGCAGGACCTTTTGATCTCAGG - Exonic
909987582 1:82181647-82181669 TAGGAGGATCTGTTGAGCTCAGG - Intergenic
910921964 1:92358017-92358039 AGGGAGGATCACTTGAACCCAGG - Intronic
910922027 1:92358678-92358700 AAGGAGGATCACTTGAACTCAGG - Intronic
910925621 1:92395406-92395428 AGGGTGGACCACTTGAGCTCAGG + Exonic
910965586 1:92805048-92805070 TGGGAGGATCACTTGAACTCAGG + Intergenic
910989179 1:93037140-93037162 TGGGAGGATCTCTTGAACCCGGG + Intergenic
911548761 1:99254159-99254181 TGGGAGGATCATTTGAACTCAGG + Intergenic
911639158 1:100268486-100268508 TGGGAGGACCTGTTGGGCCCAGG - Intronic
911905202 1:103558668-103558690 AGGGAGGACCACTTAAGCTCAGG + Intronic
912175788 1:107154501-107154523 TGGGAGGATCTGTTGAGCCCAGG + Intronic
912320749 1:108710711-108710733 CGGGAGGATCACTTGAACTCAGG - Intergenic
912376950 1:109217651-109217673 TGGGAGGACCAGTTGAGCCCAGG - Intronic
913307404 1:117445752-117445774 AGGGAGGATCACTTGAGCTCGGG - Intronic
913462604 1:119104044-119104066 TGGGAGGATCACTTGAACTCAGG - Intronic
913689542 1:121266200-121266222 GGGGAGGACCACTTGAAGTCAGG - Intronic
914148056 1:145014072-145014094 GGGGAGGACCACTTGAAGTCAGG + Intronic
914692571 1:150044023-150044045 TAGGAGGACCTCTTGAACCCAGG + Intergenic
914798982 1:150946110-150946132 TGGGAGGACCACTTGAACCCTGG - Intronic
914812372 1:151038279-151038301 TGGGAGGACCGCTTGAACCCTGG + Intronic
914877356 1:151522048-151522070 TGGGAGGACCACTTGAACCCAGG + Intronic
914918967 1:151834831-151834853 CAGGAGGACCTCTTGAACCCAGG - Intergenic
915150500 1:153827016-153827038 AGGGAGGACCACTTGAGCTCAGG + Intronic
915327729 1:155089506-155089528 TGGGAGGACCGCTTGACCTCTGG + Intergenic
915352795 1:155236955-155236977 AGGGAGAATCAGTTGAACCCGGG - Intronic
915679326 1:157564938-157564960 TGGGAGGATCTCTTGAGCTCAGG + Intergenic
915986131 1:160466831-160466853 TGGGAGGATCAATTGAACTCAGG - Intergenic
916031740 1:160882960-160882982 TGGGAGGATCGCTTGAACTCAGG - Intronic
916081903 1:161238781-161238803 TGGGAGGACTGCTTGAACTCGGG + Intergenic
916303403 1:163301558-163301580 CGGGAGGATCGGTTGAGCTCAGG - Intronic
916655827 1:166874685-166874707 GGGGAGGATCTCTTGAGCTCAGG + Intronic
917054775 1:170968653-170968675 TGGGAGGACCTCTTGAGCCCAGG + Intronic
917094816 1:171389585-171389607 TGGGAGGATCTATTGAGCTCAGG - Intergenic
917323218 1:173805420-173805442 AGGGAGGACTACTTGAACCCAGG + Intronic
917532342 1:175847203-175847225 TGGGAGGATCACTTGAACTCAGG - Intergenic
917605718 1:176626948-176626970 TGGGAGGATCGCTTGAACTCAGG - Intronic
917965032 1:180173187-180173209 AGGGAGGATCACTTGAACCCTGG - Intronic
918500438 1:185189069-185189091 AGGGAGGACCACTTGAGCTCAGG - Intronic
918674021 1:187259028-187259050 TGGGAGGATCACTTGAACTCAGG - Intergenic
918738307 1:188095153-188095175 AGGGAGGATCACTTGAAGTCAGG + Intergenic
919213350 1:194517768-194517790 TGGGAGGATCTCTTGAACCCAGG + Intergenic
919674985 1:200372725-200372747 TGGGAGGATCCCTTGAACTCAGG - Intergenic
919765049 1:201121736-201121758 TGGGAGGATCAGTTGAGCTCAGG + Intronic
919930785 1:202220308-202220330 AGGGAGAATCACTTGAACTCAGG - Intronic
919936579 1:202254828-202254850 CGGGAGGATCTCTTGAACTCAGG + Intronic
920009354 1:202856622-202856644 CGGGAGGACCACTTGAACCCAGG + Intergenic
920063580 1:203247289-203247311 AGGGAGGATCACTTGAACCCAGG + Intronic
920122772 1:203671387-203671409 AGGGAGGATTGCTTGAACTCAGG - Intronic
920189334 1:204182665-204182687 AGGGAGAATCTCTTGAACCCGGG - Intergenic
920208771 1:204313144-204313166 TGGGAGGACCTCTTGAAGCCAGG - Intronic
920476868 1:206284674-206284696 CGGGAGGACCACTTGAAGTCAGG - Intronic
920530234 1:206696473-206696495 TGGGAGGATCTTTTGAACTCAGG + Intronic
920844986 1:209586077-209586099 AGGAAGGACAGGCTGAACTCAGG - Intronic
920915769 1:210256851-210256873 AGGGAGGATCTTTTGAGCCCAGG + Intergenic
920999410 1:211027375-211027397 TAGGAGGATCTCTTGAACTCAGG + Intronic
921101701 1:211934188-211934210 TGGGAGGATCCCTTGAACTCAGG + Intergenic
921144905 1:212344934-212344956 AGGGTGGATCGCTTGAACTCAGG + Intronic
921195747 1:212756210-212756232 AGGGAGGATCATTTGAACCCAGG - Intronic
921200274 1:212798467-212798489 TGGGAGGACCACTTGAGCTCAGG + Intronic
921974750 1:221190228-221190250 AGGGAGGATCACTTGAACCCTGG + Intergenic
921981436 1:221263105-221263127 AGGCAGGCCTTGTTGAACTGTGG + Intergenic
922127747 1:222745382-222745404 TGGGAGGATCTTTTGAGCTCAGG + Intronic
922322444 1:224500578-224500600 AGGGAGGATGGCTTGAACTCAGG + Intronic
922492262 1:226027496-226027518 TGGGAGGATCACTTGAACTCAGG - Intergenic
922515414 1:226204550-226204572 AAGGAGGATCACTTGAACTCAGG + Intergenic
922849376 1:228719635-228719657 AGGGAGGATCACTTGAACCCTGG + Intergenic
922912341 1:229228309-229228331 CAGGAGGACCTTTTGAGCTCAGG + Intergenic
923071488 1:230568910-230568932 AGGGAGGATCTCTTGAGCCCAGG + Intergenic
923143744 1:231183519-231183541 AGGGAGGATCACTTGAGCTCAGG + Intronic
923306229 1:232691296-232691318 TGGGAGGACCGCTTGAAGTCAGG - Intergenic
923320266 1:232825214-232825236 AGGGAGAAGCACTTGAACTCAGG + Intergenic
923395036 1:233553391-233553413 TGGGAGGACCACTTGAACCCAGG + Intergenic
923489141 1:234468004-234468026 ATGGAGGATCACTTGAACTCAGG - Intronic
923725001 1:236498026-236498048 TGGGAGGATCTCTTGAACCCAGG - Intergenic
923725074 1:236498522-236498544 CGGGAGGATCCCTTGAACTCAGG + Intergenic
923819880 1:237426782-237426804 TGGGAGGATCTCTTGAGCTCAGG + Intronic
924262469 1:242246271-242246293 CAGGAGGATCTGTTGAACCCAGG + Intronic
924391719 1:243567554-243567576 TGGGAGGACTGTTTGAACTCAGG - Intronic
1062783663 10:241403-241425 CGGGAGGACTGCTTGAACTCAGG - Intronic
1062832251 10:613784-613806 AGGGAAGACCTGTTGAGATCAGG - Intronic
1063225343 10:4010478-4010500 TGGGAGGATCTCTTGAACCCAGG - Intergenic
1063299327 10:4837462-4837484 ATGGAGGACCTGGTGATCACCGG + Exonic
1063380225 10:5580150-5580172 CGGGAGGATCACTTGAACTCAGG - Intergenic
1063632559 10:7747804-7747826 TGGGAGGATCCGTTGAACCCAGG + Intronic
1064276713 10:13912978-13913000 CAGGAGAACCTCTTGAACTCGGG + Intronic
1064449761 10:15431240-15431262 AGGGAGGATCATTTGAGCTCAGG - Intergenic
1064559976 10:16586313-16586335 TGGGAGGATCGCTTGAACTCAGG - Intergenic
1064719924 10:18218771-18218793 AGGCAGGATCACTTGAACTCTGG + Intronic
1064759943 10:18608406-18608428 CGGGAGGATCACTTGAACTCAGG + Intronic
1064900458 10:20290563-20290585 CGGGAGGATCTCTTGAGCTCAGG - Intergenic
1064903310 10:20317362-20317384 CGGGAGGAGCAGTTGACCTCAGG + Intergenic
1065042470 10:21711493-21711515 TGGGAGGACCACTTGAGCTCAGG + Intronic
1065105579 10:22380394-22380416 TGGGAGGACCCCTTGAACCCAGG - Intronic
1065411774 10:25437316-25437338 TGGGAGGATCTCTTGAACCCAGG - Intronic
1065519676 10:26559482-26559504 AGGGAGGATCTCTTGAGCCCAGG + Intronic
1065546910 10:26830987-26831009 TGGGAGGATCAGTTGAACCCAGG - Intronic
1065552019 10:26877597-26877619 AGGGAGGATCTCTTGAGCCCAGG - Intergenic
1065614559 10:27506547-27506569 CAGGAGGATCTGTTGAGCTCAGG - Intronic
1065660481 10:28000042-28000064 GGGGAGGATCTCTTGAACCCGGG - Intergenic
1065702921 10:28443044-28443066 AGGGAGGATCACTTGAGCTCAGG + Intergenic
1065733301 10:28728984-28729006 GGGGAGGATCGCTTGAACTCAGG + Intergenic
1065791116 10:29261895-29261917 TGGGAGGACCGATTGAGCTCAGG - Intergenic
1065807066 10:29403855-29403877 TGGGAGGATCACTTGAACTCAGG - Intergenic
1065920733 10:30390552-30390574 TGGGAGGATCACTTGAACTCAGG - Intergenic
1065923641 10:30416339-30416361 GGGGAGGACCGCTTGAACCCAGG - Intergenic
1066012983 10:31211102-31211124 AGGGAGGCCCTGGGGAGCTCTGG - Intergenic
1066088691 10:31996355-31996377 GGGGAGGATCTGTTGACCCCAGG + Intergenic
1066329493 10:34404437-34404459 TGGGAGGACCACTTGAACCCAGG + Intronic
1066418642 10:35244251-35244273 TGGGAGGATCACTTGAACTCGGG - Intergenic
1066629308 10:37443068-37443090 TGGGAGGATCTGCTGAACCCAGG + Intergenic
1067035940 10:42916670-42916692 CGGGAGAACCTCTTGAACCCAGG + Intergenic
1067479591 10:46586197-46586219 TGGGAGGATCTCTTGAACCCAGG + Intronic
1067615146 10:47755601-47755623 TGGGAGGATCTCTTGAACCCAGG - Intergenic
1068046340 10:51891032-51891054 AGGGAGGACCCCTTGAACTTAGG + Intronic
1068327361 10:55511098-55511120 TGGGAGGACTGGTTGAGCTCAGG - Intronic
1068531014 10:58186697-58186719 AGGGAGGATCTCTTGAGCCCAGG - Intergenic
1068670079 10:59713520-59713542 AGGGAGGATCTCTTGAGCCCAGG - Intronic
1068698357 10:59993578-59993600 TGGGAGGATCCCTTGAACTCAGG - Intergenic
1069313895 10:67074123-67074145 AAGGAGGATCTCTTCAACTCGGG - Intronic
1069416275 10:68203494-68203516 AGGGAGGATTGCTTGAACTCAGG + Intronic
1069651990 10:70055469-70055491 TGGGAGGACCCCTTGAACCCAGG - Intronic
1069936851 10:71923430-71923452 AGAGAGAACCTGGTGAACTCTGG - Intergenic
1069972381 10:72183133-72183155 AGGGAGGATCGCTTGAACTTAGG - Intronic
1070042909 10:72799547-72799569 AGGGAGGATCAGTTGAACCCAGG - Intronic
1070063000 10:73004149-73004171 TGGGAGGATCTCTTGAACCCAGG - Intergenic
1070086625 10:73244266-73244288 TGGGAGGATCACTTGAACTCAGG + Exonic
1070104827 10:73421629-73421651 AGGGTGGATCTCTTGAGCTCAGG + Intergenic
1070180635 10:74010015-74010037 AGGGAGGATCACTTGAACCCAGG - Intronic
1070216741 10:74391612-74391634 TGGGAGGATCTGTTGAATTCAGG + Intronic
1070230415 10:74560144-74560166 AGGGAGGATCACTTGAGCTCAGG - Intronic
1070332131 10:75425497-75425519 TGGGAGGATCAGTTGAGCTCAGG - Intergenic
1070627000 10:78058351-78058373 AGGGAGGATCACTTGAGCTCAGG - Intergenic
1071539759 10:86469952-86469974 AGGGAGGATCTCTTGAGCTCAGG - Intronic
1071597374 10:86938159-86938181 TGGGAGGACCGCTTGAGCTCAGG - Intronic
1071630548 10:87215551-87215573 CGGGAGGATCTCTTGAACCCAGG - Intergenic
1071779053 10:88822608-88822630 TGGGAGGATCACTTGAACTCAGG - Exonic
1071779263 10:88824621-88824643 TGGGAGGATCCCTTGAACTCAGG - Intronic
1072103587 10:92252745-92252767 TGGGAGGATCACTTGAACTCAGG - Intronic
1072456121 10:95577568-95577590 GTGGAGGATCTCTTGAACTCAGG - Intergenic
1072517239 10:96197395-96197417 TGGGAGGATCGCTTGAACTCAGG - Intronic
1072610773 10:97016486-97016508 AGGGAGGATCACTTGAGCTCAGG - Intronic
1072619790 10:97072389-97072411 AGGGAGGATCACTTGAACCCAGG - Intronic
1072639883 10:97203911-97203933 AGCGAGTCCCTGTTGATCTCTGG - Intronic
1072650258 10:97289759-97289781 AGGGAGGACCAGTTGAGCCCAGG + Intronic
1072686301 10:97539364-97539386 CGGGAGGATCAGTTGAGCTCAGG + Intronic
1072820314 10:98550384-98550406 CAGGAGGACTGGTTGAACTCAGG - Intronic
1072974548 10:100046377-100046399 TGTGAGGATCTCTTGAACTCAGG + Intronic
1073010005 10:100351731-100351753 TGGGAGGATCTCTTGAGCTCAGG - Intronic
1073142486 10:101257720-101257742 TGGGAGGACCACTTGAACCCAGG - Intergenic
1073272513 10:102277468-102277490 AGGGAGAATCGGTTGAACCCGGG - Intronic
1073355377 10:102849683-102849705 AGGGAGGATCACTTGAGCTCAGG - Intergenic
1073411963 10:103350202-103350224 AGGGAGAATCTCTTGAACCCAGG + Intronic
1074631578 10:115260471-115260493 AAGAAGGACATGTTGACCTCTGG - Intronic
1074760150 10:116661370-116661392 TGGGAGGAGCTCTTGAACCCGGG - Intergenic
1075047043 10:119154457-119154479 TGGGAGGATCACTTGAACTCAGG + Intronic
1075073158 10:119332332-119332354 AGGGAGGATCACTTGAGCTCAGG - Intronic
1075149170 10:119911351-119911373 TGGGAGGACCGCTTGAGCTCAGG - Intronic
1075763858 10:124877501-124877523 TGGGAGGATCACTTGAACTCAGG + Intergenic
1075768591 10:124914781-124914803 CAGGAGAACCTCTTGAACTCCGG - Intergenic
1077263460 11:1636183-1636205 AAGGAGGATCACTTGAACTCGGG + Intergenic
1077562846 11:3275272-3275294 TGGGAGGATCTCTTGAACTTGGG + Intergenic
1077568740 11:3321091-3321113 TGGGAGGATCTCTTGAACTTGGG + Intergenic
1077627885 11:3789606-3789628 TGGGAGGATCAGTTGAACCCAGG - Intronic
1077837522 11:5937670-5937692 AGGGAGCATCTGTTGAACCACGG - Intronic
1078008153 11:7547920-7547942 AGGGAGAACCAGATAAACTCAGG - Intronic
1078281701 11:9908788-9908810 TGGGAGGATCGCTTGAACTCGGG - Intronic
1079023874 11:16930351-16930373 AAGGAGGATCTCTTGAACCCAGG + Intronic
1079779431 11:24581576-24581598 TGGGAGGATCGCTTGAACTCGGG + Intronic
1080109180 11:28546426-28546448 AGGGAGGACTACTTGAGCTCAGG - Intergenic
1080198900 11:29645406-29645428 TGGGAGGACTGGTTGAGCTCAGG + Intergenic
1080392929 11:31865039-31865061 AGGGAGGATCACTTGAGCTCAGG + Intronic
1081633755 11:44706992-44707014 CAGGAGGACTTCTTGAACTCAGG + Intergenic
1081662328 11:44895706-44895728 AAGGAGGAGATGCTGAACTCTGG - Intronic
1081853113 11:46287526-46287548 AGGGAGGATCGCTTGAGCTCAGG - Intronic
1081881958 11:46461013-46461035 CGGGAGGACCCCTTGAGCTCAGG + Intronic
1081954059 11:47074109-47074131 CGGGAGAATCTCTTGAACTCGGG + Intronic
1082010129 11:47444444-47444466 AGGGAGGATCGCTTGAACACAGG + Intronic
1082184891 11:49166954-49166976 GGGGAGGATCAGTTGAGCTCAGG + Intronic
1083337261 11:61930549-61930571 AGGGAGGATCACTTGAGCTCAGG + Intergenic
1083471586 11:62887883-62887905 AGGGAGGATCACTTGAACCCAGG - Intronic
1083563442 11:63693000-63693022 AAGGAGGATCTCTTGCACTCAGG - Intronic
1083971418 11:66078644-66078666 AGGGAGGATCACTTGAACCCAGG - Intronic
1083985103 11:66209279-66209301 AGGGAGGATCACTTGAAGTCAGG + Intronic
1084109113 11:67001960-67001982 AGGGAGGATCCTTTGAACACAGG + Intergenic
1084360509 11:68666008-68666030 CGGGAGGATCGCTTGAACTCGGG - Intergenic
1084677855 11:70646951-70646973 AGGGAGAACCGCTTGAACCCAGG - Intronic
1084678754 11:70652716-70652738 TGGGAGGATCTTTTGAACCCAGG + Intronic
1085108057 11:73862824-73862846 TGGGAGGACCACTTGAACCCAGG + Intronic
1085110441 11:73882990-73883012 TGGGAGGATCTCTTGAACCCAGG - Intronic
1085131595 11:74044067-74044089 TGGGAGGATCGCTTGAACTCAGG - Intronic
1085280805 11:75329191-75329213 TGGGAGGATCAGTTGAACACAGG - Intronic
1086106688 11:83155604-83155626 AGGCAGGATCACTTGAACTCGGG - Intergenic
1087607382 11:100393285-100393307 AGGGAGGATTGCTTGAACTCAGG + Intergenic
1087680138 11:101210963-101210985 TGGGAGGATCTCTTGAACCCGGG + Intergenic
1087768404 11:102180917-102180939 TGGGAGGATCTCTTGAGCTCAGG + Intronic
1087870721 11:103289666-103289688 TGGGAGGATTTCTTGAACTCAGG + Intronic
1087881790 11:103425026-103425048 TGGGAGGATCTATTGAGCTCAGG - Intronic
1087897980 11:103609062-103609084 TGGGAGGATCTCTTGAGCTCAGG + Intergenic
1087910932 11:103752667-103752689 AGGGTGGACCTGATTAATTCAGG - Intergenic
1088633244 11:111794374-111794396 AGGGAGGATCACTTGAACCCAGG - Intronic
1088900704 11:114114908-114114930 CGGGAGGATCACTTGAACTCAGG - Intronic
1089158416 11:116419840-116419862 TGGGAGGATCACTTGAACTCAGG - Intergenic
1089599786 11:119606267-119606289 AGGGAGGATCGCTTGAGCTCAGG + Intergenic
1089731351 11:120521176-120521198 TGGGAGGATCAGTTGAACCCAGG - Intronic
1089985357 11:122807779-122807801 AGGGAGGACCACTTGAGTTCAGG - Intronic
1090035871 11:123249135-123249157 TGGGAGGACCTCTTGAGCCCAGG - Intergenic
1090044919 11:123322731-123322753 AGGGAGGAGGTGTTTAAGTCAGG + Intergenic
1090348438 11:126090239-126090261 AGGGAGAATCTCTTGAACCCAGG - Intergenic
1090479298 11:127054053-127054075 TGGGAGGATCTCTTGAAGTCAGG - Intergenic
1091021894 11:132107441-132107463 AGGGAGGATCTCTTGAGCTTGGG - Intronic
1091082994 11:132690165-132690187 TGGGAGGACCACTTGAACCCAGG - Intronic
1091517328 12:1197876-1197898 AGAAAGGACTTGTTGAACTTTGG + Intronic
1091725527 12:2844030-2844052 AGGGAGGACTTCTTGAGCCCAGG + Intronic
1091761420 12:3089681-3089703 TGGGAGGATCAGTTGAGCTCAGG + Intronic
1091763678 12:3104443-3104465 TGGGAGGATCTCTTGAACCCAGG - Intronic
1091893526 12:4082433-4082455 AGGGAGGATCTCTTGAGCCCTGG - Intergenic
1092133309 12:6127619-6127641 AGGGAGGACCCCTTGAGCCCAGG + Intergenic
1092221872 12:6719340-6719362 AGGGTGGCTCTTTTGAACTCAGG - Intergenic
1092348899 12:7739770-7739792 TGGGAGGATCAGTTGAGCTCCGG - Intronic
1092354189 12:7781125-7781147 AGGGAGGATCACTTGAGCTCAGG + Intergenic
1093423491 12:19001132-19001154 TGGGAGGATCACTTGAACTCAGG + Intergenic
1093471187 12:19503922-19503944 TGGGAGGATCTCTTGAACCCAGG - Intronic
1093536236 12:20227041-20227063 AGGGAGGATCAGTTGAGCCCAGG + Intergenic
1093705141 12:22266702-22266724 TGGGAGGATCTGTTGAACCTAGG + Intronic
1093716916 12:22393263-22393285 AGGGAGGATCGCTTGAGCTCAGG - Intronic
1094027349 12:25973130-25973152 AGGGAGGATCACTTGAACCCAGG - Intronic
1094110855 12:26861345-26861367 TGGGAGAACCGCTTGAACTCGGG - Intergenic
1094697016 12:32829751-32829773 AAGGAGAACCCGTTGAACTTGGG - Intronic
1095052857 12:37569534-37569556 GGGGAGGATCACTTGAACTCAGG - Intergenic
1095558493 12:43537280-43537302 TGGGTGGACCACTTGAACTCAGG - Intronic
1095876803 12:47088338-47088360 AATGAGGACCTGCTGGACTCTGG - Intronic
1096046121 12:48563849-48563871 CAGGAGGATCTCTTGAACTCAGG + Intergenic
1096131845 12:49165584-49165606 TGGGAGGACCTCTTGAGCCCAGG - Intergenic
1096144239 12:49266619-49266641 CGGGAGGACCGCTTGAGCTCAGG + Intronic
1096172015 12:49479256-49479278 AGGGAGGACCTTCTGAAGGCTGG - Intronic
1096265882 12:50122190-50122212 CGGGAGGACCACTTGAAGTCAGG - Intergenic
1096268983 12:50148502-50148524 TGAGAGGATCTCTTGAACTCGGG + Intronic
1096484186 12:51966674-51966696 TGGGAGGATCTCTTGAGCTCAGG - Intronic
1096773002 12:53948316-53948338 TGGGAGGATCTCTTGAACCCCGG + Intergenic
1096823283 12:54254235-54254257 AGGGAGGATCACTTGAACCCGGG + Intronic
1096989983 12:55792910-55792932 CGGGAGGATCAGTTGAACCCAGG - Intronic
1097002723 12:55891434-55891456 AGGGAGGACCACTTGAGCCCAGG + Intergenic
1097124591 12:56763838-56763860 AGTGAGGATCCCTTGAACTCAGG + Intronic
1097191715 12:57222574-57222596 AGGGTGGGCCATTTGAACTCTGG - Intronic
1097648292 12:62262009-62262031 AGGGAGGATCACTTGAACTCAGG + Intronic
1097815293 12:64067315-64067337 AGGGAGGATCTGTTGAGCCTAGG + Intronic
1097875647 12:64640867-64640889 AGGGAGGACTGCTTGAACCCAGG - Intronic
1098224433 12:68307406-68307428 AGGGAGGACTGCTTGAACCCAGG + Intronic
1098413838 12:70210878-70210900 TGGGAGGATCTCTTGAACCCAGG - Intergenic
1098524718 12:71473544-71473566 TGGGAGGATCCCTTGAACTCGGG + Intronic
1098554320 12:71801652-71801674 AGGGAGGATCGCTTGAACCCAGG - Intergenic
1098898595 12:76089587-76089609 TGGGAGGACCTCTTGAGCACAGG - Intergenic
1099201349 12:79681020-79681042 TGGGAGGATCTCTTGAACTCAGG + Intronic
1099970361 12:89494130-89494152 AGGGAGGAGCTCTTGAGCGCAGG - Intronic
1100303678 12:93330954-93330976 CGGGAGGATCTCTTGAGCTCAGG + Intergenic
1100357352 12:93843811-93843833 CAGGAGGACCACTTGAACTCGGG - Intronic
1100530745 12:95459370-95459392 TGGGAGGATCTCTTGAGCTCAGG - Intergenic
1100877788 12:98981076-98981098 AGGGAGGACTGCTTGAGCTCAGG + Intronic
1100995757 12:100299000-100299022 AGGGAGGATCACTTGAGCTCAGG + Intronic
1101141666 12:101801813-101801835 AGGGAGGATCGATTGAAGTCGGG + Intronic
1101360704 12:104024152-104024174 TGGGAGGACCACTTGAGCTCAGG + Intronic
1101664294 12:106796308-106796330 TGGGAGGGTCTGTTGAGCTCAGG + Intronic
1101893171 12:108733400-108733422 TGGGAGGATCTCTTGAGCTCAGG - Intergenic
1101927424 12:108984243-108984265 AGGGAGGATCACTTGAGCTCAGG - Intronic
1101941357 12:109101476-109101498 AGGGAGGATCCCTTGATCTCAGG + Intronic
1102072619 12:110034527-110034549 TGGGAGGATCTCTTGAACCCAGG - Intronic
1102138534 12:110595559-110595581 AGGGAGGATCGCTTGAGCTCAGG + Intergenic
1102206559 12:111094908-111094930 AGGGAGGCTCTCTTGATCTCTGG + Intronic
1102290569 12:111695919-111695941 AGGGAGAACCACTTGAACCCGGG + Intronic
1102503743 12:113370961-113370983 AGGGAGGACTGCTTGAGCTCAGG + Intronic
1102623964 12:114219540-114219562 TGGGAGGACCTCTTGAGCCCGGG + Intergenic
1102869888 12:116405776-116405798 AGGGAGGATCACTTGAGCTCAGG - Intergenic
1102907247 12:116686427-116686449 TGGGAGGATCTCTTGAACTTGGG - Intergenic
1102929532 12:116851646-116851668 AGGGAGAACTGCTTGAACTCGGG + Exonic
1103134702 12:118497649-118497671 CGGGAGGATCGGTTGAACCCAGG - Intergenic
1103370484 12:120415528-120415550 TGGGAGGAGCTCTTGATCTCAGG + Intergenic
1103511432 12:121477474-121477496 AGGGAGGATCCCTTGAGCTCAGG - Intronic
1103559406 12:121785094-121785116 CGGGAGGATCACTTGAACTCAGG + Intronic
1103684728 12:122723009-122723031 TGGGTGGATCCGTTGAACTCAGG + Intergenic
1103694460 12:122802935-122802957 TGGGAGGATCACTTGAACTCAGG + Intronic
1103804217 12:123559905-123559927 AGGGAGAATCGGTTGAACCCGGG - Intergenic
1104005965 12:124892665-124892687 TGGGAGGATCTCTTGAACCCGGG - Intergenic
1104232586 12:126899691-126899713 AGGGAGGATCGCTTGAGCTCAGG - Intergenic
1104247610 12:127058607-127058629 AGGGCGGATCAGTTGAACTTAGG + Intergenic
1104677292 12:130720231-130720253 CGGGAGGACCACTTGAGCTCTGG + Intergenic
1104835734 12:131789071-131789093 TGGGAGGACGAGTTGAACCCAGG - Intronic
1104855343 12:131899581-131899603 TGGGAGGATCTCTTGAGCTCAGG - Intronic
1105055831 12:133098327-133098349 CAGGAGGATCTGTTGAACTCGGG - Intronic
1105309773 13:19195954-19195976 TGGGAGGATCGCTTGAACTCGGG + Intergenic
1105527726 13:21191662-21191684 TGGGAGGATCGCTTGAACTCGGG - Intergenic
1105869423 13:24491032-24491054 TAGGAGGATCTATTGAACTCAGG - Intronic
1105926519 13:25013739-25013761 AGGGAGGATCACTTGAACCCAGG - Intergenic
1106038505 13:26067547-26067569 AGGGAGGATCACTTGAACCCAGG + Intergenic
1106307513 13:28526573-28526595 TGGGAGGATCACTTGAACTCAGG + Intergenic
1106446685 13:29839559-29839581 AGGAAGGAGCAGTTGAACGCAGG + Intronic
1106781899 13:33067125-33067147 TGGGAGGATCACTTGAACTCAGG + Intergenic
1107019557 13:35737558-35737580 TGGGAGGATCTGTTGAGCCCCGG + Intergenic
1107439088 13:40408223-40408245 AGGGAGGACCACTTGAGCCCAGG + Intergenic
1107668269 13:42715545-42715567 AGGGAGGATCCTTTGAGCTCAGG + Intergenic
1107848796 13:44549543-44549565 AGAGAGGATCTCTTGAGCTCAGG + Intronic
1107868832 13:44728871-44728893 AGGGAGGATCTCTTGAATCCAGG - Intergenic
1108065872 13:46577187-46577209 TGGGAGGATCATTTGAACTCTGG - Intronic
1108080263 13:46728007-46728029 TGGGAGGATGTCTTGAACTCAGG - Intronic
1108148491 13:47505142-47505164 AGGGAGGATCGCTTGAGCTCAGG - Intergenic
1108296813 13:49029064-49029086 TGGGAGGACCACTTGAGCTCAGG - Intronic
1108380343 13:49848545-49848567 AGGGAGGACCGCTTGAGTTCAGG + Intergenic
1108520887 13:51246197-51246219 AGCGAGCACCTGTTGAATTATGG - Intronic
1109460643 13:62652866-62652888 TGGGAGGACCTCTTGAGCCCAGG - Intergenic
1109527915 13:63600664-63600686 AAGGAGAACCAGTTGAACCCAGG - Intergenic
1110106317 13:71680509-71680531 TGGGAGGATCTCTTGAGCTCAGG + Intronic
1110613810 13:77519457-77519479 AGGGAGGATCTCTTGAGCCCAGG - Intergenic
1110778444 13:79436875-79436897 TGGGAGGACCACTTGAGCTCAGG - Intergenic
1111616848 13:90670754-90670776 TGGGAGGATCTCTTGAGCTCAGG - Intergenic
1111900499 13:94193819-94193841 AGGGAGGACCTGTTCAACTGTGG - Intronic
1112130394 13:96517149-96517171 TGGGAGGATCACTTGAACTCAGG + Intronic
1112416862 13:99209879-99209901 AGGGAGAATCAGTTGAACCCAGG + Intronic
1112934780 13:104783798-104783820 CGGGCGGATCTCTTGAACTCAGG - Intergenic
1113036697 13:106057540-106057562 AGGGAGGATCTCTTGAGCCCAGG + Intergenic
1113576490 13:111398727-111398749 AGGGAGGACATGTGGGACTCCGG - Intergenic
1113784685 13:112996225-112996247 CGGGAGGACCACTTGAGCTCCGG + Intronic
1113830413 13:113291088-113291110 AGGGAGGATCACTTGAGCTCAGG + Intergenic
1113886192 13:113659658-113659680 TGGGAGGATCCCTTGAACTCAGG - Intergenic
1114293641 14:21309282-21309304 AGGGAGGATCACTTGAGCTCAGG + Intronic
1114316611 14:21515458-21515480 TGGGAGGATCCCTTGAACTCAGG + Intergenic
1114466626 14:22927799-22927821 AGGGAGGATCAGTTGAGCTTGGG - Intronic
1114494736 14:23124851-23124873 AGGGAGGATCTCTTGAGCCCAGG - Intergenic
1115046325 14:28999367-28999389 TGGGAGGATCTCTTGAACCCAGG + Intergenic
1115291681 14:31779243-31779265 AGGGAGAATCTCTTGAACCCGGG + Intronic
1115297350 14:31843792-31843814 AGAGAGGACTTGATGTACTCTGG - Intronic
1115317965 14:32046109-32046131 AGGGAGGATCGCTTGAGCTCAGG + Intergenic
1115616348 14:35098574-35098596 TGGGTGGACCACTTGAACTCAGG - Intronic
1115632394 14:35258217-35258239 TGGGAGGATCTCTTGAACTCAGG - Intronic
1116232809 14:42239436-42239458 TGTGAGGATCAGTTGAACTCAGG + Intergenic
1116624312 14:47245254-47245276 GGGGAGGATCTCTTGACCTCAGG - Intronic
1116798236 14:49414453-49414475 TGGGAGGACTGGTTGAGCTCCGG + Intergenic
1116808240 14:49514079-49514101 AGGCAGGATCACTTGAACTCAGG - Intergenic
1116841683 14:49824654-49824676 TGGGTGGACCTCTTGACCTCTGG - Intronic
1116847282 14:49876919-49876941 CGGGAGGATCTGTTGAGCCCAGG - Intergenic
1116911201 14:50466287-50466309 AGGGAGGATCTCTTGAGCCCAGG + Intronic
1117143587 14:52814015-52814037 TGGGAGGATCAGTTGAACCCAGG - Intergenic
1117354722 14:54912910-54912932 CGGGAGGATCACTTGAACTCAGG + Intergenic
1117515678 14:56498957-56498979 TGGGAGAATCTGTTGAACCCGGG + Intronic
1117595074 14:57319039-57319061 TGGGAGGACCGCTTGAACCCAGG + Intergenic
1117723738 14:58652167-58652189 TGGGAGGATCGCTTGAACTCAGG - Intergenic
1118360081 14:65048623-65048645 CAGGAGGACCTCTTGAGCTCAGG + Intronic
1118711285 14:68521660-68521682 AGGGAAGACCTTTTGAGCTGGGG + Intronic
1118743217 14:68756181-68756203 AGGGAGGAGTTGTTGTACTAGGG - Intergenic
1118794492 14:69128888-69128910 TGGGAGGATCACTTGAACTCAGG + Intronic
1118823447 14:69360123-69360145 TAGGAGGACCACTTGAACTCAGG + Intergenic
1118970536 14:70633139-70633161 TGGGAGGACCACTTGAACCCGGG + Intergenic
1118994763 14:70825785-70825807 AGGGAGGACCACTTGAGCTCAGG - Intergenic
1119070525 14:71578293-71578315 AGGGAGGATCACTTGAGCTCAGG - Intronic
1119122652 14:72093469-72093491 AGGGAGGACCACTTGAACCCAGG - Intronic
1119312119 14:73657009-73657031 AGGGAGGATCACTTGAGCTCAGG - Intronic
1119343500 14:73901701-73901723 CGGGTGGATCTGTTGAGCTCAGG + Intronic
1119367486 14:74106497-74106519 AGGGAGGACTGGTTGAGCCCAGG - Intronic
1120025751 14:79582168-79582190 AGGGAGGACTGCTTGAACTCAGG - Intronic
1120039596 14:79737783-79737805 AGGGAGGACTGCTTGAGCTCAGG - Intronic
1120104299 14:80476835-80476857 TGGGAGAATCGGTTGAACTCAGG + Intergenic
1120438554 14:84507288-84507310 TGGGAGGATCACTTGAACTCAGG + Intergenic
1120472768 14:84947362-84947384 TGGGAGGACCACTTGAAGTCAGG + Intergenic
1120928203 14:89819510-89819532 AGGGAGGATCACTTGAACCCAGG - Intronic
1121089644 14:91172161-91172183 TGGGAGGATCTCTTGAACCCAGG - Intronic
1121746409 14:96297882-96297904 TGGGAGGATCGCTTGAACTCAGG - Intronic
1121764504 14:96474379-96474401 TGGGAGGATCTCTTGAGCTCAGG + Intronic
1121940055 14:98061915-98061937 AGGGAGAAGCTGTTGAACTTGGG - Intergenic
1121948050 14:98142074-98142096 AGGGAGGATCTCTTGACCTCAGG + Intergenic
1122045019 14:99017075-99017097 GGGAAGGGCCTGCTGAACTCTGG - Intergenic
1122079678 14:99257962-99257984 GGGGAGGACCTGGTGAGCTCTGG - Intronic
1122220169 14:100233256-100233278 AGGGAGGATCTCTTGAGCTGGGG + Intergenic
1122341862 14:101033735-101033757 AGGGAGGACGTGCTCATCTCTGG + Intergenic
1122404485 14:101491987-101492009 TGGGAGGATCGCTTGAACTCAGG - Intergenic
1122481842 14:102052358-102052380 TGGGAGGACCACTTGAGCTCAGG - Intergenic
1122520014 14:102336959-102336981 AGGGAGGATCAGTTGAGCCCTGG - Intronic
1122521497 14:102347077-102347099 AGGGAGGATCACTTGACCTCAGG + Intronic
1122538215 14:102481103-102481125 TGGGAGGACCACTTGAACCCAGG - Intronic
1122691501 14:103533965-103533987 AGGGAGGACCTGGGGAAGCCAGG - Intronic
1122873834 14:104653735-104653757 CGGGTGGACCGCTTGAACTCAGG + Intergenic
1123435775 15:20253252-20253274 TGGGAGGACCTCTTGAGCCCAGG - Intergenic
1124034716 15:26044546-26044568 CAGGAGGACCTTTTGAACCCAGG - Intergenic
1124066464 15:26348466-26348488 AGGGAGGATCTCTTGAAGCCAGG + Intergenic
1124825227 15:33087451-33087473 TGGGAGGACCGCTTGAACCCGGG + Intronic
1125204897 15:37142848-37142870 AAGGAGAACCTCTTGAACCCAGG - Intergenic
1125302352 15:38269472-38269494 TGGGAGGACCACTTGAGCTCAGG - Intronic
1126019201 15:44383767-44383789 AGGGAGGATCATTTGAACCCAGG - Intronic
1126025643 15:44443993-44444015 TGGGAGGATCCCTTGAACTCAGG - Intronic
1126521504 15:49600560-49600582 AGGGAGAATCTCTTGAACCCGGG + Intronic
1126830617 15:52599893-52599915 AGAGAAGACCTGATGAAATCAGG - Intronic
1126833545 15:52635463-52635485 TGGGAGGACCACTTGAGCTCAGG + Intronic
1126985134 15:54297443-54297465 CAGGAGGATCTCTTGAACTCAGG - Intronic
1127099618 15:55551712-55551734 TGGGAGGATCTCTTGATCTCAGG + Intronic
1127263797 15:57345454-57345476 AGGGAGGATCACTTGAACCCAGG - Intergenic
1127383556 15:58449765-58449787 AGGGGGGATCTCTTGAAGTCAGG - Intronic
1127852625 15:62927124-62927146 AGGGAGGATCACTTGAGCTCAGG - Intergenic
1127882212 15:63168170-63168192 AGGGAGGATCACTTGAACCCAGG + Intergenic
1128055138 15:64693841-64693863 AGGGAGGATCACTTGAGCTCAGG + Intronic
1128182178 15:65613711-65613733 AGGGAGGATCGCTTGAAATCAGG - Intronic
1128296035 15:66520346-66520368 AGGGAGGATCGTTTGAACCCAGG - Intronic
1128387706 15:67162483-67162505 AGACAGGCCCTGTGGAACTCTGG - Intronic
1128441167 15:67710087-67710109 AGGGAGGATCGCTTGAACCCAGG - Intronic
1128451490 15:67808229-67808251 TGGGAGGATCTCTTGAGCTCGGG + Intergenic
1128685012 15:69677544-69677566 AGGAGGCACCTGTTGAATTCAGG + Intergenic
1129048988 15:72762236-72762258 TGGGAGGATCTCTTGAGCTCAGG - Intronic
1129494241 15:75962400-75962422 AAGGAGGCCCTGTTAAACACTGG - Intronic
1129517264 15:76164433-76164455 AGGGAGGATCACTTGAGCTCAGG - Intronic
1129854592 15:78814197-78814219 AGGGAGGATCCTTTGAACCCAGG + Intronic
1130219282 15:82004738-82004760 TGGGAGGATCCCTTGAACTCAGG - Intergenic
1130267585 15:82421878-82421900 AGGGAGGATCACTTGAGCTCAGG + Intergenic
1130306933 15:82718669-82718691 AGGGAGGATCACTTGAGCTCAGG + Intergenic
1130504440 15:84524956-84524978 AGGGAGGATCACTTGAGCTCAGG - Intergenic
1131036203 15:89223822-89223844 AGGGAGGACCACTTGAGGTCAGG + Intergenic
1131135045 15:89927991-89928013 TGGGAGAATCTCTTGAACTCAGG - Intergenic
1131152063 15:90053565-90053587 AGGGAGGATCATTTGAGCTCAGG - Intronic
1131402174 15:92134002-92134024 AGGGAGGCCCAGTTAAACTTTGG - Intronic
1131617570 15:94032797-94032819 CGGGAGGATCAGTTGAGCTCAGG - Intergenic
1131649644 15:94384663-94384685 GGGGAGGCCCTGTTGAATTTGGG + Intronic
1131815207 15:96214917-96214939 TGGGAGGATCTCTTGAGCTCGGG - Intergenic
1131949796 15:97669592-97669614 AGGGTGGATCAGTTGAGCTCAGG - Intergenic
1132764566 16:1527662-1527684 TGGGAGGATCACTTGAACTCAGG - Intronic
1132822698 16:1883773-1883795 AGGGAGGATCAGTTGAGCCCAGG + Intronic
1132953192 16:2576560-2576582 AGGGAGGATCGCTTGAACCCGGG - Intronic
1132961160 16:2623608-2623630 AGGGAGGATCGCTTGAACCCGGG + Intergenic
1133083394 16:3342156-3342178 AGGGAGAATCACTTGAACTCAGG + Intergenic
1133085695 16:3361160-3361182 AGGGAGGATCGCTTGAACCCAGG + Intergenic
1133328570 16:4957482-4957504 CGGGAGGACCGCTTGAACCCAGG - Intronic
1133499694 16:6354125-6354147 TGGGAGGATCGCTTGAACTCAGG + Intronic
1133568550 16:7018889-7018911 TGGGAGGATCTCTTGAGCTCAGG + Intronic
1134040496 16:11064682-11064704 TGGGAGGATCTCTTGAACCCGGG + Intronic
1134151016 16:11804997-11805019 TGGGAGGACTCCTTGAACTCCGG - Intergenic
1134287249 16:12872701-12872723 CAGGAGGATCAGTTGAACTCAGG - Intergenic
1134411769 16:14009039-14009061 TGGGAGGATCACTTGAACTCAGG - Intergenic
1134491312 16:14697566-14697588 CAGGAGAACCGGTTGAACTCGGG - Intergenic
1134496693 16:14736684-14736706 CAGGAGAACCGGTTGAACTCGGG - Intronic
1134660203 16:15978271-15978293 AGGGAGGATCTCCTGAGCTCAGG + Intronic
1134794712 16:17024429-17024451 AGGGAGGATCTCTTGAGCTCAGG - Intergenic
1134827103 16:17293714-17293736 AGGGAGGATCACTTGAGCTCAGG - Intronic
1134889330 16:17824962-17824984 AGGGAGAATCGCTTGAACTCGGG + Intergenic
1135270927 16:21069015-21069037 TGGGAGGATCGCTTGAACTCAGG - Intronic
1135332285 16:21570658-21570680 TGGGAGGATCTCTTGAACCCGGG - Intergenic
1135332632 16:21573484-21573506 TGGGAGGATCACTTGAACTCAGG + Intergenic
1135357236 16:21779582-21779604 TGGGAGGATCGCTTGAACTCAGG + Intergenic
1135455740 16:22595698-22595720 TGGGAGGATCGCTTGAACTCAGG + Intergenic
1135710293 16:24710802-24710824 AGGGAGAATCACTTGAACTCGGG - Intergenic
1135730556 16:24891549-24891571 CGGGAGGATCACTTGAACTCAGG - Intronic
1135829760 16:25762782-25762804 TGGGAGGATCCTTTGAACTCAGG + Intronic
1135929823 16:26727167-26727189 CGGGAGGATCGCTTGAACTCAGG + Intergenic
1136007422 16:27340627-27340649 TGGGAGGATCCCTTGAACTCAGG + Intronic
1136010703 16:27361845-27361867 AGGGAGGATCGCTTGAGCTCAGG - Intronic
1136068134 16:27772177-27772199 TGGGAGGACCTTTTGAGCCCAGG + Intronic
1136143809 16:28303743-28303765 AGGGAGGATCTCTTGAGCCCAGG - Intronic
1136405933 16:30047051-30047073 AGGGAGGATCAGTTGAGCCCAGG - Intronic
1136485287 16:30567877-30567899 TGGGAGGATCTCTTGAGCTCAGG + Intergenic
1136622793 16:31441575-31441597 AGGGAGGACCGCTTGAGCCCAGG - Intronic
1137247895 16:46720425-46720447 AGGGAGGATCTCTTGACCCCAGG - Intronic
1137288645 16:47037003-47037025 AGGGAGGATCGTTTGAGCTCAGG + Intergenic
1137461963 16:48672516-48672538 TGGGAGGATCGCTTGAACTCGGG + Intergenic
1137599482 16:49746568-49746590 CGGGAGAATCTCTTGAACTCAGG - Intronic
1137625954 16:49908815-49908837 CGGGAGGACCGCTTGAGCTCAGG - Intergenic
1137652313 16:50131075-50131097 AGGGAGGATCTCTTGAGCCCAGG - Intergenic
1138006287 16:53340940-53340962 TGGGAGGAGCTATTGAACCCAGG + Intergenic
1138630632 16:58291708-58291730 AGGGAGGATCTCTTGAGCTAGGG - Intronic
1138964101 16:62063142-62063164 AGGGAGGATCCCTTGAGCTCAGG - Intergenic
1139360596 16:66397310-66397332 TGGGAGGATCATTTGAACTCAGG - Intronic
1139398013 16:66656010-66656032 TGGGAGGATCTCTTGAGCTCAGG + Intronic
1139562633 16:67753399-67753421 AGGGAGGATCCCTTGAACCCAGG + Intronic
1139670539 16:68490208-68490230 AGGAAGGACCTGAAGAACTGAGG + Intergenic
1139817719 16:69689044-69689066 AGGGAGGATCACTTGAGCTCAGG + Intronic
1140086875 16:71804787-71804809 TGGGAGGACCTCTTGAGCCCAGG + Intronic
1140112733 16:72017682-72017704 TGGGAGGATCACTTGAACTCAGG + Intronic
1140463155 16:75157886-75157908 TGGGAGGATCACTTGAACTCAGG - Intronic
1140468621 16:75201784-75201806 AGGGAGAATCACTTGAACTCAGG + Intergenic
1140482703 16:75270663-75270685 AGGGAGGATCACTTGAGCTCAGG - Intergenic
1140494687 16:75374587-75374609 AGGGAGGATCAGTTGATCCCCGG + Intronic
1140518168 16:75559507-75559529 AGGGAGAATCAGTTGAACCCGGG + Intergenic
1140671892 16:77287568-77287590 TGGGAGGATCTCTTGAACCCAGG - Intronic
1140674164 16:77310718-77310740 AGGGAGGATCCCTTGAACCCAGG - Intronic
1140751917 16:78032484-78032506 TGGGAGGATTTCTTGAACTCAGG + Intronic
1140773561 16:78228432-78228454 TGGGAGGATCTCTTGAACCCAGG - Intronic
1140783718 16:78319487-78319509 AGGGAGGACCGCTTGAGCCCAGG - Intronic
1140847788 16:78906586-78906608 AGGGAGAACCTGGAGAAGTCAGG + Intronic
1140849843 16:78924965-78924987 CGGGAGGATCAGTTGAGCTCAGG + Intronic
1140968915 16:79994075-79994097 ATGGAGCACCTGATAAACTCAGG - Intergenic
1141012501 16:80416033-80416055 AGGCAGAATCGGTTGAACTCGGG - Intergenic
1141339140 16:83187061-83187083 TGGGAGGATCACTTGAACTCGGG - Intronic
1141566397 16:84905172-84905194 AGGGAGGATCGCTTGCACTCAGG + Intronic
1141603210 16:85138564-85138586 GGGGAGGATCTCTTGAACCCAGG - Intergenic
1141858779 16:86702685-86702707 CAGGAGGATCAGTTGAACTCAGG - Intergenic
1141882153 16:86867283-86867305 AGGGAGGGCCTCTTCTACTCAGG - Intergenic
1141986000 16:87580456-87580478 TGGGAGGATCTCTTGAACCCGGG - Intergenic
1142158737 16:88546337-88546359 TGGGAGGACCCCTTGAGCTCAGG - Intergenic
1142220352 16:88851284-88851306 AGGGAGGATCGCTTGAGCTCAGG + Intronic
1142398046 16:89844086-89844108 CGGGAGGACCTCTTGAGCCCAGG - Intronic
1142691744 17:1610648-1610670 TGGGAGGATCTGTTGAGCCCAGG + Intronic
1142723331 17:1792546-1792568 AGGGAGGATCAGTTGAACCCTGG + Intronic
1142749942 17:1981286-1981308 AGGGAGGATCACTTGAGCTCTGG + Intronic
1142827968 17:2526106-2526128 AGGGAGAATCTCTTGAACCCAGG + Intergenic
1142888210 17:2926523-2926545 AGGGAGGAACTGTGACACTCTGG - Intronic
1142971590 17:3615417-3615439 AGGTAGGTCCTGTTGAAGTATGG + Exonic
1143273301 17:5691459-5691481 TGGGAGGATCTTTTGAGCTCAGG + Intergenic
1143299184 17:5896852-5896874 TGGGAGAATCTCTTGAACTCGGG + Intronic
1143502114 17:7345414-7345436 AGGGAGGATCACTTGAACTCAGG - Intronic
1143547168 17:7604335-7604357 TGGGAGGATCTCTTGAGCTCAGG + Intronic
1143686233 17:8518223-8518245 CGGGAGGATCTCTTGAACCCAGG - Intronic
1143714447 17:8756988-8757010 CGGGAGGATCTCTTGAACTCAGG - Intronic
1143787517 17:9266955-9266977 AGAGATGACCTTTTGAACACAGG - Intronic
1144171362 17:12662708-12662730 AGGGAGAATCTCTTGAACCCAGG + Intergenic
1144319138 17:14096595-14096617 TGGGAGGATCCGTTGAAGTCAGG - Intronic
1144407225 17:14963829-14963851 AGGGAGGACATGTTGAAGTTTGG + Intergenic
1144498190 17:15763743-15763765 TGGGAGGATCGCTTGAACTCAGG - Intergenic
1144537956 17:16110125-16110147 TGGGAGGATCACTTGAACTCAGG + Intronic
1144743924 17:17600458-17600480 TGGGAGGATCAGTTGAACTCGGG + Intergenic
1144800810 17:17925612-17925634 TGGGAGGATCTCTTGAGCTCAGG + Intronic
1144821179 17:18075785-18075807 CGGGAGGACCTCTTGAGCCCAGG + Intergenic
1144846710 17:18224081-18224103 AGGGAGGATCTCTTGACCCCAGG - Intergenic
1145034049 17:19527751-19527773 TGGGAGGACCTCTTGAGCCCAGG + Intronic
1145161569 17:20578784-20578806 TGGGAGGATCGCTTGAACTCAGG - Intergenic
1145234924 17:21201712-21201734 TGGGAGGATCTCTTGAACCCGGG - Intronic
1145739286 17:27259150-27259172 TGGGAGGATCTTTTGAGCTCAGG + Intergenic
1145873665 17:28298735-28298757 AGGGAGGATCACTTGAGCTCAGG - Intergenic
1146207061 17:30913994-30914016 AGGGAGGACCTCTTGATCCCAGG - Intronic
1146376400 17:32297725-32297747 TGGGAGGACCACTTGAACCCAGG - Intronic
1146480121 17:33198257-33198279 TGGGAGGATCCCTTGAACTCGGG + Intronic
1147279344 17:39345766-39345788 TGGGAGGATCCGTTGAGCTCAGG - Intronic
1147279694 17:39348920-39348942 CAGGAGGATCTGTTGAGCTCAGG - Intronic
1147289484 17:39430155-39430177 AGGGAGGATCACTTGAAGTCAGG + Intronic
1147370641 17:39990288-39990310 TGGGAGGACTTCTTGAACCCAGG - Intronic
1147589011 17:41669284-41669306 AAGGAGAACCACTTGAACTCAGG + Intergenic
1147738194 17:42654257-42654279 AGGGAGGACCGCTTGAGCCCGGG + Intergenic
1147852908 17:43456189-43456211 TGGGAGGATCGCTTGAACTCAGG + Intergenic
1147947624 17:44088922-44088944 AGGGAGGCCTTGTTGCACTTAGG - Intronic
1148017210 17:44530307-44530329 CAGGAGGACCGCTTGAACTCAGG - Intergenic
1148017770 17:44534399-44534421 TGGGAGGACCTCTTGAGCCCAGG + Intergenic
1148141965 17:45335355-45335377 TGGGAGGATCCCTTGAACTCAGG - Intergenic
1148154926 17:45418170-45418192 CGGGAGGACTGCTTGAACTCAGG - Intronic
1148381235 17:47199826-47199848 TGGGAGGATCGGTTGAACCCAGG - Intergenic
1148468642 17:47879688-47879710 TGGGAGGATCACTTGAACTCAGG - Intergenic
1148545718 17:48517461-48517483 TGGGAGGACCCCTTGAACCCAGG - Intergenic
1148579954 17:48736676-48736698 TGGGAGGATCACTTGAACTCAGG + Intergenic
1148585829 17:48779006-48779028 AGGGAGGATCCCTTGAGCTCAGG + Intronic
1148632291 17:49120596-49120618 AAGGAGAATCTCTTGAACTCAGG - Intergenic
1148672897 17:49425588-49425610 CGAGAGGATCAGTTGAACTCTGG - Intronic
1148803573 17:50250639-50250661 TGGGAGGATCACTTGAACTCAGG + Intergenic
1148824970 17:50385962-50385984 TGGGAGGATCTATTGAGCTCAGG + Intronic
1148916145 17:50980638-50980660 TGGGAGGATCTCTTGAACACAGG + Intronic
1149127101 17:53248321-53248343 TGGGAGGACCACTTGAGCTCAGG - Intergenic
1149877465 17:60250720-60250742 TGGAAGGATCTCTTGAACTCAGG + Intronic
1149982821 17:61324755-61324777 CGGGAGGATCAGTTGAGCTCAGG + Intronic
1150054299 17:61998690-61998712 AGGGAGGATACTTTGAACTCTGG - Intronic
1150073446 17:62172113-62172135 TGGGAGGATCATTTGAACTCAGG + Intergenic
1150240814 17:63631057-63631079 AGGGAGGATCGCTTGAGCTCAGG + Intronic
1150364614 17:64570871-64570893 TGGGAGGATCTCTTGAGCTCAGG - Intronic
1150385385 17:64755300-64755322 AGGGAGGATGGGTTGAGCTCAGG + Intergenic
1150620167 17:66802126-66802148 TGGGAGGAACGGTTGAGCTCAGG + Intronic
1150828197 17:68495117-68495139 CGGGAGGACCTCTTGGGCTCAGG - Intergenic
1151278905 17:73057050-73057072 AGGGAGGATCAATTGAGCTCAGG - Intronic
1151284881 17:73103321-73103343 AGGGAGAATCGCTTGAACTCAGG - Intergenic
1151465512 17:74282391-74282413 TGGGAGGATCTATTGAATTCAGG - Intronic
1151639498 17:75379625-75379647 TGGGAGGACCACTTGAGCTCAGG - Intronic
1151736471 17:75944139-75944161 AGGGAGGACCATTTGAACCCGGG + Exonic
1151824197 17:76514529-76514551 TGGGAGGATCACTTGAACTCAGG - Intergenic
1151825585 17:76522212-76522234 AGGGAGGATCGGTTGAACCCAGG + Intergenic
1151911169 17:77084179-77084201 TGGGAGGATCTCTTGAGCTCAGG + Intergenic
1151941201 17:77293107-77293129 AGGGAGGATCGCTTGAGCTCAGG - Intronic
1152014802 17:77743548-77743570 TGGGAGGACCACTTGAGCTCAGG + Intergenic
1152080351 17:78183463-78183485 CGGGAGGATCACTTGAACTCAGG + Intronic
1152346420 17:79755094-79755116 AGGGAGGATCACTTGAACCCAGG + Intergenic
1152620641 17:81362897-81362919 AGGGAGGATCAGTTGAGCCCAGG + Intergenic
1152727274 17:81953694-81953716 TGGGAGGATCACTTGAACTCAGG - Intronic
1152778139 17:82214562-82214584 AGGGAGGATCCTTTGAGCTCGGG + Intergenic
1153053775 18:925715-925737 TGGGAGGATCTCTTGAACCCAGG + Intergenic
1153152399 18:2110181-2110203 AGGGAGGAACACTTGAACCCAGG + Intergenic
1153247890 18:3091384-3091406 TGGGAGGATCTCTTGAACCCAGG + Intronic
1153255299 18:3164082-3164104 TGGGAGGATCTCTTGAACCCAGG - Intronic
1153280964 18:3413640-3413662 CGGGAGGATCACTTGAACTCGGG + Intronic
1153316122 18:3724095-3724117 TGGGAGGATCACTTGAACTCTGG + Intronic
1154195364 18:12261938-12261960 AGGGAGGACTGCTTGAACCCAGG + Intronic
1154348475 18:13563996-13564018 TGGGAGGACCACTTGAGCTCAGG - Intronic
1154968019 18:21378960-21378982 AGGGAGGATCACTTGAGCTCAGG - Intronic
1154987829 18:21570188-21570210 CGGGAGGACCTCTTGAGCCCAGG - Intronic
1155196586 18:23480724-23480746 AGGGAGGATCTCTTGAGCCCAGG + Intronic
1155454368 18:25995718-25995740 AGGGAGGATCACTTGAACTCTGG - Intergenic
1155730166 18:29147231-29147253 CAGGAGGATCTCTTGAACTCAGG + Intergenic
1155806678 18:30178690-30178712 TGGGAGGATCTTTTGACCTCAGG + Intergenic
1155899815 18:31375010-31375032 TGGGAGGATCACTTGAACTCAGG + Intergenic
1156265695 18:35486685-35486707 AGGGAGGATCACTTGAACCCAGG + Intronic
1156270439 18:35525530-35525552 TGGGAGGACCTATTGAGCCCAGG + Intergenic
1156285145 18:35685973-35685995 CGGGAGGATCGCTTGAACTCAGG + Intronic
1156345394 18:36252629-36252651 TGGGAGGATCTTTTGAACCCAGG + Intronic
1156345770 18:36255983-36256005 CAGGAGGATCTCTTGAACTCAGG - Intronic
1157261254 18:46177326-46177348 CGGGAGGATCAGTTGAACTCAGG + Intronic
1157343280 18:46799675-46799697 TGGGAGGATCACTTGAACTCAGG + Intergenic
1157387503 18:47270655-47270677 TGGGAGGATCGCTTGAACTCAGG - Intergenic
1158248368 18:55457576-55457598 AGGGAGGATCTCTTGAGCTCAGG - Intronic
1158439390 18:57460916-57460938 TGGGAGGATCACTTGAACTCAGG - Intronic
1158531115 18:58262534-58262556 TGGGAGGATCTCTTGAACCCGGG + Intronic
1158669518 18:59462476-59462498 TGGGAGGATCACTTGAACTCAGG - Intronic
1158708498 18:59816475-59816497 AGGGAGGATCATTTGAACCCAGG + Intergenic
1158797510 18:60865649-60865671 TGGGAGGATCCGTTGAACCCTGG - Intergenic
1158799848 18:60893488-60893510 AGGGTGGGGCTGTTAAACTCTGG - Intergenic
1158937217 18:62375771-62375793 TGGGAGGATCTCTTGAACCCAGG + Intronic
1159018090 18:63118891-63118913 AGGGAGGATCAATTGAGCTCAGG - Intergenic
1159589763 18:70321179-70321201 TGGGAGGATCTCTTGAACCCAGG + Intronic
1159669608 18:71206607-71206629 AGGGAGGATCACTTGAACCCAGG + Intergenic
1159687824 18:71445182-71445204 CGGGAGGATCTTTTGAGCTCAGG - Intergenic
1159921034 18:74227556-74227578 TGGGAGGACCAATTGAGCTCAGG + Intergenic
1159928001 18:74285757-74285779 AGGGAGGACTGGTTGAGCCCAGG + Intronic
1160233053 18:77063306-77063328 TGGAAGGGCCTGTTGAACTGTGG - Intronic
1160684684 19:427999-428021 AGGGAGGATCTCTTGAGCCCAGG + Intronic
1160920481 19:1517602-1517624 TGGGAGGATCACTTGAACTCAGG - Intergenic
1161262001 19:3343132-3343154 CGGGAGGATCTCTTGAACCCAGG + Intergenic
1161426576 19:4206996-4207018 CGGGAGGACCGCTTGAGCTCAGG - Intronic
1161517641 19:4705314-4705336 TGGGAGGATCTCTTGAACCCAGG - Intronic
1161530141 19:4783839-4783861 AGGGAGGACCATTTGAGCTCAGG + Intergenic
1161599531 19:5172884-5172906 AGGGAGGATCACTTGAAGTCAGG + Intronic
1161644280 19:5443728-5443750 AGGGAGGATCACTTGAACCCGGG + Intergenic
1162014083 19:7834589-7834611 AGGGAGGGCCTGTTGAAGAGGGG + Intronic
1162058289 19:8078872-8078894 TGGGAGGATCTCTTGAACCCAGG - Intronic
1162109995 19:8394835-8394857 CAGGAGGATCTCTTGAACTCAGG + Intronic
1162144317 19:8604572-8604594 TGGGAGAATCAGTTGAACTCAGG - Intronic
1162212009 19:9099732-9099754 AAGGAGGATCTCTTGAACCCGGG + Intergenic
1162285834 19:9738102-9738124 AGGGAGGATCCCTTGAACCCAGG - Intergenic
1162417397 19:10546229-10546251 CGGGAGAATCTGTTGAGCTCAGG + Intronic
1162422493 19:10573886-10573908 TGGGAGGACCGCTTGAGCTCAGG - Intronic
1162558824 19:11403972-11403994 AGGGAGGATCGCTTGAACTTGGG - Intronic
1162559850 19:11410587-11410609 AGGGAGGATCTCTTGAGCCCAGG + Intronic
1162570944 19:11472471-11472493 TGGGAGGACTGGTTGAGCTCAGG + Intronic
1162741680 19:12777244-12777266 AGGGAGGACTGCTTGAACCCAGG + Intronic
1162758773 19:12875908-12875930 AGGGAGGATCACTTGAACTCAGG - Exonic
1162879579 19:13648188-13648210 TGGGAGGATCTTTTGAACACAGG + Intergenic
1162948674 19:14058013-14058035 CGGGAGAATCTCTTGAACTCGGG + Intronic
1163086986 19:14988785-14988807 AGGGAGGATCCCTTGAGCTCAGG + Intronic
1163134540 19:15300150-15300172 AGGGAGGACCGCTTGAACCCGGG + Intronic
1163142234 19:15357513-15357535 GGGGAGGATCTCTTGAGCTCAGG + Intronic
1163163260 19:15478252-15478274 CAGGAGGATCTGTTGAACCCGGG + Intronic
1163175190 19:15559713-15559735 TGGGAGGATCGCTTGAACTCAGG - Intergenic
1163293510 19:16396489-16396511 TGGGAGGATCAGTTGAGCTCAGG - Intronic
1163386580 19:17003683-17003705 AGGGAGGATCACTTGAACTTGGG + Intronic
1163422487 19:17221777-17221799 TGGGAGGACCACTTGAGCTCAGG + Intergenic
1163459615 19:17429036-17429058 TGGGAGGATCTGTTGAGCTCAGG + Intronic
1163515850 19:17763187-17763209 TAGGAGGATCTCTTGAACTCAGG - Intronic
1163665333 19:18600894-18600916 AGGGAGGATCACTTGAACCCAGG - Intronic
1163702791 19:18794718-18794740 AAGGAGGATCTGTTGAGCCCAGG - Intergenic
1163706576 19:18817563-18817585 AGGGAGGACCGCTTGAGCACAGG - Intergenic
1163785728 19:19274021-19274043 TGGGAGGATCTGTTGAGCCCAGG - Intergenic
1163840480 19:19605531-19605553 TGGGAGGATCGCTTGAACTCAGG + Intronic
1164457272 19:28419191-28419213 TGGGAGGATCGGTTGAACCCAGG + Intergenic
1164481624 19:28615584-28615606 AGGGTGGACCCCTTGAGCTCAGG + Intergenic
1164565301 19:29321690-29321712 TGGGAAGACCTCTTGAACCCCGG - Intergenic
1164694522 19:30233432-30233454 TGGGAGGATCTCTTGAACCCAGG - Intronic
1164753948 19:30676086-30676108 AGGGAGGATCTCTTGACCCCGGG - Intronic
1164837654 19:31367909-31367931 TGGGAGGACAGCTTGAACTCAGG - Intergenic
1164872454 19:31657302-31657324 TGGGAGGATCTCTTGAGCTCTGG - Intergenic
1164900381 19:31915475-31915497 TGGGAGGACCGCTTGAGCTCAGG - Intergenic
1164929000 19:32159196-32159218 AGGGAGGACTGCTTGAGCTCAGG + Intergenic
1165005990 19:32807171-32807193 AGGGAGGATCTCTTGAGCCCAGG + Intronic
1165041092 19:33068133-33068155 TGGGAGGATCACTTGAACTCAGG - Intergenic
1165048673 19:33127040-33127062 TGGGAGGATCTGTTGAGCCCGGG + Intronic
1165180028 19:33959624-33959646 TGGGAGGATCGCTTGAACTCAGG - Intergenic
1165339024 19:35197300-35197322 TGGGAGGATCGCTTGAACTCAGG + Intergenic
1165372190 19:35415754-35415776 AGGGAGGATCACTTGAACCCGGG - Intergenic
1165554772 19:36620849-36620871 AGAGAGGATCACTTGAACTCGGG - Intronic
1165680983 19:37775243-37775265 AGGGAGGATCTCTTGAGCCCAGG - Intronic
1165748202 19:38243458-38243480 AGGTAGGATCGCTTGAACTCAGG + Intergenic
1165799773 19:38541974-38541996 TGGGAGGACCACTTGAACCCAGG + Intronic
1165865377 19:38933816-38933838 CGGGAGGATCTATTGAGCTCAGG - Intronic
1165925668 19:39324706-39324728 AGGGAGGATCAGTTGAGCCCAGG + Intergenic
1166083364 19:40458784-40458806 TGGGAGGATCAGTTGAACCCCGG - Intronic
1166135114 19:40772011-40772033 TGGGAGGACCACTTGAACCCAGG - Exonic
1166146358 19:40839039-40839061 AGGCAGGACCGCTTGAGCTCAGG - Intronic
1166150405 19:40869663-40869685 AGGCAGGACCGCTTGAGCTCAGG - Intronic
1166307978 19:41945955-41945977 AGGGAGGACCTCTTGAGCCCAGG - Intergenic
1166514444 19:43435805-43435827 AGGGAGGATCACTTGAGCTCAGG + Intergenic
1166607207 19:44154723-44154745 ATGGAGGATCGCTTGAACTCAGG - Intronic
1166609822 19:44181149-44181171 TGGGAGGATCTCTTGAGCTCAGG + Intergenic
1166614387 19:44230106-44230128 TGGGAGGACCACTTGAAATCAGG - Intronic
1166691718 19:44825569-44825591 CAGGAGGATCAGTTGAACTCAGG + Intergenic
1166798256 19:45440824-45440846 TGGGAGGATCTCTTGAACCCAGG - Intronic
1166891084 19:45993775-45993797 TGGGAGGACTGCTTGAACTCAGG + Intergenic
1167017774 19:46852283-46852305 AGGGAGGATCGCTTGAGCTCAGG - Intergenic
1167023435 19:46896175-46896197 TGGGAGGATCACTTGAACTCAGG + Intergenic
1167038961 19:47010698-47010720 TGGGAGGATCACTTGAACTCAGG + Intergenic
1167253160 19:48411963-48411985 TGGGAGGATCACTTGAACTCAGG + Intronic
1167457321 19:49603597-49603619 AAGGAGGATCACTTGAACTCTGG + Intronic
1167557396 19:50204800-50204822 AGGGAGGATCGGTTGAGCCCAGG + Intronic
1167565729 19:50255363-50255385 AGGGTGGACCTGTTGGGCTGGGG + Intronic
1167581054 19:50343050-50343072 TGGGAGGACCATTTGAACCCAGG - Intronic
1167625150 19:50583150-50583172 TGGGTGGATCTGTTGAGCTCAGG + Intergenic
1167625321 19:50584688-50584710 TGGGAGGATTTCTTGAACTCAGG - Intergenic
1167782154 19:51605801-51605823 AGGGAGGACCTGGGGAACAGAGG - Intergenic
1167906369 19:52664401-52664423 TGGGAGGATCCGTTGAACCCAGG + Intronic
1168039681 19:53748082-53748104 TGGGAGGACCACTTGAGCTCAGG - Intergenic
1168230815 19:55030242-55030264 AGGGAGGACCACTTGAGCCCAGG + Intronic
1168328466 19:55551318-55551340 TGGGAGGATCTCTTGAACCCAGG - Intergenic
1168330712 19:55566331-55566353 AGGGAGGATCGCTTGAACCCAGG - Intergenic
925289822 2:2740055-2740077 GAGGAGTACCTGGTGAACTCAGG + Intergenic
925641246 2:5987751-5987773 AGGCAGGACCTGTTTATCTCTGG + Intergenic
926069065 2:9870260-9870282 AGGGAGGATCAGTTGAACCCAGG + Intronic
926176241 2:10594761-10594783 TGGGAGGATCTCTTGAGCTCAGG + Intronic
926313221 2:11689810-11689832 AGGGAGAATCTCTTGAACCCGGG + Intronic
926703737 2:15821815-15821837 TGGGAGGATCTGTTGAACCCAGG - Intergenic
926908055 2:17824387-17824409 TGGGAGGACCTCTTGAACCCAGG - Intergenic
927234204 2:20855541-20855563 GGGGAGGATCTCTTGAACTCAGG - Intergenic
927814841 2:26206071-26206093 AGGGAGGATCGCTTGAGCTCAGG + Intronic
927977061 2:27346785-27346807 AGGGAGGACTGTTTGAACCCAGG - Intronic
928346435 2:30501580-30501602 TGGGAGGATCAGTTGAACCCAGG + Intronic
928506139 2:31955011-31955033 AGGGAGGATCACTTGAGCTCAGG + Intronic
928578233 2:32678160-32678182 TGGGAGGATCCCTTGAACTCAGG + Intronic
928709754 2:33990830-33990852 AGGGAAGATCTCTTGAACCCAGG - Intergenic
928809687 2:35207689-35207711 AGTGAGGACATGTGGAACTCAGG + Intergenic
929117866 2:38459453-38459475 AGGGAGGATTTGTTGAGCCCAGG - Intergenic
929265606 2:39915936-39915958 AGGGAGGATCACTTGAACCCAGG - Intergenic
929493708 2:42420695-42420717 AGGGAGAATCACTTGAACTCAGG + Intronic
929551269 2:42893818-42893840 TGGGAGGATCACTTGAACTCAGG + Intergenic
929585123 2:43108832-43108854 AAGGAGGACCACTTGAGCTCAGG + Intergenic
929674886 2:43916724-43916746 TGGGAGGACCACTTGAGCTCAGG + Intronic
929752998 2:44737206-44737228 AGGGAGGACCACTTGAGCTCGGG - Intronic
929952236 2:46422034-46422056 TGGGAGGACCACTTGAACCCAGG + Intergenic
930046858 2:47180118-47180140 AGAGAGGACCTCTTGAAGCCAGG - Intergenic
930110310 2:47673326-47673348 AGGGAGGATCACTTGAGCTCAGG - Intergenic
930786276 2:55274343-55274365 TGGGAGGATCACTTGAACTCAGG + Intergenic
930821193 2:55649209-55649231 TGGGAGGATCACTTGAACTCAGG + Intronic
931032111 2:58188528-58188550 TGGGAGGATCAGTTGAGCTCAGG - Intronic
931146801 2:59528096-59528118 AGGGAGGATCTCTTGAGCCCGGG - Intergenic
931262756 2:60634592-60634614 GGGGAGGAGGTGTTGAAGTCAGG + Intergenic
931713014 2:65005764-65005786 AGGGAGGACTTCTTGAGCCCAGG + Intronic
931717353 2:65039616-65039638 CGGGAGGATCTCTTGAACCCAGG + Intergenic
931730488 2:65148898-65148920 AGGGAGGATCACTTGAACCCAGG - Intergenic
932271637 2:70415293-70415315 AGGGAGGATCACTTGAGCTCAGG - Intergenic
932549467 2:72753176-72753198 TGGGAGGATCTCTTGAACCCAGG + Intronic
932553774 2:72799475-72799497 TGGGAGGACCAGTTGAGCCCAGG + Intronic
932672294 2:73748677-73748699 TGGGAGGATCGCTTGAACTCAGG + Intergenic
932784280 2:74586347-74586369 AGGGAGTCACTGTTCAACTCAGG - Intronic
933316436 2:80720807-80720829 CGGGAGGACCGCTTGAGCTCAGG - Intergenic
933559660 2:83874645-83874667 AGGGAGCATCTGTTGAACTACGG + Intergenic
933621007 2:84541383-84541405 AGGGAAGTCCTGTTGATCTTTGG + Intronic
933679643 2:85088444-85088466 TGGGAGGATCTCTTGAGCTCAGG + Intergenic
933740399 2:85529471-85529493 TGGGAGGATCACTTGAACTCAGG - Intergenic
933745133 2:85565130-85565152 AGGGAGGATCACTTGAGCTCAGG - Intronic
933777918 2:85782786-85782808 TGGGAGGATCTCTTGAACCCAGG - Intronic
933827127 2:86172434-86172456 AGGGAGGACCACTTGAGCCCAGG - Intronic
934071765 2:88390630-88390652 AGGGAGGACCACTTGAGCTCAGG + Intergenic
934543320 2:95194206-95194228 AGGGAGAATCTCTTGAACCCAGG - Intergenic
934582368 2:95454151-95454173 TGGGAGGATCACTTGAACTCAGG + Intergenic
934597082 2:95622563-95622585 TGGGAGGATCACTTGAACTCAGG - Intergenic
934705119 2:96471715-96471737 TGGGAGGACCTCTTGAGCCCAGG - Intergenic
934728255 2:96638746-96638768 CGGGAGGACCTCTTGAGCTCAGG + Intronic
934842796 2:97640437-97640459 TGGGAGGATCACTTGAACTCAGG + Intergenic
935659359 2:105452666-105452688 TGGGAGGATCTCTTGAACCCAGG + Intergenic
935761487 2:106324783-106324805 AGGGAGGATCTCTTGAGCCCAGG + Intergenic
935914920 2:107938662-107938684 AGGGAGAATCTATTGAACCCAGG + Intergenic
936037220 2:109122640-109122662 TGGGAGGACCACTTGAACCCAGG + Intergenic
936351891 2:111719321-111719343 AGGGAGGATCACTTGAGCTCAGG - Intergenic
936975556 2:118218021-118218043 AGGGAGGATCATTTGAGCTCAGG + Intergenic
937015399 2:118600910-118600932 TGGCAGGATCTCTTGAACTCAGG - Intergenic
937155685 2:119717235-119717257 TGGGAGGATCGCTTGAACTCGGG + Intergenic
937458859 2:122068254-122068276 AGAGAGGATCTCTTGACCTCAGG + Intergenic
937740895 2:125352281-125352303 AGGGAGGATCACTTGAGCTCAGG + Intergenic
937938487 2:127266152-127266174 TGGGAGGATCATTTGAACTCAGG - Intronic
937942343 2:127295730-127295752 CAGGAGGATCTCTTGAACTCAGG + Intergenic
937942642 2:127297926-127297948 TGGGTGGACCACTTGAACTCAGG - Intergenic
937958254 2:127435658-127435680 AGGGAGGATCACTTGAGCTCAGG + Intergenic
938027323 2:127961373-127961395 TGGGAGGATCAGTTGAGCTCAGG - Intronic
938413492 2:131084940-131084962 CGGGAGGATCACTTGAACTCAGG - Intronic
939227181 2:139378812-139378834 AGGCAGGATCTATTGAGCTCAGG - Intergenic
939460037 2:142487822-142487844 TGGGAGGACCACTTGAGCTCAGG + Intergenic
939487517 2:142833639-142833661 TGAGAGGACCACTTGAACTCAGG - Intergenic
939874647 2:147563840-147563862 TGGGAGGATCACTTGAACTCAGG + Intergenic
939914876 2:148026823-148026845 GGAGAGGATCTCTTGAACTCAGG + Intronic
939926277 2:148177926-148177948 AAGGAGGATCTCTTGAGCTCAGG + Intronic
940288281 2:152053614-152053636 TGGGAGGATCTCTTGAGCTCAGG - Intronic
940294465 2:152108041-152108063 TGGGAGGATCTCTTGAACCCAGG + Intergenic
940324687 2:152412713-152412735 TGGGAGGATCACTTGAACTCAGG + Intronic
940863026 2:158789764-158789786 AGGGATGATCACTTGAACTCAGG + Intergenic
940949587 2:159658424-159658446 TGAGAGGATCTCTTGAACTCAGG - Intergenic
941030663 2:160508210-160508232 AGGGAGGATCAGTTGAACCCAGG - Intergenic
941035051 2:160559322-160559344 TGGGAGGATCCCTTGAACTCAGG - Intergenic
941419567 2:165265912-165265934 AGGGAGGATCACTTGAGCTCAGG - Intronic
941677371 2:168357834-168357856 AAGGAGGATCTCTTGAGCTCAGG - Intergenic
941925809 2:170893461-170893483 TGGGAGGATCATTTGAACTCAGG + Intergenic
942020305 2:171860997-171861019 AGGGAGGATCATTTGAGCTCAGG + Intronic
943247833 2:185478005-185478027 AGGGAGAACCATTTGAACTCAGG - Intergenic
943331487 2:186564758-186564780 AGGGAGGATCACTTGAGCTCAGG + Intergenic
943399319 2:187385841-187385863 AGGGAGGATCGCTTGAACTCGGG - Intronic
943638717 2:190335597-190335619 TGGGAGAATCTCTTGAACTCAGG - Intronic
943671037 2:190661018-190661040 AGGGAGGACTGCTTGAACCCTGG - Intronic
944090636 2:195906516-195906538 TGGGAGGATCACTTGAACTCAGG - Intronic
944571739 2:201052068-201052090 CGGGTGGACCACTTGAACTCAGG + Intronic
944584815 2:201164170-201164192 TGGGAGGATCTTTTGAACCCAGG + Exonic
944771755 2:202921916-202921938 TGGGAGGACTGGTTGAGCTCAGG - Intronic
944885287 2:204056688-204056710 CGGGAGGATCTTTTGAGCTCAGG - Intergenic
945072808 2:206008072-206008094 AAGGAGAATCTCTTGAACTCAGG - Intronic
945094400 2:206205453-206205475 TGGGAGGACCACTTGAACCCAGG - Intronic
945211081 2:207382598-207382620 TGGGAGGATCACTTGAACTCAGG + Intergenic
945285251 2:208075644-208075666 TGGGAGGATCTCTTGAGCTCAGG - Intergenic
945831293 2:214789450-214789472 TGGGAGGATCTCTTGAACCCAGG + Intronic
945839892 2:214875077-214875099 AGGGAGGATCGTTTGAGCTCAGG - Intergenic
946327981 2:218994497-218994519 TGGGAGGATCTCTTGAACCCAGG + Intergenic
946448736 2:219761846-219761868 AGGGAGGATCACTTGAACTCAGG + Intergenic
946768431 2:223061888-223061910 AGGGAGGTCCTGGTGACCTAAGG - Intronic
946845358 2:223854164-223854186 CAGGAGAACCAGTTGAACTCAGG - Intergenic
947151731 2:227122955-227122977 TGGGAGGATCACTTGAACTCGGG - Intronic
947180531 2:227407480-227407502 TGGGAGGATCTCTTGAGCTCAGG - Intergenic
947400523 2:229727163-229727185 TGGGAGGACAGCTTGAACTCAGG + Intergenic
947437741 2:230087388-230087410 CAGGAGGATCTGTTGAACCCAGG + Intergenic
947567720 2:231205275-231205297 AGGGAGGATCCCTTGAACCCAGG + Intronic
947593891 2:231399234-231399256 TGGGAGGTCCTGGTGACCTCTGG + Exonic
947672690 2:231948878-231948900 TGGGAGGATCTGTTGACCCCAGG - Intergenic
947718158 2:232352100-232352122 GGGGAGAACCTGTTGAAGCCGGG - Intergenic
947729592 2:232420588-232420610 AGGGAGAACCTGTTGAAGCCAGG - Intergenic
947741627 2:232487447-232487469 GGGGAGAACCTGTTGAAGCCAGG - Intronic
947868304 2:233417123-233417145 AGGGAGAATCAGTTGAACCCAGG - Intronic
948153128 2:235760284-235760306 AGGGAGAATCTCTTGAACCCGGG + Intronic
948191252 2:236060968-236060990 TGGGAGGACCTCTTGAGCCCAGG + Intronic
948937323 2:241175685-241175707 TGGGAGGATCACTTGAACTCAGG - Intronic
1168836354 20:880355-880377 AGGGAGGATCGCTTGAGCTCAGG + Intronic
1168879593 20:1195135-1195157 AGGAAGGATCTCTTGAACCCAGG + Intergenic
1168881003 20:1205958-1205980 TGGGAGGATCAGTTGAACCCAGG + Intronic
1169020396 20:2326619-2326641 AGGGTGGATCTGTTGAGATCAGG + Intronic
1169079742 20:2789854-2789876 TGGGAGGATCCCTTGAACTCAGG + Intergenic
1169092292 20:2868389-2868411 AGGGAGGACTGCTTGAGCTCAGG - Intronic
1169368604 20:5011089-5011111 TGGGAGGATCATTTGAACTCGGG + Intergenic
1169378795 20:5088739-5088761 TGGGAGGATCTCTTGAGCTCAGG - Intronic
1169383029 20:5125392-5125414 CGGGAGGATCTCTTGAACCCAGG + Intronic
1169755061 20:9034898-9034920 TGGGAGGATCAGTTGAGCTCGGG + Intergenic
1170218894 20:13920133-13920155 TGGGAGGATCCCTTGAACTCAGG + Intronic
1170233518 20:14076421-14076443 CGGGAGGATCACTTGAACTCAGG + Intronic
1170515545 20:17126128-17126150 TGGGAGGATCTCTTGAGCTCAGG - Intergenic
1170576148 20:17662946-17662968 AGGGAGGATCGCTTGAGCTCTGG + Intronic
1170632044 20:18074198-18074220 AGGGAGGATCACTTGAGCTCAGG - Intergenic
1170869922 20:20195986-20196008 TGGGAGGATCTCTTGAACCCAGG + Intronic
1171053399 20:21882980-21883002 AGGGAGGATCTGCTGTCCTCTGG + Intergenic
1171222807 20:23415871-23415893 TGGGAGGATCTCTTGAGCTCAGG + Intronic
1171529416 20:25842855-25842877 GGGGAGGATCACTTGAACTCAGG + Intronic
1171547410 20:26013025-26013047 GGGGAGGATCACTTGAACTCAGG - Intergenic
1171944810 20:31367167-31367189 AGGGAGGACCACTTGAACCCAGG + Intergenic
1172047119 20:32088000-32088022 TGGGAGGATCAGTTGAACCCAGG - Intronic
1172180253 20:32998940-32998962 TGGGAGGATCACTTGAACTCAGG + Intronic
1172263483 20:33590151-33590173 TGGGAGGATCTCTTGAACCCAGG + Intronic
1172368315 20:34366450-34366472 TGGGAGGACCACTTGAACACAGG - Intronic
1172370700 20:34388188-34388210 TGGGAGGACCGCTTGAACTCAGG - Intronic
1172376330 20:34443891-34443913 TGGGAGGATCTGTTGAGCCCAGG + Intronic
1172442395 20:34975295-34975317 TGGGAGGACCGCTTGAACCCAGG - Intergenic
1172472511 20:35210452-35210474 CGGGAGGATCACTTGAACTCAGG + Intergenic
1172503858 20:35446528-35446550 AGGGAGGATCACTTGAGCTCAGG - Intronic
1172544121 20:35746216-35746238 TGGGAGGATCTCTTGAGCTCAGG - Intergenic
1172545861 20:35760860-35760882 TGGGAGGATCTCTTGAACCCAGG + Intergenic
1172582094 20:36056423-36056445 AAGGAGGATCTCTTGAGCTCAGG - Intergenic
1172710242 20:36916402-36916424 AGGGAGGATCACTTGAGCTCAGG + Intronic
1172724619 20:37028434-37028456 AGGGAGGATCACTTGAACCCAGG + Intronic
1172817968 20:37704485-37704507 TGGGAGGATCTCTTGAGCTCAGG + Intronic
1172852867 20:37979170-37979192 TGGGAGGATCTCTTGAGCTCGGG + Intergenic
1172955169 20:38751706-38751728 AGGGAGGGCTTCTTAAACTCTGG + Intronic
1173221059 20:41133557-41133579 AGGCAGGACTGCTTGAACTCGGG + Intergenic
1173260966 20:41435366-41435388 AGGGAGGATTGCTTGAACTCAGG + Intronic
1173286116 20:41672697-41672719 AGGAAGGTGCTGTTGAACTGGGG - Intergenic
1173627480 20:44483883-44483905 TGGGAGGATCTCTTGAGCTCAGG - Intronic
1173657760 20:44712159-44712181 AGGGAGGATCCCTTGAACCCAGG + Intergenic
1173879113 20:46397576-46397598 AGGGAGGACAGCTTGAACCCAGG + Intronic
1173890640 20:46506882-46506904 TGGGAGGATCGCTTGAACTCAGG + Intronic
1174024689 20:47563930-47563952 TGGGAGGATCACTTGAACTCAGG + Intronic
1174314147 20:49684046-49684068 AGGGAGGATCGCTTGAACCCAGG + Intronic
1174466799 20:50724126-50724148 AGGGAGGATCGCTTGAGCTCAGG + Intergenic
1174637463 20:52014020-52014042 TGGGAGGATCAGTTGAACCCAGG - Intergenic
1174719531 20:52797241-52797263 AGGGAGGGCCGCTTGAGCTCAGG + Intergenic
1174829359 20:53798362-53798384 TGGGAGGACCACTTGAACCCAGG - Intergenic
1174836647 20:53862246-53862268 AGGGAGGACCTGTTGTAGATAGG - Intergenic
1174892084 20:54406286-54406308 GGGGAGGATCACTTGAACTCAGG + Intergenic
1174942659 20:54947682-54947704 AGGGAGGATGTCTTGAGCTCAGG + Intergenic
1175086431 20:56462983-56463005 TGGGAGGATCTCTTGAGCTCAGG + Intergenic
1175331990 20:58171468-58171490 CGGGAGGATCAGTTGAACCCAGG + Intergenic
1176912982 21:14590368-14590390 TGGGAGGACCTCCTGAGCTCAGG - Intergenic
1177121349 21:17140713-17140735 AGGGAGGACCTCATGGGCTCTGG - Intergenic
1177252562 21:18613316-18613338 TGGGAGGACCTCTTGAGCCCAGG - Intergenic
1177494441 21:21871431-21871453 AGGGAGGATCCCTTGAACCCAGG - Intergenic
1177791959 21:25731855-25731877 AGGGAGGATTGTTTGAACTCAGG + Intronic
1177830822 21:26137025-26137047 CGGGAGGATCTCTTGAACCCAGG - Intronic
1178084859 21:29102542-29102564 AGGGAGGATCTCTTGAGCTCAGG - Intronic
1178332505 21:31711035-31711057 TGGGAGGATCACTTGAACTCAGG - Intronic
1178341407 21:31788448-31788470 AGGGGGGACCTCTTGAAGCCGGG + Intergenic
1178448719 21:32671212-32671234 AGGGAGGATCTCTTGAGCCCAGG + Intronic
1178454897 21:32739875-32739897 AAGGAGGACCACTTGAGCTCAGG + Intronic
1178490188 21:33045391-33045413 GGGGAGGATCAGTTGAACCCAGG + Intergenic
1178557674 21:33607537-33607559 TGGGAGGATCTCTTGAACCCAGG + Intronic
1178601921 21:34001714-34001736 TGGGAGGATCTCTTGAGCTCAGG - Intergenic
1178641515 21:34348341-34348363 TGGGAGGATCTGTTGAGCCCAGG + Intergenic
1178920962 21:36737867-36737889 AGGGAGAATCTCTTGAACCCAGG + Intronic
1179223775 21:39433855-39433877 AGGGAGGATCACTTGAACCCAGG - Intronic
1179379759 21:40887505-40887527 AGGGAGGATCACTTGAGCTCAGG + Intergenic
1179787198 21:43736723-43736745 TGGGAGGATCTCTTGAGCTCAGG - Intronic
1180115273 21:45699372-45699394 AGGGAGGGCAGATTGAACTCTGG - Intronic
1180756666 22:18166964-18166986 TGGGAGGATCGCTTGAACTCAGG - Intronic
1180878512 22:19187022-19187044 AGGGAGGATCACTTGAGCTCAGG - Intronic
1180906931 22:19420371-19420393 TGGGAGGATCTATTGAGCTCGGG + Intronic
1180972953 22:19825066-19825088 AGGGAGGACCTGGTGGGCTGGGG - Intronic
1181075099 22:20370468-20370490 TGGGAGGATCGCTTGAACTCAGG + Intronic
1181262207 22:21606620-21606642 TGGGAGGATCACTTGAACTCAGG + Intronic
1181475539 22:23165729-23165751 AGGGAGGCCATTTTGGACTCTGG - Intergenic
1182106974 22:27696639-27696661 TGGGAGGACCTCTTGAGTTCAGG + Intergenic
1182236196 22:28878796-28878818 TGGGAGGATCTCTTGAACCCAGG - Intergenic
1182462801 22:30494458-30494480 CGGGAGGATCTCTTGAACCCAGG - Intronic
1182464161 22:30504148-30504170 TGGGAGGATCTATTGAACCCGGG - Intronic
1182614476 22:31577636-31577658 TGGGAGGATCGCTTGAACTCAGG + Intronic
1183051936 22:35269883-35269905 TGGGAGGATCAGTTGAACCCAGG + Intronic
1183065112 22:35357358-35357380 TGGGAGGACCACTTGAACCCAGG - Intergenic
1183088889 22:35507757-35507779 AGGGAGGATCAGTTGAGGTCAGG + Intergenic
1183129008 22:35814825-35814847 AGGGAGGATCTCTTGAGCTCAGG + Intronic
1183147648 22:36009464-36009486 TGGGAGGACCTCTTGAGCCCAGG - Intronic
1183296365 22:37031840-37031862 TGGGAGGATCACTTGAACTCAGG + Intergenic
1183677130 22:39305746-39305768 AAGGAGGATCTCTTGAACCCAGG + Intergenic
1183692349 22:39397738-39397760 CGGGAGGATCTTTTGAGCTCAGG + Intergenic
1183858033 22:40649439-40649461 CGGGAGGATCTCTTGAACCCAGG + Intergenic
1183887986 22:40901025-40901047 AAGGAAGATCAGTTGAACTCAGG + Intronic
1184153236 22:42650295-42650317 CAGGAGGATCTGTTGAACCCTGG - Intergenic
1184172243 22:42766673-42766695 CGGGAGGATCTGTTGAGCCCAGG + Intergenic
1184481701 22:44752132-44752154 TGGGAGGATCGCTTGAACTCGGG + Intronic
1184536511 22:45091347-45091369 AGGGTGGACCTGCAGAGCTCAGG + Intergenic
1184755049 22:46511019-46511041 AGGGAGAATCTCTTGAACCCAGG + Intronic
1184794044 22:46721183-46721205 AGGGAGGATCGCTTGAGCTCAGG + Intronic
949567191 3:5255723-5255745 TGGGAGGATCACTTGAACTCAGG + Intergenic
949985882 3:9540663-9540685 AGGGAGGACTGCTTGAGCTCAGG + Intronic
950291522 3:11788385-11788407 AGGGAGGACCACTTGAGCCCAGG - Intergenic
950314416 3:11987869-11987891 TGGGAGGATCAGTTGAACCCAGG + Intergenic
950403163 3:12786621-12786643 CGGGAGGATCTCTTGAACTTGGG + Intergenic
950802604 3:15566561-15566583 AGGCAGGATCCGTTGAACTTGGG + Intronic
951185178 3:19704490-19704512 AGGGAGGATCGCTTGAACCCTGG - Intergenic
951455505 3:22887859-22887881 ATGGAGGAGCTGTTGAAGGCTGG - Intergenic
951945523 3:28131666-28131688 TGGGAGGATCTGTTGAAATCAGG - Intergenic
952193651 3:31049824-31049846 TGGGAGGATCACTTGAACTCAGG - Intergenic
952368497 3:32696689-32696711 AGGGAGGATCACTTGAACCCAGG - Intronic
952427641 3:33191850-33191872 TGGGAGGATCTGTTGAGCCCAGG + Intronic
952459897 3:33513437-33513459 CAGGAGAACCAGTTGAACTCAGG + Intronic
952793977 3:37222890-37222912 TGGGAGGATCAGTTGAACCCAGG - Intergenic
952845472 3:37684566-37684588 TGGGAGGATCACTTGAACTCAGG - Intronic
953503949 3:43464450-43464472 TGGGAGGATCACTTGAACTCAGG + Intronic
954186884 3:48924035-48924057 CAGGAGGATCTGTTGAGCTCAGG + Intronic
954281615 3:49583515-49583537 TGGGAGGATCACTTGAACTCAGG + Intronic
954547560 3:51451387-51451409 AGGGAGGATCATTTGAGCTCAGG + Intronic
954657367 3:52203446-52203468 AGGGAGGATCGCTTGAACCCAGG + Intronic
954825908 3:53373294-53373316 TGGGAGGATCACTTGAACTCAGG - Intergenic
955205760 3:56894560-56894582 AGGGAGGACTGCTTGAACCCAGG + Intronic
955376601 3:58402324-58402346 TGGGAGGACCCTTTGAGCTCAGG - Intronic
955698037 3:61656137-61656159 AGGGAGGATCAGTTGAACCCAGG + Intronic
955698214 3:61657544-61657566 AGGGAGGATCAGTTGAACCCAGG + Intronic
955734241 3:62019428-62019450 AGGGAGGATTGCTTGAACTCAGG + Intronic
955896814 3:63709017-63709039 CTGGAGGATCTTTTGAACTCAGG - Intergenic
955908158 3:63829731-63829753 AGGGAGGATCTCTTGAGCTCAGG + Intronic
956176632 3:66479038-66479060 AGGGAGGACGTATTGAACTTGGG - Intronic
956280414 3:67550430-67550452 AGGGAGGATCACTTGAACCCGGG - Intronic
956436135 3:69236319-69236341 CAGGAGGATCTGTTGAACCCAGG - Intronic
956644516 3:71442982-71443004 AAGGAGAACCTCTTGAACCCAGG - Intronic
956762590 3:72456980-72457002 AAGGAGGATCTCTTGAGCTCAGG - Intergenic
956819745 3:72943467-72943489 AGGGAGGATCACTTGAGCTCAGG - Intronic
958595961 3:96223217-96223239 AGGGAGGATCACTTGAAGTCAGG - Intergenic
958664020 3:97110615-97110637 AGGGAGGATCGCTTGAACCCTGG - Intronic
959057280 3:101580336-101580358 TGGGAGGACCAGTTGAGCCCAGG + Intronic
959549504 3:107638689-107638711 TGGGAGGACTGGTTGAGCTCAGG + Intronic
959640002 3:108621968-108621990 TGGGAGGATCACTTGAACTCAGG + Intronic
959708310 3:109359603-109359625 TGGGAGGATCTCTTGAAGTCAGG - Intergenic
960224240 3:115150164-115150186 CGGGAGGATCTCTTGAACCCGGG + Intergenic
960797194 3:121500051-121500073 GGGGAGGACCACTTGAGCTCAGG + Intronic
960898421 3:122530082-122530104 TGGGAGGACTGATTGAACTCAGG + Intronic
960935386 3:122897273-122897295 TGGGAGGACTGCTTGAACTCAGG - Intergenic
961238441 3:125389059-125389081 AGGGAGGATCACTTGAGCTCAGG + Intergenic
961260990 3:125601702-125601724 AGGGAGGATCACTTGAAGTCAGG + Intergenic
961452328 3:127008006-127008028 AGGGAGCACCTGTGGATGTCTGG + Intronic
961538132 3:127582336-127582358 AGGGAGGACTGCTTGAGCTCAGG + Intronic
961783734 3:129337072-129337094 AGGGAGAATTTCTTGAACTCGGG - Intergenic
961908704 3:130290730-130290752 TGGGAGGACCGCTTGAGCTCAGG - Intergenic
961978478 3:131051756-131051778 AGGGAGGATCAGTTGAAACCAGG - Intronic
962113897 3:132481358-132481380 CGGGAGGATCACTTGAACTCAGG + Intronic
962355583 3:134691523-134691545 TGGGAGGATCTTTTGAACCCAGG + Intronic
962783202 3:138740869-138740891 AGGGAGGATCTCTTGAACCCAGG - Intronic
963157004 3:142109968-142109990 TGGGAGGATCACTTGAACTCGGG - Intronic
963209449 3:142673132-142673154 TGGGAGGATCCCTTGAACTCTGG - Intronic
963616662 3:147547865-147547887 AGGGAGGATCACTTGAAGTCAGG + Intergenic
963646029 3:147915696-147915718 TGGGAGGATCACTTGAACTCAGG - Intergenic
963735567 3:149014616-149014638 AGGGAGGATCTCTTGAGCCCAGG + Intronic
963794056 3:149613638-149613660 TGGGAGGATCACTTGAACTCAGG - Intronic
963884702 3:150568686-150568708 TGGGAGGATCATTTGAACTCAGG + Intronic
964033204 3:152163781-152163803 TGGGAGGACCTCTTGAGCCCAGG + Intergenic
964113719 3:153113360-153113382 TGGGAGGATCAGTTGAACCCTGG + Intergenic
964197439 3:154081005-154081027 AGGGAGGATCACTTGAACCCAGG - Intergenic
964271538 3:154961614-154961636 AGGGAGGATCACTTGACCTCAGG + Intergenic
964290638 3:155176596-155176618 AGGGAGGATCACTTGAGCTCAGG + Intronic
964429722 3:156592411-156592433 AGGGAGAATCTCTTGAACCCGGG - Intergenic
964524501 3:157603758-157603780 TGGGAGGATCTCTTGAGCTCAGG + Intronic
965019118 3:163203313-163203335 CGGGAGGATCAGTTGAGCTCAGG + Intergenic
965210102 3:165774424-165774446 AGGGAGAATCTCTTGAACCCAGG - Intronic
965641294 3:170831274-170831296 AGGGAGGACCATTTGAGCCCAGG + Intronic
966012695 3:175100744-175100766 AGGGAGAATCGCTTGAACTCGGG + Intronic
966203416 3:177380282-177380304 CGGGAGGACCAGTTGAGCCCAGG - Intergenic
966368094 3:179212666-179212688 AGGGAGGATCACTTGAGCTCAGG - Intronic
966419349 3:179721971-179721993 AGGCAGGATCACTTGAACTCAGG + Intronic
966789752 3:183656254-183656276 AGGGAGGATCTCTTGAGCCCAGG - Intronic
967118225 3:186361086-186361108 AGGGATGAGCTGCGGAACTCAGG - Intronic
967700382 3:192585575-192585597 AGGTTGGGCCTGTAGAACTCTGG + Intronic
968026834 3:195449720-195449742 AGGGAGGATCACTTGAGCTCCGG - Intergenic
968124912 3:196151913-196151935 TGGGAGGATCACTTGAACTCAGG - Intergenic
968146665 3:196304973-196304995 TGGGAGGACCTCTTGAGCCCAGG - Intronic
968169891 3:196501816-196501838 TGGGAGGATCTCTTGAACCCAGG - Intronic
968225677 3:196970487-196970509 GGAGAGGACTTCTTGAACTCGGG - Intergenic
968768441 4:2487647-2487669 AGGGAGGATCTCTTGAGCCCAGG - Intronic
968770658 4:2503987-2504009 AAGGAGGATCACTTGAACTCAGG + Intronic
968794797 4:2695836-2695858 AGGGAGGATCTCTTGAGCCCAGG + Intronic
968848588 4:3062255-3062277 CGGGAGGACCATTTGAGCTCAGG - Intergenic
968863309 4:3190252-3190274 TGGGAGGATCTCTTGAGCTCAGG + Intronic
969326816 4:6448856-6448878 ACGGAGGTCCTGCTGAACTCCGG + Intronic
969354290 4:6616217-6616239 AGAGAGGACCTGGTTAACACAGG - Intronic
969555601 4:7906907-7906929 AGGAAGAACCGCTTGAACTCGGG + Intronic
969847120 4:9928047-9928069 TGGGAGGACCTCTTGAGCCCAGG + Intronic
970060416 4:12027119-12027141 AGGGAGGATCAGTTGAGCCCGGG - Intergenic
970802383 4:19988887-19988909 TGGGAGGATCTCTTGAATTCAGG - Intergenic
971003601 4:22350021-22350043 TGGGAGGATCTCTTGAGCTCAGG + Intronic
971339555 4:25755328-25755350 AGGGAGGATCACTTGAGCTCAGG - Intronic
971415295 4:26421393-26421415 AGGGAGGATTGGTTGAACCCGGG - Intronic
971515493 4:27481226-27481248 AGGGAGGATCGCTTGAAGTCAGG + Intergenic
971558079 4:28038816-28038838 CGGGAGGACCTCTTGAGGTCAGG + Intergenic
972592787 4:40503943-40503965 TGGGAGGATCTCTTGAATTCAGG + Intronic
972774678 4:42229986-42230008 TGGGAGGATCTCTTGAACCCGGG + Intergenic
972793422 4:42394252-42394274 AGGGAGGATCCCTTGAGCTCAGG - Intergenic
973161708 4:47026085-47026107 TGGGAGGATCTCTTGAATTCAGG + Intronic
973735598 4:53868548-53868570 AGGGAGGAACTGAAGTACTCTGG + Intronic
974048576 4:56918399-56918421 TGGGAGGATCTGTTGAGCCCGGG + Intronic
974068243 4:57100305-57100327 TGGGAGGATCTCTTGAGCTCAGG - Intronic
975333634 4:73149770-73149792 AGGGAGGATCATTTGAGCTCAGG + Intronic
975777808 4:77807315-77807337 GGAGAGGATCTGTTGAGCTCAGG + Intronic
975784280 4:77871126-77871148 AGGGAGGCCCACTTGAACCCAGG + Intronic
975976217 4:80099293-80099315 CGGGAGGACCTCTTGAGCTCAGG + Intronic
976240897 4:82955690-82955712 TGGGAGGATCGCTTGAACTCAGG + Intronic
976270680 4:83227643-83227665 TGGGAGGACCACTTGAACCCAGG - Intergenic
976566055 4:86552190-86552212 CGGGAGGATCTCTTGAGCTCAGG + Intronic
976678752 4:87731894-87731916 AGGGAGGATCTGTTGAGCACAGG + Intergenic
976819723 4:89191895-89191917 TGGGAGGATCTCTTGAACCCGGG + Intergenic
976967883 4:91067436-91067458 AGGGAGGACTGTTTGAACCCAGG - Intronic
977251053 4:94689290-94689312 CGGGAGGATCACTTGAACTCAGG - Intergenic
977299070 4:95246947-95246969 AGGGAGGATCATTTGAACTCAGG + Intronic
977419372 4:96778521-96778543 TGGGAGGATCCCTTGAACTCGGG + Intergenic
977531867 4:98209762-98209784 TGGGAGGATCTCTTGAGCTCAGG - Intergenic
977768128 4:100825125-100825147 CAGGAGGATCTCTTGAACTCAGG - Intronic
978350236 4:107813621-107813643 TGGGAGGATCACTTGAACTCGGG - Intergenic
978578032 4:110205485-110205507 CGGGAGGATCTCTTGAGCTCAGG - Intergenic
978645488 4:110926061-110926083 GGGGAGGACTGATTGAACTCAGG - Intergenic
978773761 4:112485213-112485235 AGGGAGGATCGATTGAACTCAGG + Intergenic
979034589 4:115698542-115698564 CAGGAGAACCTTTTGAACTCAGG + Intergenic
979240949 4:118446460-118446482 TGGGAGGATCACTTGAACTCAGG - Intergenic
979467248 4:121054920-121054942 CGGAAGGATCTGTTGAGCTCAGG - Intronic
979532158 4:121780292-121780314 TGGGAGGACCTCTTGAGCCCAGG + Intergenic
979623484 4:122821558-122821580 TGGGAGAATCTCTTGAACTCAGG - Intergenic
980031365 4:127835854-127835876 AGGGAGGATCACTTGAACCCAGG + Exonic
980363467 4:131767693-131767715 AGGGAGAACTGCTTGAACTCGGG - Intergenic
980936244 4:139228385-139228407 TGGGAGAATCTCTTGAACTCAGG - Intergenic
981380527 4:144066508-144066530 AGGGAGGATCACTTGAACCCAGG + Intergenic
981696043 4:147559798-147559820 AAGGAGGATCGTTTGAACTCAGG - Intergenic
982007304 4:151075869-151075891 AGGGAGGATCACTTGACCTCAGG - Intergenic
982234174 4:153236782-153236804 TGGGAGGATCTCTTGAACCCAGG - Intronic
982457739 4:155630485-155630507 AGGGAGGATCTCTTGAACCCAGG - Intergenic
982469630 4:155772645-155772667 TGGGAGGATCCGTTGAGCTCAGG - Intronic
983109277 4:163727912-163727934 AGGGAGGATCACTTGAACCCAGG - Intronic
983195229 4:164799156-164799178 AGGGTGGATCCCTTGAACTCGGG + Intergenic
983261957 4:165467228-165467250 AGGGAGGATCACTTGAACCCAGG + Intronic
983653884 4:170060840-170060862 AGGGAGGATCACTTGAACCCAGG - Exonic
983911076 4:173240459-173240481 CAGGAGAACCTCTTGAACTCGGG - Intronic
983955175 4:173689024-173689046 AGGGAGGACATCTTGAGCCCAGG + Intergenic
984319943 4:178181649-178181671 AGGGAGGACATCTTGAGCCCAGG + Intergenic
984349757 4:178575932-178575954 AAGGAGGATCACTTGAACTCAGG - Intergenic
984467036 4:180112737-180112759 AGACAGGACCTCTTGAAGTCAGG + Intergenic
984643370 4:182195409-182195431 TGGGAGGATCTCTTGAGCTCAGG + Intronic
984735844 4:183107252-183107274 TGGGAGGATCTGTTGAACCCTGG - Intronic
984819369 4:183866784-183866806 CGGGAGGAACACTTGAACTCAGG + Intronic
984840792 4:184065523-184065545 AGGGAGAATCTCTTGAACCCGGG - Intergenic
984929011 4:184829999-184830021 TGGGAGGATCTCTTGAACCCAGG + Intergenic
984932785 4:184861797-184861819 AGGGAGAATCTCTTGAACCCAGG + Intergenic
985069797 4:186156880-186156902 TGGGAGGACCCCTTGAGCTCAGG + Intronic
985301681 4:188496757-188496779 CAGGAGAACCTCTTGAACTCGGG - Intergenic
985522493 5:383653-383675 CGGGAGGATCTCTTGAGCTCAGG - Intronic
986731254 5:10636522-10636544 AGGGAGGATCTCTTGAGCCCAGG + Intronic
987283025 5:16429520-16429542 AGGGAGGATCACTTGAACCCAGG + Intergenic
987452627 5:18105100-18105122 AGGGAGGACCGCTTGAGCCCAGG - Intergenic
987980031 5:25072102-25072124 TGGGAGGATTTCTTGAACTCAGG + Intergenic
988180767 5:27788657-27788679 AGGGAGGAAAGCTTGAACTCAGG + Intergenic
988619283 5:32805793-32805815 TGGGAGGACCACTTGAACCCAGG - Intergenic
988682469 5:33497402-33497424 AGAGAGGTACTGTTGAACTGAGG - Intergenic
988788803 5:34588489-34588511 AGGGAGGACCACTTGAGCCCAGG - Intergenic
989070868 5:37509967-37509989 TGGGAGGATCTCTTGAATTCAGG + Intronic
989099894 5:37813788-37813810 TGGGAGGATCTCTTGAACCCAGG - Intronic
989152554 5:38314737-38314759 AGTGGTGACTTGTTGAACTCAGG + Intronic
989366946 5:40666712-40666734 TGGGAGGATCTCTTGAAGTCAGG - Intergenic
990075938 5:51845783-51845805 TAGGAGGACCTCTTGAGCTCAGG + Intergenic
990174798 5:53095600-53095622 AGGGAGGATCCTTTGAACCCAGG + Intergenic
990223675 5:53625036-53625058 TGGGAGGATCTCTTGAGCTCAGG - Intronic
990265519 5:54070939-54070961 AGGGAGGATCTCCTGAGCTCAGG + Intronic
990362280 5:55032502-55032524 TGGATGGATCTGTTGAACTCAGG + Intronic
990384973 5:55251655-55251677 TGGGAGGATCACTTGAACTCAGG - Intergenic
991179954 5:63738610-63738632 TGGGAGGACCCCTTGAACCCAGG - Intergenic
991310618 5:65237293-65237315 AGGGAGGATCTCTTGAGCTCAGG + Intronic
991367315 5:65882729-65882751 TGGGAGGACCACTTGAACCCAGG + Intergenic
991697844 5:69289632-69289654 AGGGAGGACCGCTTGAGCCCAGG + Intronic
991971316 5:72144484-72144506 AGGGAGGATCTCTTGAGCCCAGG - Intronic
992119314 5:73574712-73574734 TGGGAGGATCTGTTGAACTCAGG - Intronic
992256101 5:74922755-74922777 AGGGAGGAGCTGATGCCCTCGGG - Intergenic
992322727 5:75629705-75629727 TGGGAGGATCTCTTGAGCTCAGG + Intronic
992516142 5:77493911-77493933 AGGGAGGAAGTGTTCAACCCTGG - Intronic
992561460 5:77957298-77957320 TGGGAGGATCTCTTGAGCTCAGG - Intergenic
992688502 5:79220617-79220639 AGGGAGGATCCCTTGAACTGAGG - Intronic
992691934 5:79248988-79249010 CGGGAGGATAAGTTGAACTCAGG - Intronic
992765437 5:79994575-79994597 AGGGAGGATCACTTGAACCCAGG + Intronic
992847359 5:80764588-80764610 TGGGAGGATCTCTTGAACCCAGG - Intronic
993076237 5:83235240-83235262 AGGGAGGATCACTTGAACCCAGG + Intronic
993236271 5:85314040-85314062 AGGGAGGATCTCTTGAACCCAGG + Intergenic
993720398 5:91316052-91316074 TGGGAGGATCTCTTGAGCTCAGG + Intergenic
993781662 5:92073737-92073759 AGGGAGGATCGCTTGAACCCAGG + Intergenic
994588130 5:101737758-101737780 AGGGAGAGCCTGTTGAATTCAGG + Intergenic
995033530 5:107507607-107507629 AAGGAGGACCGCTTGAGCTCAGG + Intronic
995034902 5:107522489-107522511 TGTGAGGACCACTTGAACTCAGG - Intronic
995158672 5:108947947-108947969 AGGGAGGATCACTTGAGCTCAGG - Intronic
996302381 5:122004025-122004047 TGGGAGGATCGCTTGAACTCGGG - Intronic
996374972 5:122794792-122794814 TGGGAGGATCACTTGAACTCAGG + Intronic
996506779 5:124276684-124276706 TGGGAGGATCCCTTGAACTCAGG - Intergenic
996713016 5:126562436-126562458 CGGGAGGATCTCTTGAGCTCAGG - Intronic
997236401 5:132274630-132274652 GGGGTGGAGCTGTTGATCTCGGG - Intronic
997327873 5:133036994-133037016 TGGGAGGATCTCTTGAACCCAGG + Intergenic
997896055 5:137718403-137718425 TGGGAGGACTGCTTGAACTCAGG + Intronic
997908500 5:137844486-137844508 AGGGAGGATCACTTGAGCTCAGG + Intergenic
997929815 5:138062913-138062935 TGGGAGGATCACTTGAACTCGGG + Intergenic
998068740 5:139179961-139179983 TGGGAGGATCTCTTGACCTCAGG + Intronic
998105383 5:139465620-139465642 AGGGAGGACTGCTTGAGCTCAGG + Intergenic
998229703 5:140352860-140352882 TGGGAGGATCACTTGAACTCAGG + Intergenic
998376220 5:141692548-141692570 AGGGAGGGCCTGGGGAATTCAGG - Intergenic
998428866 5:142053062-142053084 AGGGAGGATCACTTGAGCTCAGG + Intergenic
998853861 5:146376172-146376194 AGGGAGGACTGCTTGAGCTCAGG + Intergenic
999219058 5:149960197-149960219 AGGGAGGATCGCTTGAACCCAGG - Intergenic
999449632 5:151668378-151668400 AGGGAGGATCACTTGAGCTCAGG - Intronic
999740801 5:154549868-154549890 TGGGAGGATCATTTGAACTCAGG - Intergenic
999859428 5:155629647-155629669 TGGGAGGATCCGTTGAGCTCAGG + Intergenic
1000182839 5:158829267-158829289 TGGGAGGACCAGTTGAGCCCGGG - Intronic
1000564481 5:162830442-162830464 AAGGAGGATCATTTGAACTCAGG + Intergenic
1000799893 5:165712973-165712995 AGGGAGGATCTTTTAAACCCAGG - Intergenic
1001029221 5:168249764-168249786 AGGGAGAATCTCTTGAGCTCAGG + Intronic
1001889694 5:175328598-175328620 AGGGAGGATCGCTTGAAGTCAGG + Intergenic
1002009818 5:176269982-176270004 CGGGAGGATCTCTTGAGCTCAGG - Intronic
1002131517 5:177085031-177085053 CGGGAGGATCGCTTGAACTCAGG - Intergenic
1002216906 5:177642326-177642348 CGGGAGGATCTCTTGAGCTCAGG + Intergenic
1002463136 5:179386799-179386821 AGGGAGGATTGCTTGAACTCAGG + Intergenic
1002487847 5:179551582-179551604 AGGGAGGATCGCTTGAACCCGGG - Intronic
1002488485 5:179556591-179556613 TGGGAGGATCACTTGAACTCGGG - Intronic
1002719519 5:181249453-181249475 TGGGAGGATCACTTGAACTCAGG + Intergenic
1002864854 6:1112187-1112209 TGGGAGGATCGCTTGAACTCAGG - Intergenic
1002988859 6:2219002-2219024 AGGGAGGACCGCTTGAGCCCAGG + Intronic
1003865945 6:10362905-10362927 AGGGAGGATCAGTTGAAGCCAGG + Intergenic
1003999595 6:11584926-11584948 AGGGAGGATCACTTGAACCCAGG - Intergenic
1004055201 6:12129115-12129137 TGGGAGGACCTCTTGAGCCCAGG + Intronic
1004340220 6:14801882-14801904 TGGGAGGATCGCTTGAACTCGGG - Intergenic
1004441692 6:15661259-15661281 AGGGAGGATCTCTTGTACCCAGG + Intronic
1004469143 6:15913273-15913295 TGGGAGGATCGCTTGAACTCGGG + Intergenic
1004708355 6:18145880-18145902 AGGGAGGATCTCTTGAGCCCAGG + Intronic
1004719720 6:18257482-18257504 TGGGAGGACCACTTGAGCTCAGG + Intronic
1004751762 6:18568991-18569013 AGGGAGGACCACTTGAACCCAGG + Intergenic
1004766879 6:18739368-18739390 TGGGAGGATCAGTTGAACCCAGG - Intergenic
1004937052 6:20518073-20518095 CGGGAGGATCAGTTGAACCCAGG + Intergenic
1004977664 6:20985690-20985712 CGGGAGGATCCCTTGAACTCAGG + Intronic
1004989153 6:21117408-21117430 TGGGCGGATCTGTTGAACCCAGG + Intronic
1005303171 6:24490657-24490679 TGGGAGGATCTCTTGAACCCAGG + Intronic
1005394137 6:25364032-25364054 AGGGAGGATCGCTTGAACCCAGG - Intronic
1005486727 6:26307531-26307553 AGGGAGGATCGCTTGAACCCAGG + Intergenic
1005497568 6:26401613-26401635 AGGGAGGATCACTTGAGCTCAGG + Intergenic
1005508466 6:26491061-26491083 CGGGAGGATCACTTGAACTCAGG + Intergenic
1005529214 6:26685813-26685835 TGGGAGGATCGCTTGAACTCAGG + Intergenic
1005541582 6:26815833-26815855 TGGGAGGATCGCTTGAACTCAGG - Intergenic
1005591175 6:27329238-27329260 CGGGAGGATCAGTTGAGCTCAGG - Intergenic
1005732016 6:28706910-28706932 TGGGAGGACCACTTGAGCTCAGG + Intergenic
1005793058 6:29327195-29327217 AGGGAGAATCTCTTGAACCCGGG + Intergenic
1005937745 6:30536675-30536697 TGGGAGGATCACTTGAACTCTGG + Intergenic
1006012213 6:31052585-31052607 AGGGAGGATCTCTTGAGCTCAGG + Intergenic
1006107021 6:31723073-31723095 AGGGAGGATCGCTTGAGCTCAGG - Intronic
1006269848 6:32955901-32955923 CGGGAGGATCGCTTGAACTCGGG - Intronic
1006347395 6:33493979-33494001 CGGGAGGATCACTTGAACTCAGG + Intergenic
1006467324 6:34203351-34203373 AGTGAGCACCTGAGGAACTCTGG + Intergenic
1006468925 6:34214993-34215015 TGGGAGGATCCCTTGAACTCAGG - Intergenic
1006549732 6:34811932-34811954 AGGGAGGATCACTTGAGCTCAGG + Intronic
1006676144 6:35765029-35765051 AGGGAGGATCGCTTGAACCCGGG + Intergenic
1006768772 6:36533238-36533260 TGGGAGGATCTCTTGAGCTCAGG - Intronic
1006812385 6:36828225-36828247 AGGGAGGATCACTTGAGCTCAGG + Intronic
1006844696 6:37054149-37054171 AGGGAGGATCGCTTGAACCCAGG + Intergenic
1006855394 6:37129500-37129522 CGGGAGGATCTCTTGAGCTCAGG + Intergenic
1006875097 6:37288647-37288669 AGGGAGGATCTCTTGAGCCCAGG + Intronic
1007062554 6:38955199-38955221 AGGGAGGATCACTTGAGCTCAGG - Intronic
1007218824 6:40262474-40262496 AGGCAGGACCTGGTGTTCTCTGG - Intergenic
1007613221 6:43163883-43163905 AGGGAGGATCTCTTGAACCCAGG + Intergenic
1007800905 6:44391893-44391915 TGGGAGGATCGGTTGAACCCAGG + Intronic
1008080840 6:47193116-47193138 TGGGAGGACCACTTGAGCTCAGG + Intergenic
1008719965 6:54337343-54337365 AGGGAGAATTGGTTGAACTCAGG - Intronic
1008749541 6:54715774-54715796 AGGGAGAATCACTTGAACTCAGG + Intergenic
1008951981 6:57171779-57171801 TGGGAGGACCGCTTGAACCCGGG + Intergenic
1009012392 6:57857890-57857912 TGGGAGGATCGCTTGAACTCAGG - Intergenic
1009954660 6:70438927-70438949 TGGGAGGATCTCTTGAACCCAGG + Intronic
1010210801 6:73361794-73361816 AGGGAGGATCTCTTGAGCCCAGG + Intergenic
1010419974 6:75661957-75661979 CGGGAGAATCTGTTGAACCCTGG + Intronic
1010423753 6:75703667-75703689 AGGGAGGATCGCTTGAGCTCAGG + Intronic
1011084771 6:83527244-83527266 TGGGAGGATCTATTGAGCTCAGG - Intergenic
1011256148 6:85423160-85423182 AGGGTGGATCTCTTGAGCTCAGG + Intergenic
1011460447 6:87597779-87597801 TGGGAGGATCACTTGAACTCAGG - Intronic
1011591337 6:88973137-88973159 TGGGAGGATCTCTTGAGCTCAGG - Intergenic
1011604879 6:89093384-89093406 TGGGAGGATCACTTGAACTCAGG - Intergenic
1011634238 6:89355033-89355055 AGGGAGGATCAGTTGAGCTCTGG + Intergenic
1011667380 6:89647725-89647747 AGGGAGGATCACTTGAACCCAGG + Intronic
1013051748 6:106542742-106542764 AGGCAGAACCGCTTGAACTCAGG - Intronic
1013051786 6:106543123-106543145 AGGCAGAACCGCTTGAACTCAGG - Intronic
1013092099 6:106909192-106909214 CAGGAGGACCACTTGAACTCAGG + Intergenic
1013129178 6:107215297-107215319 AGGGAGGATCACTTGAACCCAGG + Intronic
1013161868 6:107552828-107552850 AGGGAGGATCACTTGAACCCAGG + Intronic
1013217587 6:108042202-108042224 CAGGAGGATCTCTTGAACTCAGG + Exonic
1013327186 6:109058175-109058197 TGGGAGGATCACTTGAACTCAGG - Intronic
1013518961 6:110915176-110915198 AGGGAGAACTGCTTGAACTCAGG + Intergenic
1013529069 6:111002558-111002580 CGGGAGGATCGCTTGAACTCAGG - Intronic
1013711131 6:112900418-112900440 AGGGAGGATCTCTTGAGTTCAGG - Intergenic
1014030720 6:116700242-116700264 AGGGAGGACCTCTTGAACCCAGG + Intronic
1014474244 6:121853267-121853289 TGGGAGGACCACTTGAGCTCAGG - Intergenic
1014572776 6:123031196-123031218 AGGGAGGATCACTTGAACCCAGG - Intronic
1014924495 6:127254895-127254917 AAGGAGAACCACTTGAACTCGGG + Intergenic
1015007934 6:128306703-128306725 AGGGAGGATCACTTGAGCTCAGG + Intronic
1015368953 6:132428873-132428895 ATGGAGGAAATGTTGAACCCAGG - Intergenic
1015402422 6:132801123-132801145 TGGGAGGATCAGTTGAGCTCAGG - Intergenic
1015522825 6:134148414-134148436 AGGGAGGATCTCTTGAGCCCAGG + Intergenic
1015613966 6:135055273-135055295 AGGGCGGATCGCTTGAACTCAGG + Intronic
1015629828 6:135220934-135220956 TGGGAGGACTGGTTGAACCCAGG - Intergenic
1015766157 6:136719081-136719103 AGGGAGGATCACTTGAACGCAGG + Intronic
1015797753 6:137030171-137030193 AGGGAGGACCACTTGAGCCCAGG - Intronic
1015815875 6:137210121-137210143 TGGGAGGATCTGTTGAGCTCAGG + Intronic
1015952280 6:138565332-138565354 TGGGAGGAACATTTGAACTCAGG - Intronic
1016068712 6:139711485-139711507 AGGGAGAATCTCTTGAACCCAGG - Intergenic
1016472707 6:144391297-144391319 AGGAAGGATCTCTTGAGCTCAGG - Intronic
1016486635 6:144546714-144546736 TGGGAGGATCACTTGAACTCAGG + Intronic
1016679308 6:146809567-146809589 TGGGTGGATCTCTTGAACTCAGG - Intronic
1016964257 6:149703634-149703656 AGGGAGGACTGCTTGAGCTCAGG + Intronic
1017134329 6:151134845-151134867 TGGGAGGATCGCTTGAACTCAGG + Intergenic
1017402332 6:154078641-154078663 AGGGAGGACCACTTGAGCACAGG + Intronic
1017471193 6:154738090-154738112 TGGGAGGATCTGTTGAGCCCAGG + Intronic
1017679823 6:156852353-156852375 TGGGAGGACCCTTTGAGCTCAGG + Intronic
1017885689 6:158597731-158597753 AGGGAGGACTGCTTGAACCCAGG - Intronic
1018448952 6:163887571-163887593 AGGGATCATCTGTTGATCTCTGG - Intergenic
1018464935 6:164035386-164035408 TGGGAGGATCTGCTGAACCCCGG - Intergenic
1018664346 6:166120869-166120891 AGGGAGGATCACTTGAGCTCAGG + Intergenic
1019374273 7:680826-680848 TGGGAGGATCGCTTGAACTCAGG + Intronic
1019377990 7:706096-706118 GGGGAGGACCGCTTGAGCTCAGG + Intronic
1019679440 7:2337352-2337374 AGGGAGGATCACTTGAGCTCAGG + Intronic
1019760108 7:2804829-2804851 CGGGAGGATCTGTTGAGCCCAGG + Intronic
1019789038 7:2998455-2998477 TGGGAGGATCACTTGAACTCAGG + Intronic
1019998764 7:4742642-4742664 AGGGAGGATCTCTTGAGCCCAGG - Intronic
1020037034 7:4970424-4970446 TGGGAGGATCACTTGAACTCAGG + Intergenic
1020050912 7:5081064-5081086 TGGGAGGATCGGTTGAACCCGGG - Intergenic
1020100626 7:5392368-5392390 CAGGAGGATCTCTTGAACTCAGG + Intronic
1020121015 7:5503444-5503466 TGGGAGGATCTCTTGAACCCCGG - Intronic
1020243274 7:6411532-6411554 TGGGAGGATCAGTTGAACTTGGG + Intronic
1020372688 7:7451316-7451338 CGGGAGAACCACTTGAACTCAGG - Intronic
1020791943 7:12638028-12638050 AAGGAGGAGCAGTTGAACTTAGG - Intronic
1021025469 7:15660918-15660940 TGGGAGGATCACTTGAACTCGGG + Intronic
1021121690 7:16802923-16802945 AGGGAGGATCACTTGAACCCAGG - Intronic
1021388767 7:20066381-20066403 TGGGAGGATCACTTGAACTCAGG + Intergenic
1021444019 7:20713461-20713483 TGGGAGGACCACGTGAACTCAGG - Intronic
1021458510 7:20858298-20858320 GGGGAGGATCTCTTGAGCTCAGG - Intergenic
1021545892 7:21812559-21812581 AGGGAGGATCACTTGAGCTCAGG + Intronic
1021568157 7:22035117-22035139 TGGGAGGACCAGTTGAACCCAGG - Intergenic
1021590407 7:22254997-22255019 AAGGTGGACCTGTTAGACTCGGG - Intronic
1021650921 7:22832212-22832234 AAGGAGGATCTGTTGAGCCCAGG - Intergenic
1021715789 7:23460856-23460878 CAGGAGGACCTCTTGAACCCGGG + Intronic
1021856946 7:24866408-24866430 AGGGAGGACCACTTGAGCCCAGG + Intronic
1022085030 7:27058323-27058345 AGGGAGGATCACTTGAGCTCAGG - Intergenic
1022369412 7:29756871-29756893 AGGGAGGATCACTTGAAGTCAGG + Intergenic
1023485466 7:40681709-40681731 AGGCAGGACCTCTTGAAGTAGGG + Intronic
1023802784 7:43849447-43849469 TGGGAGGATCTGTTGACCCCAGG + Intergenic
1023928338 7:44687648-44687670 AGGGTGGATCACTTGAACTCAGG - Intronic
1023957425 7:44897996-44898018 TGGGAGGACCACTTGAGCTCAGG + Intergenic
1024458956 7:49639846-49639868 AGAGAGGAGCAGTTGAACTATGG + Intergenic
1024640242 7:51322555-51322577 AGTGAGGAGCTGTTGAATTTAGG + Intergenic
1025057121 7:55774163-55774185 TGGGAGGATCCCTTGAACTCAGG + Intergenic
1025089504 7:56050949-56050971 CGGGAGGATCACTTGAACTCAGG + Intronic
1025259414 7:57407812-57407834 AGGGAGGATCCCTTGAGCTCAGG + Intergenic
1025609441 7:63065346-63065368 AGGGAGGATCCCTTGAGCTCAGG - Intergenic
1025911134 7:65829750-65829772 TGGGAGGACCACTTGAACCCAGG - Intergenic
1026009445 7:66625429-66625451 ATGGAGGATCACTTGAACTCAGG + Intergenic
1026098550 7:67366176-67366198 TGGGAGGATCTCTTGAAGTCAGG + Intergenic
1026114061 7:67481427-67481449 CAGGAGGATCTCTTGAACTCAGG - Intergenic
1026176390 7:68001446-68001468 TGGGAGGATCTCTTGAGCTCAGG + Intergenic
1026186431 7:68085282-68085304 AGGGAGGATCACTTGAACCCAGG - Intergenic
1026288536 7:68985361-68985383 AGGGAGGATCTCTTGAGCTCAGG - Intergenic
1026305635 7:69138291-69138313 AGTGAGGACCTGTTGGTCACAGG - Intergenic
1026498006 7:70920104-70920126 TGGGAGGATCCGTTGAGCTCAGG - Intergenic
1026570330 7:71523647-71523669 GAGGAGGATCTCTTGAACTCAGG + Intronic
1026776960 7:73236350-73236372 TGGGAGGATCCGTTGAGCTCAGG + Intergenic
1026798669 7:73382942-73382964 CAGGAGGACCTCTTGAACCCAGG + Intergenic
1026938217 7:74271019-74271041 AGGGAGGATCTTTTGAGCCCAGG - Intergenic
1026997834 7:74630356-74630378 AGGGAGGATCGCTTGAGCTCAGG + Intergenic
1027017807 7:74789720-74789742 TGGGAGGATCCGTTGAGCTCAGG + Intergenic
1027070216 7:75156212-75156234 TGGGAGGATCCGTTGAGCTCAGG - Intergenic
1027190128 7:75991770-75991792 TGGGAGGATCACTTGAACTCAGG - Intronic
1027247871 7:76379636-76379658 CGGGAGGATCTCTTGAGCTCAGG - Intergenic
1027258678 7:76448103-76448125 TGGGAGGATCGGTTGAGCTCAGG + Intergenic
1027271056 7:76519155-76519177 TGGGAGGATCTGTTGAACTCAGG - Intergenic
1027320820 7:77009090-77009112 TGGGAGGATCTGTTGAACTCAGG - Intergenic
1027376643 7:77557192-77557214 CGGGAGGACCTCTTGAGCCCAGG - Intronic
1027740928 7:82003835-82003857 AGGGAGAATCTCTTGAACCCGGG - Intronic
1028268890 7:88761996-88762018 GGGGAGTACCTGGTGAACCCTGG - Intronic
1028282941 7:88955031-88955053 CGGGAGGATCTCTTGAGCTCAGG + Intronic
1028807436 7:95044798-95044820 AGGGAGGACCACTTGAGCGCAGG - Intronic
1028881513 7:95885569-95885591 AGGGAGGATCCTTTGAACCCAGG - Intronic
1028964802 7:96790165-96790187 AGGGAGAACCTGCTTGACTCAGG - Intergenic
1029182904 7:98717376-98717398 TGGGAGGACTGCTTGAACTCAGG - Intergenic
1029303974 7:99605357-99605379 CGGGAGGATCGCTTGAACTCAGG - Intronic
1029336699 7:99906417-99906439 TGGGAGGATCTCTTGAGCTCAGG - Intronic
1029337032 7:99909957-99909979 TGGGAGGATCTGTTGAGCCCAGG - Intronic
1029446757 7:100617459-100617481 TGGGAGGATCTCTTGAACCCAGG + Intergenic
1029636754 7:101789652-101789674 TGGGAGGATCCCTTGAACTCAGG + Intergenic
1029711411 7:102302084-102302106 GGGGAGGATCTCTTGAGCTCAGG - Intronic
1029917363 7:104224892-104224914 AGGGAGGATCACTTGAAGTCAGG - Intergenic
1031045902 7:116887297-116887319 TGGGAGGATCCTTTGAACTCAGG + Intronic
1031130121 7:117823781-117823803 AGGGAGGATCACTTGAACCCAGG - Intronic
1031338337 7:120566433-120566455 TGGGAGGATCTCTTGAACTTGGG - Intronic
1031464674 7:122093715-122093737 TGGGAGGATCACTTGAACTCAGG + Intronic
1031623425 7:123964615-123964637 TGGGAGGATCAGTTGAACTCAGG - Intronic
1031636820 7:124110695-124110717 AGGGAGGATCTCTTGAGCCCAGG + Intergenic
1031980972 7:128124069-128124091 TGGGAGGACCTCTTGAGCCCAGG - Intergenic
1032131658 7:129234141-129234163 AGGGAGGTTCTATTGAGCTCAGG - Intronic
1032162949 7:129524772-129524794 TGGGAGGATCGCTTGAACTCAGG - Intergenic
1032358913 7:131236566-131236588 GGGGAGGATCACTTGAACTCAGG + Intronic
1032727186 7:134601509-134601531 AGGGAGGATCTCTTGAGCCCAGG + Intergenic
1032834906 7:135663435-135663457 AGGGAGAATCGGTTGAACCCGGG - Intronic
1033003433 7:137533194-137533216 CGGGAGGATCACTTGAACTCAGG + Intronic
1033154663 7:138946684-138946706 TGGGAGGATCACTTGAACTCTGG + Intronic
1033332312 7:140426932-140426954 TGGGAGAACCTCTTGAACCCAGG - Intergenic
1033344277 7:140515205-140515227 TGGGAGGATCACTTGAACTCAGG - Intergenic
1033346913 7:140532795-140532817 TGGGAGGATCTCTTGATCTCTGG + Intronic
1033923504 7:146426091-146426113 AAGGAGAATCTTTTGAACTCGGG + Intronic
1034709680 7:153180066-153180088 TGGGAGGATCTGTTGAGCCCAGG - Intergenic
1035786156 8:2262911-2262933 AGGGAGGACTGGTTGAGCCCAGG - Intergenic
1035806651 8:2458805-2458827 AGGGAGGACTGGTTGAGCCCAGG + Intergenic
1036564222 8:9924608-9924630 CGGGAGGATCACTTGAACTCAGG - Intergenic
1036944985 8:13086794-13086816 AGGGAGGACTGCTTGAGCTCAGG + Intronic
1037020942 8:13969248-13969270 AGGGAGAATCACTTGAACTCAGG + Intergenic
1037597555 8:20367078-20367100 AGGGAGGATCATTTGAGCTCAGG - Intergenic
1037737141 8:21577022-21577044 AGGGAGGATCTCTTGAGCCCAGG - Intergenic
1038660904 8:29495948-29495970 TGGGAGGATCTCTTGAGCTCAGG - Intergenic
1038770318 8:30472846-30472868 TGGGAGGATCTCTTGAGCTCAGG + Intronic
1038908516 8:31935348-31935370 CGGGAGGACCACTTGAACACAGG - Intronic
1038908540 8:31935483-31935505 CGGGAGGACCACTTGAACACAGG - Intronic
1038969682 8:32619119-32619141 TGGGAGGATCACTTGAACTCAGG + Intronic
1039015248 8:33141026-33141048 TGGGAGGATCTTTTGAGCTCAGG - Intergenic
1039524890 8:38205982-38206004 AGGGAGGATCACTTGAGCTCAGG - Intronic
1039630515 8:39107312-39107334 AGGGAGGATCACTTGAACCCAGG + Intronic
1039677318 8:39683907-39683929 TGGGAGGATCAGTTGAGCTCAGG + Intronic
1039706711 8:40015061-40015083 TGGGAGGATCACTTGAACTCAGG + Intronic
1039815095 8:41086784-41086806 AGGGAGGAACTCTTGAGCCCAGG - Intergenic
1039873793 8:41568555-41568577 CAGGAGGACCAGTTGAACCCAGG - Intergenic
1039963700 8:42269225-42269247 CGGGAGGACCCCTTGAACCCAGG + Intergenic
1039981857 8:42415084-42415106 AGGAAGAAGCTGGTGAACTCAGG + Intergenic
1040051295 8:43016944-43016966 TGGGAGGATCTCTTGAACCCAGG + Intronic
1040367785 8:46736685-46736707 AGGGAGGACTGCTTGAAGTCAGG - Intergenic
1040462110 8:47659165-47659187 TGGGAGGACCAGTTGAGCCCAGG + Intronic
1040523351 8:48196759-48196781 TGGGAGGACCACTTGAGCTCAGG + Intergenic
1040939851 8:52821193-52821215 AGGGATGACCTGGTGAACTCCGG - Intergenic
1041008991 8:53523231-53523253 AAAAAGGGCCTGTTGAACTCTGG - Intergenic
1041068955 8:54107679-54107701 AGGGAGAATCTCTTGAACCCGGG + Intergenic
1041256209 8:55981581-55981603 TGGGAGGACTGCTTGAACTCAGG - Intronic
1042146528 8:65735716-65735738 CGGGAGGATCACTTGAACTCAGG - Intronic
1042153227 8:65812112-65812134 TGGGAGGATCATTTGAACTCAGG + Intronic
1042246899 8:66717110-66717132 CAGGAGAACCTCTTGAACTCAGG + Intronic
1042323456 8:67503387-67503409 AGGGAGGACCTGTTGAACTCAGG - Intronic
1042352240 8:67789094-67789116 TGGGAGGACCACTTGAACCCAGG + Intergenic
1042412696 8:68482500-68482522 TGGGAGGATCACTTGAACTCAGG - Intronic
1042450740 8:68942616-68942638 AGGGAGAATCGCTTGAACTCGGG - Intergenic
1042601650 8:70504683-70504705 TGGGAGGATCGCTTGAACTCAGG - Intergenic
1042830493 8:73022526-73022548 TGGGAGGATCTCTTGAGCTCAGG + Intronic
1042890304 8:73602628-73602650 AGGGAGGATCTCTTGAGCCCAGG + Intronic
1042903537 8:73750473-73750495 AGGGAGGATCTCTTGAAACCAGG + Intronic
1043218813 8:77631546-77631568 TGGGAGGATCCTTTGAACTCAGG + Intergenic
1043863916 8:85354054-85354076 TGGGAGGATCTCTTGAACCCAGG - Intronic
1043865181 8:85366238-85366260 AGGGAGGATCACTTGAGCTCAGG - Intronic
1044094800 8:88049930-88049952 TGGGAGGATCTGTTGAGCCCAGG + Intronic
1044443336 8:92245619-92245641 TGGGAGGATCTGTTGAGCCCAGG + Intergenic
1044460781 8:92441668-92441690 AGGGAGGATCACTTGAACGCCGG + Intergenic
1044728717 8:95213605-95213627 CGGGAGGATCTCTTGAGCTCAGG - Intergenic
1044734702 8:95268218-95268240 CGGGAGGACAGCTTGAACTCAGG + Intronic
1044818659 8:96139803-96139825 AGGGAGAACCGCTTGAACCCAGG + Intergenic
1045107466 8:98906918-98906940 AGGGAGGATCTGTTGAGACCAGG + Intronic
1045259060 8:100556246-100556268 CTGGAGGATCTGTTGAGCTCAGG - Intronic
1045279020 8:100732846-100732868 TGGGAGGATCACTTGAACTCAGG + Intergenic
1045525310 8:102936339-102936361 TGGGAGGATCTCTTGAACTCAGG + Intronic
1046134540 8:110009947-110009969 AAGGAGAATCTCTTGAACTCAGG - Intergenic
1046465990 8:114604043-114604065 AGGGAGGATCACTTGAACCCAGG - Intergenic
1046956918 8:120071380-120071402 GGGGAGGATCACTTGAACTCAGG + Intronic
1046967182 8:120180798-120180820 CAGGAGAATCTGTTGAACTCAGG - Intronic
1047242962 8:123109999-123110021 AGGGAGAATCGGTTGAACCCTGG + Intronic
1047567668 8:126063257-126063279 TGGGAGGATCTCTTGAGCTCAGG - Intergenic
1047668586 8:127119892-127119914 TGGGAGGACCACTTGAACCCAGG - Intergenic
1048034699 8:130666374-130666396 AGGGAGGACTTGCTGAATTACGG - Intergenic
1048317205 8:133371137-133371159 AGGGAGGACCCTGTGAACTGGGG - Intergenic
1048741534 8:137566210-137566232 TGGGAGGACCATTTGAAGTCAGG - Intergenic
1048783258 8:138023941-138023963 AGGGAGGATCGCTTGAACCCAGG + Intergenic
1049144544 8:140989148-140989170 CGGGAGGACTGGTTGAGCTCAGG + Intronic
1049426699 8:142541015-142541037 AGGGAGCAGCTGGTGAACACAGG + Intronic
1049527883 8:143138000-143138022 TGGGAGGACCCCTTGAGCTCAGG - Intergenic
1049754881 8:144306453-144306475 AGGGAGGATCCCTTGAGCTCCGG - Intronic
1049879117 8:145050094-145050116 AGGGAGGATCAGTTGAGCCCAGG + Intergenic
1049995889 9:1033134-1033156 AGGGAGGACCGCTTGAGCTGGGG + Intergenic
1050511033 9:6395941-6395963 AGGGAGGATCACTTGAGCTCAGG - Intergenic
1050879109 9:10676790-10676812 AGGGAGGACCTCTTAAGCCCAGG - Intergenic
1051253745 9:15190436-15190458 TGGGAGGATCAGTTGAACCCAGG - Intronic
1051412493 9:16804967-16804989 TGGGAGAATCTCTTGAACTCGGG + Intronic
1051423737 9:16914165-16914187 TGGGAGGACCTCTTGATCCCAGG - Intergenic
1052281437 9:26737476-26737498 AGGGAGGATCACTTGAACCCAGG + Intergenic
1052924144 9:34000205-34000227 CGGCAGGATCTCTTGAACTCAGG - Intronic
1052927803 9:34031907-34031929 AGGGAGGACTTCTTGAGCCCAGG + Intronic
1052958361 9:34272849-34272871 AGAGAGGACTGCTTGAACTCAGG - Intronic
1052967678 9:34353148-34353170 TGGGAGGATCAGTTGAGCTCTGG + Intergenic
1053022383 9:34703943-34703965 TGGGAGGATCTCTTGAACTCAGG - Intergenic
1053154335 9:35765031-35765053 CAGGAGGATCTCTTGAACTCAGG + Intergenic
1053167990 9:35858195-35858217 AGGGAGGATCGCTTGAACTTGGG - Intergenic
1053331014 9:37207031-37207053 AGGGAGGATCGCTTGAACCCAGG + Intronic
1053797393 9:41739155-41739177 TGGGAGGATCACTTGAACTCAGG + Intergenic
1054147798 9:61575791-61575813 TGGGAGGATCATTTGAACTCAGG - Intergenic
1054185808 9:61951207-61951229 TGGGAGGATCACTTGAACTCAGG + Intergenic
1054467540 9:65506835-65506857 TGGGAGGATCACTTGAACTCAGG - Intergenic
1054652703 9:67637315-67637337 TGGGAGGATCACTTGAACTCAGG - Intergenic
1055306858 9:74938364-74938386 TGGGAGGATCGCTTGAACTCAGG + Intergenic
1055655462 9:78446399-78446421 TGGGAGGATCGCTTGAACTCAGG + Intergenic
1056115287 9:83435325-83435347 AGGGAGGATCTCATGAAATCAGG + Intronic
1056342678 9:85653175-85653197 GGGGGGGATCTCTTGAACTCAGG + Intronic
1057039286 9:91835747-91835769 AGGGTGCACCTGTGGAGCTCAGG + Intronic
1057064855 9:92039052-92039074 TGGGAGGATCGCTTGAACTCAGG + Intronic
1057217843 9:93239210-93239232 AGTGAGGACCTGCAGAACTGGGG - Intronic
1057496002 9:95561844-95561866 AGCCAGCACTTGTTGAACTCAGG - Intergenic
1057643550 9:96852410-96852432 AGGGAGGACAGCTTGAGCTCAGG + Intronic
1057769321 9:97953207-97953229 TGGGAGAATCAGTTGAACTCAGG + Intergenic
1057856176 9:98602516-98602538 AGGGAGGATCATTTGAGCTCAGG - Intronic
1058010539 9:99971930-99971952 TGGGAGGATCACTTGAACTCAGG + Intergenic
1058040134 9:100293933-100293955 AGGGAGGATCACTTGAACCCAGG + Intronic
1058688951 9:107503051-107503073 TGGGAGGACCACTTGAACCCAGG + Intergenic
1058723397 9:107779252-107779274 TGGGAGGATCCTTTGAACTCAGG + Intergenic
1058867654 9:109176344-109176366 AGGGAGGATCCCTTGAAGTCAGG - Intronic
1059456837 9:114405165-114405187 TGGGAGGACCACTTGAACCCAGG - Intronic
1059476256 9:114550425-114550447 TTGGAGGACCTGCTGAAGTCTGG + Intergenic
1059478281 9:114567079-114567101 TGGGAGGATCAGTTGAGCTCAGG - Intergenic
1059500537 9:114749592-114749614 AGGGAGGATCACTTGAGCTCAGG + Intergenic
1059786322 9:117589182-117589204 CGGGAGGATCACTTGAACTCGGG + Intergenic
1060136534 9:121160884-121160906 AGGGAGGATCCCTTGAGCTCAGG + Intronic
1060652029 9:125336573-125336595 AGGGAGGACCGCTTGAGCCCAGG - Intronic
1060963573 9:127698991-127699013 AGGGAGGATCGCTTGAACCCGGG - Intronic
1061050625 9:128192633-128192655 CGGGAGGACCACTTGAACCCAGG - Intronic
1061437267 9:130572409-130572431 CGGGAGGACTGCTTGAACTCAGG + Intergenic
1061638511 9:131931150-131931172 AGGGAGGATCACTTGAGCTCAGG + Intronic
1061810271 9:133158369-133158391 TGGGAGGACCGCTTGAGCTCAGG - Intronic
1062048632 9:134435956-134435978 AGGGAGGACCGCTTGAGCCCAGG - Intronic
1062469909 9:136697797-136697819 AGGCAGGACCAGATGAATTCTGG + Intergenic
1062576057 9:137208729-137208751 CGGGAGGAGCTCTTGAACTTGGG + Intronic
1185481522 X:450066-450088 TGGGAGGATCAGTTGAGCTCAGG - Intergenic
1185481599 X:450531-450553 TGGGAGGATCAGTTGAGCTCAGG - Intergenic
1185645719 X:1614318-1614340 TGGGAGGATCTCTTGAAGTCAGG + Intergenic
1185710245 X:2297845-2297867 AGGGAGGATCACTTGAACTCGGG - Intronic
1185785359 X:2886479-2886501 TGGGAGGATCAGTTGAACCCAGG - Intergenic
1185799128 X:2993631-2993653 TGGGAGGATCTCTTGAGCTCAGG - Intergenic
1185834584 X:3333208-3333230 AGGGAAGACCACTTGAACCCAGG + Intronic
1185873836 X:3685951-3685973 AGGGAGGATCTCTTGAGCCCAGG + Intronic
1186178264 X:6947697-6947719 TGGGAGGATCAGTTGAGCTCAGG + Intergenic
1186213655 X:7276376-7276398 TGGGAGGACGTCTTGAACCCAGG + Intronic
1186331344 X:8537680-8537702 TGGGAGGATCGCTTGAACTCAGG + Intronic
1186449342 X:9659050-9659072 GGGGAGGATCTCTTGAACCCAGG - Intronic
1186489513 X:9960562-9960584 AGGGAGGATCTCTTGAGCCCAGG + Intergenic
1186766086 X:12771929-12771951 CGGGAGGATCTCTTGAGCTCAGG - Intergenic
1186836964 X:13447883-13447905 TGGGAGGACTGCTTGAACTCAGG - Intergenic
1186882756 X:13882585-13882607 AAGGAGGATCGCTTGAACTCAGG + Intronic
1186882861 X:13883753-13883775 AAGGAGGATCGCTTGAACTCAGG + Intronic
1187253782 X:17623018-17623040 TGGGAGGATCAGTTGAGCTCCGG - Intronic
1187412948 X:19066689-19066711 AGGGAGGATCATTTGAACCCAGG - Intronic
1187485745 X:19701492-19701514 GGGGAGGACCTGTGAAACTTTGG - Intronic
1187676540 X:21721932-21721954 CAGGAGGATCTTTTGAACTCAGG + Intronic
1187692857 X:21888889-21888911 AGGGAGGATCACTTGATCTCAGG - Intergenic
1187697257 X:21934825-21934847 TGGGAGGATCAATTGAACTCAGG + Intergenic
1187923473 X:24228822-24228844 AGGGAGGATCACTTGAACCCAGG - Intergenic
1188431629 X:30109989-30110011 AGGGAGAATCTCTTGAACCCTGG + Intergenic
1188689910 X:33116414-33116436 TGGGAGGATCACTTGAACTCAGG + Intronic
1188864478 X:35298687-35298709 AGGGAGGATCGCTTGAGCTCAGG - Intergenic
1189150860 X:38705155-38705177 AGGGAGGATCACTTGAACTCAGG + Intergenic
1189408769 X:40750642-40750664 AGGGAGGATCACTTGAACCCAGG - Intergenic
1189517652 X:41731325-41731347 TGGGAGGATCTGTTGAGCCCAGG + Intronic
1189651473 X:43194523-43194545 TGGGAGGATCACTTGAACTCAGG - Intergenic
1189723120 X:43940656-43940678 AAGGAGGACCTCTTGAGCCCAGG + Intergenic
1189983970 X:46537176-46537198 AAGGAGAATCTCTTGAACTCGGG + Intronic
1190013342 X:46804465-46804487 AGGGTGGATCTCTTGAAGTCAGG + Intergenic
1190100683 X:47520619-47520641 TGGGAGGATCTCTTGAGCTCAGG + Intergenic
1190172779 X:48124841-48124863 CGGGAGGATCACTTGAACTCGGG + Intergenic
1190179813 X:48182697-48182719 CGGGAGGATCACTTGAACTCGGG - Intergenic
1190184742 X:48223773-48223795 TGGGAGGATCACTTGAACTCGGG + Intronic
1190190267 X:48271165-48271187 CGGGAGGATCATTTGAACTCGGG + Intronic
1190192822 X:48291937-48291959 CGGGAGGATCATTTGAACTCGGG - Intergenic
1190197330 X:48330634-48330656 CGGGAGGATCACTTGAACTCGGG + Intergenic
1190257176 X:48772306-48772328 AGGGAGGATCACTTGAACCCAGG + Intronic
1190659000 X:52637655-52637677 CGGGAGGATCATTTGAACTCGGG + Intergenic
1190662925 X:52671240-52671262 TGGGAGGACAGCTTGAACTCAGG - Intronic
1190664066 X:52681043-52681065 CGGGAGGATCACTTGAACTCGGG + Intronic
1190675356 X:52777379-52777401 CGGGAGGATCACTTGAACTCGGG - Intronic
1190676498 X:52787242-52787264 TGGGAGGACAGCTTGAACTCAGG + Intronic
1190677392 X:52793868-52793890 CGGGAGGATCATTTGAACTCGGG + Intergenic
1190692769 X:52925707-52925729 TGGGAGGATCTCTTGAGCTCAGG - Intergenic
1190744885 X:53316591-53316613 AGGGAGGACCGCTTGAGCCCAGG + Intronic
1190837499 X:54114535-54114557 AGGGAGGATCACTTGAACCCCGG - Intronic
1190865159 X:54378300-54378322 TGGGAGGATCTCTTGAACTCTGG - Intergenic
1190865683 X:54382620-54382642 AGGGAGGATCCTTTGAGCTCAGG + Intergenic
1190865822 X:54383627-54383649 AGGGAGGATCCTTTGAGCTCAGG + Intergenic
1192108977 X:68344645-68344667 AGGGAGGAGCGCTTGAACCCAGG + Intronic
1192556095 X:72090678-72090700 AGGGAGGAGCTGTTAAAGTGGGG - Intergenic
1192774939 X:74233918-74233940 TGGGAGGACCATTTGAACTCAGG + Intergenic
1194283391 X:91980660-91980682 CGGGATGATCTGTTGAGCTCAGG - Intronic
1194727850 X:97419150-97419172 TGGGAGGATCTCTTGAGCTCAGG - Intronic
1195910299 X:109882572-109882594 TGGGAGGACCACTTGAACCCAGG + Intergenic
1196063657 X:111438821-111438843 CAGGTGGATCTGTTGAACTCAGG - Intergenic
1196349950 X:114717162-114717184 TGGGAGGATCCCTTGAACTCAGG - Intronic
1196660977 X:118268329-118268351 TGGGAGGATCGCTTGAACTCAGG + Intergenic
1196851939 X:119946223-119946245 TGGGAGGATCCCTTGAACTCAGG - Intergenic
1196913762 X:120511280-120511302 AGGGAGGATCACTTGAACCCAGG + Intergenic
1196921913 X:120593838-120593860 TGGGAGGATCACTTGAACTCAGG - Intergenic
1197354880 X:125426033-125426055 TGGGAGGATCTTTTGAACTCAGG + Intergenic
1197511913 X:127380369-127380391 CGGGAGGACCACTTGAACCCAGG - Intergenic
1198059860 X:133034773-133034795 TGGGAGGATCTCTTGAGCTCAGG + Intronic
1198083873 X:133264908-133264930 ACGGAGGATCTCTTGAGCTCAGG + Intergenic
1198143282 X:133827850-133827872 AGGGAGGATCCCTTGAACCCGGG + Intronic
1198187514 X:134267957-134267979 TGGGAGGATCTCTTGAACCCAGG - Intergenic
1198363668 X:135920041-135920063 TAGGAGGACCATTTGAACTCAGG + Intergenic
1198405882 X:136311922-136311944 TGGGAGGACCACTTGAGCTCAGG - Intronic
1198411479 X:136373735-136373757 TGGGAGGATCACTTGAACTCAGG + Intronic
1199279684 X:145986323-145986345 AGGGAGGACCAGTTGAGGCCAGG - Intergenic
1199522247 X:148749362-148749384 TGGGAGGATCTGTTGAGCCCGGG - Intronic
1199827426 X:151514629-151514651 TGGGAGGATCACTTGAACTCAGG - Intergenic
1200174031 X:154099223-154099245 AGGGAGGATCGCTTGAGCTCAGG - Intergenic
1200455873 Y:3391716-3391738 TGGGAGGACCACTTGAACTAGGG - Intergenic
1200600964 Y:5205194-5205216 CGGGATGATCTGTTGAGCTCAGG - Intronic
1200765917 Y:7080525-7080547 TGGGAGGACCTCTTGAGCCCAGG + Intronic
1200780085 Y:7206879-7206901 AGGGAGGATCATTTGAACCCAGG + Intergenic
1200790467 Y:7295048-7295070 AGGGAGGATCTCTTGAGCCCAGG - Intergenic
1201255878 Y:12107836-12107858 TGGGAGGATCTCTTGAACCCAGG - Intergenic
1201374352 Y:13300333-13300355 AGGGAGGATCAGTTGAGGTCAGG + Intronic
1201485072 Y:14485357-14485379 TGGGAGGATCACTTGAACTCAGG + Intergenic
1201558555 Y:15290681-15290703 AGGGAGGATCCTTTGAGCTCAGG - Intergenic
1201770655 Y:17614388-17614410 AGGGAGCATCTGTTGAACCACGG - Intergenic
1201830900 Y:18291598-18291620 AGGGAGCATCTGTTGAACCACGG + Intergenic